Statistical Interpretation in Making DNA-based Identification of Mass Victims

Size: px
Start display at page:

Download "Statistical Interpretation in Making DNA-based Identification of Mass Victims"

Transcription

1 Statistical Interretation in Making DNAbased Identification of Mass Victims KyoungJin Shin wan Young Lee Woo Ick Yang Eunho a Det. of Forensic Medicine Yonsei University College of Medicine Det. of Information and Statistics Yonsei University DNAbased Identification of Mass Victims Direct Matching assesses the robability or likelihood that a DNA rofile from a victim s remains and a rofile develoed from a ersonal item known to belong to a missing individual would shareby chancethe same DNA rofile Indirect Matching uses methods of formal genetic kinshi htt://

2 Consideration for DNAbased Identification of Mass Victims Calculation of likelihood ratio LR Various kinshi Numerous families Allele droin and droout Estimation of cold hit Evaluation of DNA Analysis Odds Form of Bayes Theorem d E E E E d d osterior Odds Likelihood Ratio rior Odds

3 3 Kinshi robability LR LR 5 robability rior if ] [ + + E. LR LR E and two individuals of genotyes the be and. unrelated are and : etc. cousins full sibs child arent for examle related are and :. d LR d d d d d

4 Use of the IBD robabilities According to Balding and Nichols Forensic Sci Int.994;64 :5 4 Z Z Z : : : alleles allele alleles are identical by descent with is identical by descent with are identical by descent with robability robability robability Z + + Z Z The likelihood Ratio for the roosition That the Individuals and are Related Versus Unrelated d LR d aa ab aa ab bb or bc aa ab ac cc or cd + + a a 4 + a a b + + a 4a a b and ; the robabilities that and share or airs of autosomal STR alleles identicalbydecent 4

5 The robabilities and that a iven Relative and Me Share or airs of Autosomal STR Alleles Identicalbydescent Legend: reat reat randarent 7/8 /8 Relationshi reat randarent 3/4 /4 reat rand Uncle reat rand Aunt 7/8 /8 randarent / / rand Uncle rand Aunt 3/4 /4 First Cousin of randarent 5/6 /6 Mother Father Unrelated Uncle/Aunt / / First Cousin of arent 7/8 /8 Second Cousin of arent 3/3 /3 Me Full Sibling alf Sibling First Cousin Second Cousin Third Cousin /4 / /4 / / 3/4 /4 5/6 /6 63/64 /64 eneral Formula for LR Calculation According to Brenner and Weir Theor oul Biol. 3;63:73 8. a If two genotyes with susected relationshis are ab and cd define the four mating combinations : ac; : ad; 3: bc; 4 : bd. b If the two alleles in the ith air are the same tye then ui is the recirocal of the frequency of that allele. Otherwise ui. u + u + u 3 + u. a U 4 uu 4 + u u 3 b W 3. LR + U + W 4 5

6 Common IBD robabilities and LR Relationshi LR + U + W Not related LR Same individual LR W Discrimination index arentchild LR U aternity Index randarentgrandchild ½ ½ LR ½ + ½ U Full sibs ¼ ½ ¼ LR ¼ + ½ U + ¼ W alf sibs ½ ½ LR ½ + ½ U Unclenehew ½ ½ LR ½ + ½ U First cousin ¾ ¼ LR ¾ + ¼ U 6

7 Distribution of the LR Buckleton et al. Forensic DNA Evidence Interretation enotying of ighly Degraded DNA Efficient DNA extraction MiniSTR Identifiler + Minifiler ABI Yfiler + Yminilex ark et al 7 LR calculation should be modified in light of allele droout 7

8 The Likelihood Ratio LR for the roosition that the Individuals and are Related versus Unrelated d where a articular Allele in the rofile has Droed Out an an aa + LR d D + a + + D ad + Da ab D+ + D a + D + ad + Da bb or bc D + D + Da D ; the robability that a articular allele in rofile has droed out ; the robabilities that and share or air of autosomal STR alleles identicalbydescent LR equation from Buckleton et al. of which some notations are modified 8

9 Mitochondrial DNA Control Region Sequence of a Victim and the Alleged Brother Samle V V V3 alo grou Victim 63T636C 7394T63 39.C35.C 489C53d54d D4bb Brother 63T636C 7394T63 39.C35.C 489C53d54d D4bb Match robability /44 enotying of YSTRs using Yfiler kit from a Victim 9

10 enotying of YSTRs using Yminilex from a Victim YSTR enotyes of a Victim and the Alleged Brother STR locus DYS9 DYS389I DYS389II DYS39 DYS39 DYS39 DYS393 DYS385a/b DYS437 DYS438 DYS439 DYS448 DYS456 DYS458 DYS635 ATA 4. Allele Victim Brother Match robability /33 Shared Allele

11 enotying of Autosomal STRs using Identifiler kit from a Victim enotying of Autosomal STRs using Minifiler kit from a Victim

12 An Examle of Likelihood Ratio LR Calculation for Full Sibling with robabilities of Droout : D ¼ and ½ STR Locus Victim enotye Brother D LR Sibling Index D 4 D D8S DS D7S CSFO D3S T D3S D6S DS D9S vwa TOX 8 D8S D5S FA Cummulative LR The STR loci and alleles which have ossibility of allele droout and their LRs are reresented in bold italic. robability for Kinshi Determination N: No. of victims M: No. of genotyed skeletal remains n: No. of genotyed families M N M k n k X k N n 단 n k N M k n k M n N

13 Estimation of Cold it M E X n N For examle identification of Korean War victims Summary A simle and general formula for likelihood ratio calculation Evaluation of kinshi index in light of allele droout Estimation of cold hit in DNAbased identification on oen forms of mass disaster 3

14 Consideration for Use of LR LR threshold for determination of kinshi Rate of allele droout Degree of DNA degradation STR locus used in CR system Strategy to increase LR Use of mtdna YSTR halotyes Combined calculation of two more relatives genotyes Thank you for your attention! htt://forensic.yonsei.ac.kr 4

AFDAA 2012 WINTER MEETING Population Statistics Refresher Course - Lecture 3: Statistics of Kinship Analysis

AFDAA 2012 WINTER MEETING Population Statistics Refresher Course - Lecture 3: Statistics of Kinship Analysis AFDAA 2012 WINTER MEETING Population Statistics Refresher Course - Lecture 3: Statistics of Kinship Analysis Ranajit Chakraborty, PhD Center for Computational Genomics Institute of Applied Genetics Department

More information

DNA Parentage Test No Summary Report

DNA Parentage Test No Summary Report Collaborative Testing Services, Inc FORENSIC TESTING PROGRAM DNA Parentage Test No. 165871 Summary Report This proficiency test was sent to 45 participants. Each participant received a sample pack consisting

More information

DNA Parentage Test No Summary Report

DNA Parentage Test No Summary Report Collaborative Testing Services, Inc FORENSIC TESTING PROGRAM DNA Parentage Test No. 175871 Summary Report This proficiency test was sent to 45 participants. Each participant received a sample pack consisting

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/1122655/dc1 Supporting Online Material for Finding Criminals Through DNA of Their Relatives Frederick R. Bieber,* Charles H. Brenner, David Lazer *Author for correspondence.

More information

Popstats Parentage Statistics Strength of Genetic Evidence In Parentage Testing

Popstats Parentage Statistics Strength of Genetic Evidence In Parentage Testing Popstats Parentage Statistics Strength of Genetic Evidence In Parentage Testing Arthur J. Eisenberg, Ph.D. Director DNA Identity Laboratory UNT-Health Science Center eisenber@hsc.unt.edu PATERNITY TESTING

More information

ICMP DNA REPORTS GUIDE

ICMP DNA REPORTS GUIDE ICMP DNA REPORTS GUIDE Distribution: General Sarajevo, 16 th December 2010 GUIDE TO ICMP DNA REPORTS 1. Purpose of This Document 1. The International Commission on Missing Persons (ICMP) endeavors to secure

More information

Large scale kinship:familial Searching and DVI. Seoul, ISFG workshop

Large scale kinship:familial Searching and DVI. Seoul, ISFG workshop Large scale kinship:familial Searching and DVI Seoul, ISFG workshop 29 August 2017 Large scale kinship Familial Searching: search for a relative of an unidentified offender whose profile is available in

More information

Primer on Human Pedigree Analysis:

Primer on Human Pedigree Analysis: Primer on Human Pedigree Analysis: Criteria for the selection and collection of appropriate Family Reference Samples John V. Planz. Ph.D. UNT Center for Human Identification Successful Missing Person ID

More information

DNA: Statistical Guidelines

DNA: Statistical Guidelines Frequency calculations for STR analysis When a probative association between an evidence profile and a reference profile is made, a frequency estimate is calculated to give weight to the association. Frequency

More information

DNA Parentage Test No Summary Report

DNA Parentage Test No Summary Report Collaborative Testing Services, Inc FORENSIC TESTING PROGRAM DNA Parentage Test No. 155872 Summary Report This proficiency test was sent to 38 participants. Each participant received a sample pack consisting

More information

Investigations from last time. Inbreeding and neutral evolution Genes, alleles and heterozygosity

Investigations from last time. Inbreeding and neutral evolution Genes, alleles and heterozygosity Investigations from last time. Heterozygous advantage: See what happens if you set initial allele frequency to or 0. What happens and why? Why are these scenario called unstable equilibria? Heterozygous

More information

DNA Interpretation Test No Summary Report

DNA Interpretation Test No Summary Report Collaborative Testing Services, Inc FORENSIC TESTING PROGRAM DNA Interpretation Test No. 17-588 Summary Report This proficiency test was sent to 3 participants. Each participant received a sample pack

More information

Web-based Y-STR database for haplotype frequency estimation and kinship index calculation

Web-based Y-STR database for haplotype frequency estimation and kinship index calculation 20-05-29 Web-based Y-STR database for haplotype frequency estimation and kinship index calculation In Seok Yang Dept. of Forensic Medicine Yonsei University College of Medicine Y chromosome short tandem

More information

4. Kinship Paper Challenge

4. Kinship Paper Challenge 4. António Amorim (aamorim@ipatimup.pt) Nádia Pinto (npinto@ipatimup.pt) 4.1 Approach After a woman dies her child claims for a paternity test of the man who is supposed to be his father. The test is carried

More information

DNA Parentage Test No Summary Report

DNA Parentage Test No Summary Report Collaborative Testing Services, Inc FORENSIC TESTING PROGRAM DNA Parentage Test No. 16-5870 Summary Report This proficiency test was sent to 27 participants. Each participant received a sample pack consisting

More information

On identification problems requiring linked autosomal markers

On identification problems requiring linked autosomal markers * Title Page (with authors & addresses) On identification problems requiring linked autosomal markers Thore Egeland a Nuala Sheehan b a Department of Medical Genetics, Ulleval University Hospital, 0407

More information

Non-Paternity: Implications and Resolution

Non-Paternity: Implications and Resolution Non-Paternity: Implications and Resolution Michelle Beckwith PTC Labs 2006 AABB HITA Meeting October 8, 2006 Considerations when identifying victims using relatives Identification requires knowledge of

More information

Automated Discovery of Pedigrees and Their Structures in Collections of STR DNA Specimens Using a Link Discovery Tool

Automated Discovery of Pedigrees and Their Structures in Collections of STR DNA Specimens Using a Link Discovery Tool University of Tennessee, Knoxville Trace: Tennessee Research and Creative Exchange Masters Theses Graduate School 5-2010 Automated Discovery of Pedigrees and Their Structures in Collections of STR DNA

More information

Free Online Training

Free Online Training Using DNA and CODIS to Resolve Missing and Unidentified Person Cases B.J. Spamer NamUs Training and Analysis Division Office: 817-735-5473 Cell: 817-964-1879 Email: BJ.Spamer@unthsc.edu Free Online Training

More information

Methods of Parentage Analysis in Natural Populations

Methods of Parentage Analysis in Natural Populations Methods of Parentage Analysis in Natural Populations Using molecular markers, estimates of genetic maternity or paternity can be achieved by excluding as parents all adults whose genotypes are incompatible

More information

MATH & STAT Ch.1 Permutations & Combinations JCCSS

MATH & STAT Ch.1 Permutations & Combinations JCCSS THOMAS / 6ch1.doc / P.1 1.1 The Multilication Princile of Counting P.2 If a first oeration can be erformed in n 1 ways, a second oeration in n 2 ways, a third oeration in n 3 ways, and so forth, then the

More information

1/8/2013. Free Online Training. Using DNA and CODIS to Resolve Missing and Unidentified Person Cases. Click Online Training

1/8/2013. Free Online Training. Using DNA and CODIS to Resolve Missing and Unidentified Person Cases.  Click Online Training Free Online Training Using DNA and CODIS to Resolve Missing and Unidentified Person Cases B.J. Spamer NamUs Training and Analysis Division Office: 817-735-5473 Cell: 817-964-1879 Email: BJ.Spamer@unthsc.edu

More information

Statistical methods in genetic relatedness and pedigree analysis

Statistical methods in genetic relatedness and pedigree analysis Statistical methods in genetic relatedness and pedigree analysis Oslo, January 2018 Magnus Dehli Vigeland and Thore Egeland Exercise set III: Coecients of pairwise relatedness Exercise III-1. Use Wright's

More information

University of Washington, TOPMed DCC July 2018

University of Washington, TOPMed DCC July 2018 Module 12: Comput l Pipeline for WGS Relatedness Inference from Genetic Data Timothy Thornton (tathornt@uw.edu) & Stephanie Gogarten (sdmorris@uw.edu) University of Washington, TOPMed DCC July 2018 1 /

More information

Lecture 1: Introduction to pedigree analysis

Lecture 1: Introduction to pedigree analysis Lecture 1: Introduction to pedigree analysis Magnus Dehli Vigeland NORBIS course, 8 th 12 th of January 2018, Oslo Outline Part I: Brief introductions Pedigrees symbols and terminology Some common relationships

More information

DNA Parentage Test No Summary Report

DNA Parentage Test No Summary Report Collaborative Testing Services, Inc FORENSIC TESTING PROGRAM DNA Parentage Test No. 175872 Summary Report This proficiency test was sent to 42 participants. Each participant received a sample pack consisting

More information

Lutz Roewer, Sascha Willuweit Dept. Forensic Genetics, Institute of Legal Medicine and Forensic Sciences Charité Universitätsmedizin Berlin, Germany

Lutz Roewer, Sascha Willuweit Dept. Forensic Genetics, Institute of Legal Medicine and Forensic Sciences Charité Universitätsmedizin Berlin, Germany The new YHRD Lutz Roewer, Sascha Willuweit Dept. Forensic Genetics, Institute of Legal Medicine and Forensic Sciences Charité Universitätsmedizin Berlin, Germany 2000 2004 2008 2014 Aug 99 Jun 00 Jan 03

More information

1) Using the sightings data, determine who moved from one area to another and fill this data in on the data sheet.

1) Using the sightings data, determine who moved from one area to another and fill this data in on the data sheet. Parentage and Geography 5. The Life of Lulu the Lioness: A Heroine s Story Name: Objective Using genotypes from many individuals, determine maternity, paternity, and relatedness among a group of lions.

More information

Autosomal DNA. What is autosomal DNA? X-DNA

Autosomal DNA. What is autosomal DNA? X-DNA ANGIE BUSH AND PAUL WOODBURY info@thednadetectives.com November 1, 2014 Autosomal DNA What is autosomal DNA? Autosomal DNA consists of all nuclear DNA except for the X and Y sex chromosomes. There are

More information

CONGEN. Inbreeding vocabulary

CONGEN. Inbreeding vocabulary CONGEN Inbreeding vocabulary Inbreeding Mating between relatives. Inbreeding depression Reduction in fitness due to inbreeding. Identical by descent Alleles that are identical by descent are direct descendents

More information

GliesianDNA (BETA) atdna Relationships Predictions for cms with no influence factors

GliesianDNA (BETA) atdna Relationships Predictions for cms with no influence factors GliesianDNA (BETA) atdna Relationships Predictions for 562.3 cms with no influence factors Report generated on: 2018-07-07T13:08:31.511 by Gliesian, LLC's GliesianDNA (beta), version 0.4.1 Introduction

More information

Family Tree DNA Genetic Genealogy Started Here

Family Tree DNA Genetic Genealogy Started Here Family Tree DNA Genetic Genealogy Started Here With 253,000 samples in our DNA database (the largest of its kind in the world) your genealogical search could become even easier Why Bennett Greenspan founded

More information

New Advances Reconstructing the Y Chromosome Haplotype of Napoléon the First Based on Three of his Living Descendants

New Advances Reconstructing the Y Chromosome Haplotype of Napoléon the First Based on Three of his Living Descendants Journal of Molecular Biology Research; Vol. 5, No. 1; 20 ISSN 125-430X E-ISSN 125-4318 Published by Canadian Center of Science and Education New Advances Reconstructing the Y Chromosome Haplotype of Napoléon

More information

DNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding

DNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding DNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding by Dr. Ing. Robert L. Baber 2014 July 26 Rights reserved, see the copyright notice at http://gengen.rlbaber.de

More information

Mix & match: Getting comfortable with DNA reporting. Elmira, New York. Cybergenetics People of New York v Casey Wilson

Mix & match: Getting comfortable with DNA reporting. Elmira, New York. Cybergenetics People of New York v Casey Wilson Mix & match: Getting comfortable with DNA reporting What s in a Match? How to read a forensic DNA report Duquesne University October, 2015 Pittsburgh, PA Mark W Perlin, PhD, MD, PhD Cybergenetics, Pittsburgh,

More information

Kinship and Population Subdivision

Kinship and Population Subdivision Kinship and Population Subdivision Henry Harpending University of Utah The coefficient of kinship between two diploid organisms describes their overall genetic similarity to each other relative to some

More information

Kinship/relatedness. David Balding Professor of Statistical Genetics University of Melbourne, and University College London.

Kinship/relatedness. David Balding Professor of Statistical Genetics University of Melbourne, and University College London. Kinship/relatedness David Balding Professor of Statistical Genetics University of Melbourne, and University College London 2 Feb 2016 1 Ways to measure relatedness 2 Pedigree-based kinship coefficients

More information

Statistical DNA Forensics Theory, Methods and Computation

Statistical DNA Forensics Theory, Methods and Computation Statistical DNA Forensics Theory, Methods and Computation Wing Kam Fung and Yue-Qing Hu Department of Statistics and Actuarial Science, The University of Hong Kong, Hong Kong Statistical DNA Forensics

More information

Statistical DNA Forensics Theory, Methods and Computation

Statistical DNA Forensics Theory, Methods and Computation Statistical DNA Forensics Theory, Methods and Computation Wing Kam Fung and Yue-Qing Hu Department of Statistics and Actuarial Science, The University of Hong Kong, Hong Kong Statistical DNA Forensics

More information

GEDmatch Home Page The upper left corner of your home page has Information about you and links to lots of helpful information. Check them out!

GEDmatch Home Page The upper left corner of your home page has Information about you and links to lots of helpful information. Check them out! USING GEDMATCH Created March 2015 GEDmatch is a free, non-profit site that accepts raw autosomal data files from Ancestry, FTDNA, and 23andme. As such, it provides a large autosomal database that spans

More information

An Optimal Algorithm for Automatic Genotype Elimination

An Optimal Algorithm for Automatic Genotype Elimination Am. J. Hum. Genet. 65:1733 1740, 1999 An Optimal Algorithm for Automatic Genotype Elimination Jeffrey R. O Connell 1,2 and Daniel E. Weeks 1 1 Department of Human Genetics, University of Pittsburgh, Pittsburgh,

More information

KINSHIP ANALYSIS AND HUMAN IDENTIFICATION IN MASS DISASTERS: THE USE OF MDKAP FOR THE WORLD TRADE CENTER TRAGEDY

KINSHIP ANALYSIS AND HUMAN IDENTIFICATION IN MASS DISASTERS: THE USE OF MDKAP FOR THE WORLD TRADE CENTER TRAGEDY 1 KINSHIP ANALYSIS AND HUMAN IDENTIFICATION IN MASS DISASTERS: THE USE OF MDKAP FOR THE WORLD TRADE CENTER TRAGEDY Benoît Leclair 1, Steve Niezgoda 2, George R. Carmody 3 and Robert C. Shaler 4 1 Myriad

More information

DNA for Genealogy Librarians. Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District

DNA for Genealogy Librarians. Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District DNA for Genealogy Librarians Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District What does DNA do? It replicates itself. It codes for the production

More information

Objective: Why? 4/6/2014. Outlines:

Objective: Why? 4/6/2014. Outlines: Objective: Develop mathematical models that quantify/model resemblance between relatives for phenotypes of a quantitative trait : - based on pedigree - based on markers Outlines: Causal model for covariances

More information

Received December 28, 1964

Received December 28, 1964 EFFECT OF LINKAGE ON THE GENETIC LOAD MANIFESTED UNDER INBREEDING MASATOSHI NE1 Division of Genetics, National Institute of Radiological Sciences, Chiba, Japan Received December 28, 1964 IN the theory

More information

DNA Basics. OLLI: Genealogy 101 October 1, ~ Monique E. Rivera ~

DNA Basics. OLLI: Genealogy 101 October 1, ~ Monique E. Rivera ~ DNA Basics OLLI: Genealogy 101 October 1, 2018 ~ Monique E. Rivera ~ WHAT IS DNA? DNA (deoxyribonucleic acid) is found in every living cell everywhere. It is a long chemical chain that tells our cells

More information

Detection of Misspecified Relationships in Inbred and Outbred Pedigrees

Detection of Misspecified Relationships in Inbred and Outbred Pedigrees Detection of Misspecified Relationships in Inbred and Outbred Pedigrees Lei Sun 1, Mark Abney 1,2, Mary Sara McPeek 1,2 1 Department of Statistics, 2 Department of Human Genetics, University of Chicago,

More information

Forensic Statistics and Graphical Models (1) Richard Gill Spring Semester 2015

Forensic Statistics and Graphical Models (1) Richard Gill Spring Semester 2015 Forensic Statistics and Graphical Models (1) Richard Gill Spring Semester 2015 http://www.math.leidenuniv.nl/~gill/teaching/graphical Forensic Statistics Distinguish criminal investigation and criminal

More information

CM I. The risk of false inclusion of a relative in parentage testing - an in shico population study

CM I. The risk of false inclusion of a relative in parentage testing - an in shico population study FÜRENSiC SCiENCE CM I 257 Croat Med J.2013i54:25?-e2 doi: 10.3325/cmj.2013.54.2S? The risk of false inclusion of a relative in parentage testing - an in shico population study Aim To investigate the potential

More information

CAGGNI s DNA Special Interest Group

CAGGNI s DNA Special Interest Group CAGGNI s DNA Special Interest Group 10 Jan 2015 Al & Michelle Wilson Agenda Survey Basics in Fan Charts Recombination Exercise Triangulation Overview Survey 1. Have you taken (or sponsored) a DNA test?

More information

DNA Opening Doors for Today s s Genealogist

DNA Opening Doors for Today s s Genealogist DNA Opening Doors for Today s s Genealogist Presented to JGSI Sunday, March 30, 2008 Presented by Alvin Holtzman Genetic Genealogy Discussion Points What is DNA How can it help genealogists What to expect

More information

have to get on the phone or family members for the names of more distant relatives.

have to get on the phone or  family members for the names of more distant relatives. Ideas for Teachers: Give each student the family tree worksheet to fill out at home. Explain to them that each family is different and this worksheet is meant to help them plan their family tree. They

More information

NON-RANDOM MATING AND INBREEDING

NON-RANDOM MATING AND INBREEDING Instructor: Dr. Martha B. Reiskind AEC 495/AEC592: Conservation Genetics DEFINITIONS Nonrandom mating: Mating individuals are more closely related or less closely related than those drawn by chance from

More information

Walter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018

Walter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018 DNA, Ancestry, and Your Genealogical Research- Segments and centimorgans Walter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018 1 Today s agenda Brief review of previous DIG session

More information

BIOL 502 Population Genetics Spring 2017

BIOL 502 Population Genetics Spring 2017 BIOL 502 Population Genetics Spring 2017 Week 8 Inbreeding Arun Sethuraman California State University San Marcos Table of contents 1. Inbreeding Coefficient 2. Mating Systems 3. Consanguinity and Inbreeding

More information

Chapter 2: Genes in Pedigrees

Chapter 2: Genes in Pedigrees Chapter 2: Genes in Pedigrees Chapter 2-0 2.1 Pedigree definitions and terminology 2-1 2.2 Gene identity by descent (ibd) 2-5 2.3 ibd of more than 2 genes 2-14 2.4 Data on relatives 2-21 2.1.1 GRAPHICAL

More information

Forensic use of Y chromosome DNA: a general overview

Forensic use of Y chromosome DNA: a general overview DOI 10.1007/s00439-017-1776-9 REVIEW Forensic use of Y chromosome DNA: a general overview Manfred Kayser 1 Received: 5 February 2017 / Accepted: 8 March 2017 The Author(s) 2017. This article is an open

More information

Introduction to Autosomal DNA Tools

Introduction to Autosomal DNA Tools GENETIC GENEALOGY JOURNEY Debbie Parker Wayne, CG, CGL Introduction to Autosomal DNA Tools Just as in the old joke about a new genealogist walking into the library and asking for the book that covers my

More information

Inbreeding depression in corn. Inbreeding. Inbreeding depression in humans. Genotype frequencies without random mating. Example.

Inbreeding depression in corn. Inbreeding. Inbreeding depression in humans. Genotype frequencies without random mating. Example. nbreeding depression in corn nbreeding Alan R Rogers Two plants on left are from inbred homozygous strains Next: the F offspring of these strains Then offspring (F2 ) of two F s Then F3 And so on November

More information

Pedigree Reconstruction using Identity by Descent

Pedigree Reconstruction using Identity by Descent Pedigree Reconstruction using Identity by Descent Bonnie Kirkpatrick Electrical Engineering and Computer Sciences University of California at Berkeley Technical Report No. UCB/EECS-2010-43 http://www.eecs.berkeley.edu/pubs/techrpts/2010/eecs-2010-43.html

More information

Manual for Familias 3

Manual for Familias 3 Manual for Familias 3 Daniel Kling 1 (daniellkling@gmailcom) Petter F Mostad 2 (mostad@chalmersse) ThoreEgeland 1,3 (thoreegeland@nmbuno) 1 Oslo University Hospital Department of Forensic Services Oslo,

More information

Interpretation errors in DNA profiling

Interpretation errors in DNA profiling Interpretation errors in DNA profiling Dan E. Krane, Wright State University, Dayton, OH Forensic Bioinformatics (www.bioforensics.com) A controversial idea: Analysts should arrive at conclusions about

More information

Inbreeding and self-fertilization

Inbreeding and self-fertilization Inbreeding and self-fertilization Introduction Remember that long list of assumptions associated with derivation of the Hardy-Weinberg principle that we just finished? Well, we re about to begin violating

More information

Bottlenecks reduce genetic variation Genetic Drift

Bottlenecks reduce genetic variation Genetic Drift Bottlenecks reduce genetic variation Genetic Drift Northern Elephant Seals were reduced to ~30 individuals in the 1800s. Rare alleles are likely to be lost during a bottleneck Two important determinants

More information

1.4.1(Question should be rather: Another sibling of these two brothers) 25% % % (population risk of heterozygot*2/3*1/4)

1.4.1(Question should be rather: Another sibling of these two brothers) 25% % % (population risk of heterozygot*2/3*1/4) ----------------------------------------------------------Chapter 1--------------------------------------------------------------- (each task of this chapter is dedicated as x (x meaning the exact task.

More information

Chromosome X haplotyping in deficiency paternity testing principles and case report

Chromosome X haplotyping in deficiency paternity testing principles and case report International Congress Series 1239 (2003) 815 820 Chromosome X haplotyping in deficiency paternity testing principles and case report R. Szibor a, *, I. Plate a, J. Edelmann b, S. Hering c, E. Kuhlisch

More information

DNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016

DNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016 DNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016 1 What we will cover How testing helps genealogy What is DNA? How do you select from the three testing companies?

More information

Economics of Strategy (ECON 4550) Maymester 2015 Foundations of Game Theory

Economics of Strategy (ECON 4550) Maymester 2015 Foundations of Game Theory Economics of Strategy (ECON 4550) Maymester 05 Foundations of Game Theory Reading: Game Theory (ECON 4550 Courseak, Page 95) Definitions and Concets: Game Theory study of decision making settings in which

More information

There are two basic types of FET s: The junction field effect transistor or JFET the metal oxide FET or MOSFET.

There are two basic types of FET s: The junction field effect transistor or JFET the metal oxide FET or MOSFET. Page 61 Field Effect Transistors The Fieldeffect transistor (FET) We know that the biolar junction transistor or BJT is a current controlled device. The FET or field effect transistor is a voltage controlled

More information

Two-point linkage analysis using the LINKAGE/FASTLINK programs

Two-point linkage analysis using the LINKAGE/FASTLINK programs 1 Two-point linkage analysis using the LINKAGE/FASTLINK programs Copyrighted 2018 Maria Chahrour and Suzanne M. Leal These exercises will introduce the LINKAGE file format which is the standard format

More information

TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter

TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter 1-1: DNA: WHERE DO I START? Definition Genetic genealogy is the application of genetics to traditional genealogy. Genetic genealogy uses genealogical

More information

Genetic Identity and

Genetic Identity and Genetic Identity and GACATGTAGCTCTTCACTTCACCCAGGTTGGGTTGTGTCAACAGGAAACATTGTAACATATCACTTGGATTAGCACCTAGG/TTAT/TTAT/TTA Community DTC Genetic Testing Workshop The National Academies' August 31 September 1,

More information

Meek DNA Project Group B Ancestral Signature

Meek DNA Project Group B Ancestral Signature Meek DNA Project Group B Ancestral Signature The purpose of this paper is to explore the method and logic used by the author in establishing the Y-DNA ancestral signature for The Meek DNA Project Group

More information

Pedigrees How do scientists trace hereditary diseases through a family history?

Pedigrees How do scientists trace hereditary diseases through a family history? Why? Pedigrees How do scientists trace hereditary diseases through a family history? Imagine you want to learn about an inherited genetic trait present in your family. How would you find out the chances

More information

Introduction to Number Theory 2. c Eli Biham - November 5, Introduction to Number Theory 2 (12)

Introduction to Number Theory 2. c Eli Biham - November 5, Introduction to Number Theory 2 (12) Introduction to Number Theory c Eli Biham - November 5, 006 345 Introduction to Number Theory (1) Quadratic Residues Definition: The numbers 0, 1,,...,(n 1) mod n, are called uadratic residues modulo n.

More information

DNA PATERNITY TESTING YOUR QUESTIONS ANSWERED. Need some advice on testing? Call us free on:

DNA PATERNITY TESTING YOUR QUESTIONS ANSWERED. Need some advice on testing? Call us free on: DNA PATERNITY TESTING YOUR QUESTIONS ANSWERED Need some advice on testing? Call us free on: 0800 036 2522 Introduction Since 1987 Cellmark has conducted over half a million DNA relationship tests and is

More information

Genealogical Research

Genealogical Research DNA, Ancestry, and Your Genealogical Research Walter Steets Houston Genealogical Forum DNA Interest Group March 2, 2019 1 Today s Agenda Brief review of basic genetics and terms used in genetic genealogy

More information

Linkage Analysis in Merlin. Meike Bartels Kate Morley Danielle Posthuma

Linkage Analysis in Merlin. Meike Bartels Kate Morley Danielle Posthuma Linkage Analysis in Merlin Meike Bartels Kate Morley Danielle Posthuma Software for linkage analyses Genehunter Mendel Vitesse Allegro Simwalk Loki Merlin. Mx R Lisrel MERLIN software Programs: MERLIN

More information

Genetic Genealogy. Rules and Tools. Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter

Genetic Genealogy. Rules and Tools. Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter Genetic Genealogy Rules and Tools Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter I am NOT this guy! 2 Genealogy s Newest Tool Genealogy research: Study of Family History Identifies

More information

Finite Math - Fall 2016

Finite Math - Fall 2016 Finite Math - Fall 206 Lecture Notes - /28/206 Section 7.4 - Permutations and Combinations There are often situations in which we have to multiply many consecutive numbers together, for example, in examples

More information

High resolution radar signal detection based on feature analysis

High resolution radar signal detection based on feature analysis Available online www.jocr.com Journal of Chemical and Pharmaceutical Research, 4, 6(6):73-77 Research Article ISSN : 975-7384 CODEN(USA) : JCPRC5 High resolution radar signal detection based on feature

More information

Report on the VAN_TUYL Surname Project Y-STR Results 3/11/2013 Rory Van Tuyl

Report on the VAN_TUYL Surname Project Y-STR Results 3/11/2013 Rory Van Tuyl Report on the VAN_TUYL Surname Project Y-STR Results 3/11/2013 Rory Van Tuyl Abstract: Recent data for two descendants of Ott van Tuyl has been added to the project, bringing the total number of Gameren

More information

Your mtdna Full Sequence Results

Your mtdna Full Sequence Results Congratulations! You are one of the first to have your entire mitochondrial DNA (DNA) sequenced! Testing the full sequence has already become the standard practice used by researchers studying the DNA,

More information

! FTDNA! Ancestry. ! 23andMe. ! Medical Considera,ons. ! Iden,fying family medical history. ! Communica,ng with the medical community

! FTDNA! Ancestry. ! 23andMe. ! Medical Considera,ons. ! Iden,fying family medical history. ! Communica,ng with the medical community by JEFF CARPENTER! Brief Defini,ons about YDNA, XDNA, mtdna, atdna (Covered in Part 1)! Benefits of Tes,ng DNA! Examples of DNA TESTING! FTDNA! Ancestry! 3andMe Jeff Carpenter, 016 jeffcarpenter1939@gmal.com!

More information

Developing Conclusions About Different Modes of Inheritance

Developing Conclusions About Different Modes of Inheritance Pedigree Analysis Introduction A pedigree is a diagram of family relationships that uses symbols to represent people and lines to represent genetic relationships. These diagrams make it easier to visualize

More information

Advanced Autosomal DNA Techniques used in Genetic Genealogy

Advanced Autosomal DNA Techniques used in Genetic Genealogy Advanced Autosomal DNA Techniques used in Genetic Genealogy Tim Janzen, MD E-mail: tjanzen@comcast.net Summary of Chromosome Mapping Technique The following are specific instructions on how to map your

More information

Function Block DIGITAL PLL. Within +/- 5ppm / 10 years (Internal TCXO Stability) 1 External Reference Frequency Range: 10MHz +/- 100Hz

Function Block DIGITAL PLL. Within +/- 5ppm / 10 years (Internal TCXO Stability) 1 External Reference Frequency Range: 10MHz +/- 100Hz Features * Best Suited for Local Oscillator of Microwave Equipment with Low Phase Noise and Low Spurious Emission * Programmable Selection by Rotary Switch or Serial Control Signal * Built-in PLL Circuit

More information

Pizza and Who do you think you are?

Pizza and Who do you think you are? Pizza and Who do you think you are? an overview of one of the newest and possibly more helpful developments in researching genealogy and family history that of using DNA for research What is DNA? Part

More information

Autosomal-DNA. How does the nature of Jewish genealogy make autosomal DNA research more challenging?

Autosomal-DNA. How does the nature of Jewish genealogy make autosomal DNA research more challenging? Autosomal-DNA How does the nature of Jewish genealogy make autosomal DNA research more challenging? Using Family Finder results for genealogy is more challenging for individuals of Jewish ancestry because

More information

THE population genetics of within-generation

THE population genetics of within-generation Coyright Ó 009 by the Genetics Society of America DOI: 0.534/genetics.09.0368 The Genealogical Consequences of Fecundity Variance Polymorhism Jesse E. Taylor Deartment of Statistics, University of Oxford,

More information

Enhanced Kinship Analysis and STR-based DNA Typing for Human Identification in Mass Fatality Incidents: The Swissair Flight 111 Disaster

Enhanced Kinship Analysis and STR-based DNA Typing for Human Identification in Mass Fatality Incidents: The Swissair Flight 111 Disaster JForensicSci,Sept. 2004, Vol. 49, No. 5 Paper ID JFS2003311 Available online at: www.astm.org Benoît Leclair, 1,2 Ph.D.; Chantal J. Frégeau, 1 Ph.D.; Kathy L. Bowen, 1 B.Sc.; and Ron M. Fourney, 1 Ph.D.

More information

DAR POLICY STATEMENT AND BACKGROUND Using DNA Evidence for DAR Applications

DAR POLICY STATEMENT AND BACKGROUND Using DNA Evidence for DAR Applications Effective January 1, 2014, DAR will begin accepting Y-DNA evidence in support of new member applications and supplemental applications as one element in a structured analysis. This analysis will use a

More information

Halley Family. Mystery? Mystery? Can you solve a. Can you help solve a

Halley Family. Mystery? Mystery? Can you solve a. Can you help solve a Can you solve a Can you help solve a Halley Halley Family Family Mystery? Mystery? Who was the great grandfather of John Bennett Halley? He lived in Maryland around 1797 and might have been born there.

More information

DNA TESTING. This is the testing regime for FamilyTreeDNA. Other SNP tests were ordered from Yseq.

DNA TESTING. This is the testing regime for FamilyTreeDNA. Other SNP tests were ordered from Yseq. DNA & GENEALOGY DNA TESTING This is the testing regime for FamilyTreeDNA. Other SNP tests were ordered from Yseq. Product Date Batch Family Finder 30-May-14 Completed 569 05-Aug-14 Batched 569 05-Jul-14

More information

Inbreeding and self-fertilization

Inbreeding and self-fertilization Inbreeding and self-fertilization Introduction Remember that long list of assumptions associated with derivation of the Hardy-Weinberg principle that I went over a couple of lectures ago? Well, we re about

More information

DNA, A Genealogy Tool. The Search for an Expert Genealogist, Photos & Clues

DNA, A Genealogy Tool. The Search for an Expert Genealogist, Photos & Clues DNA, A Genealogy Tool The Search for an Expert Genealogist, Photos & Clues mydanishancestors.com *Slide Show shared in this class & more web-sites under Toolbar/DNA *One doesn t have to have Danish ancestors

More information

DNA (DeoxyriboNucleic Acid)

DNA (DeoxyriboNucleic Acid) Basics of DNA & Sales and Marketing Presented by: Kim Levaggi of Chromosomal Labs DNA (DeoxyriboNucleic Acid) DNA a very long molecule that is essentially the instruction manual to cells and organisms.

More information

Quadratic Residues. Legendre symbols provide a computational tool for determining whether a quadratic congruence has a solution. = a (p 1)/2 (mod p).

Quadratic Residues. Legendre symbols provide a computational tool for determining whether a quadratic congruence has a solution. = a (p 1)/2 (mod p). Quadratic Residues 4--015 a is a quadratic residue mod m if x = a (mod m). Otherwise, a is a quadratic nonresidue. Quadratic Recirocity relates the solvability of the congruence x = (mod q) to the solvability

More information

Basics of DNA & Sales and Marketing

Basics of DNA & Sales and Marketing Basics of DNA & Sales and Marketing Presented by: Kim Levaggi of Chromosomal Labs 1 DNA (DeoxyriboNucleic Acid) DNA a very long molecule that is essentially the instruction manual to cells and organisms.

More information

Genetic Genealogy Journey Why Is My Cousin Not on my DNA Match List? Debbie Parker Wayne, CG SM, CGL SM

Genetic Genealogy Journey Why Is My Cousin Not on my DNA Match List? Debbie Parker Wayne, CG SM, CGL SM Genetic Genealogy Journey Why Is My Cousin Not on my DNA Match List? Debbie Parker Wayne, CG SM, CGL SM The CSI television shows have conditioned us to expect exact DNA matches and lead us to think DNA

More information