1/8/2013. Free Online Training. Using DNA and CODIS to Resolve Missing and Unidentified Person Cases. Click Online Training

Size: px
Start display at page:

Download "1/8/2013. Free Online Training. Using DNA and CODIS to Resolve Missing and Unidentified Person Cases. Click Online Training"

Transcription

1 Free Online Training Using DNA and CODIS to Resolve Missing and Unidentified Person Cases B.J. Spamer NamUs Training and Analysis Division Office: Cell: Click Online Training DNA Profiles Used in MP and UP Cases Three types of profiles used in missing and unidentified person investigations: STR Profiles Short t Tandem d Repeatst Also commonly referred to as Nuclear DNA profiles Y-STR Profiles Y-Chromosome Short Tandem Repeats Mitochondrial (mtdna) Profiles STR profiles (also called NUCLEAR DNA PROFILES) are passed down to a child by both the mother and father 50% from each parent. STR profiles (also called NUCLEAR DNA PROFILES) are passed down to a child by both the mother and father 50% from each parent. STR profiles (also called NUCLEAR DNA PROFILES) are passed down to a child by both the mother and father 50% from each parent. 1

2 13 specific STR loci serve as the standard for CODIS, to ensure uniformity and the ability to share DNA information between laboratories. Advantages of STR Profiles Most discriminating of the three DNA profiles The likelihood of two individuals (except identical twins) having the same 13-loci DNA profile can be 1 in 1 billion or higher. Most comparisons between convicted offender/arrestee profiles and suspect profiles from crime scenes are performed with STR profiles Disadvantages of STR Profiles Particularly in degraded and/or skeletal remains cases, complete or even partial STR profiles may no longer be obtainable. This may severely limit it CODIS searching. Closely related family references (mother, father, sister) may not be available for missing persons the more distant a relative, the less useful their STR profile is for comparisons. For Example: Juvenile missing in the 1980 s. Skeletal remains were found in the 1990 s but were not identified as the missing juvenile. DNA was collected from one sibling and an STR profile only was uploaded to CODIS in the early 2000 s. No associations were made, despite the fact that both the MP and UP were represented in CODIS with STR profiles. When an additional family reference sample was profiled and uploaded to CODIS, the association was made. How Does That Happen? How Does That Happen? 11, 17 12, 14 11, 17 12, 14 2

3 Y-Chromosome (Y-STR) Profiles Y-STR profiles are passed only to a MALE child and only by the FATHER. Y-Chromosome (Y-STR) Profiles All males sharing the same paternal lineage will share the same Y-STR profile. Missing Person Y-STR Profiles Disadvantages: Not unique to an individual Only applicable to missing/unidentified males May not be obtainable bl in decomposed/skeletal d/ l remains cases Advantages: Distant paternal relatives can provide a Y-STR profile for comparison purposes when close relatives are not available for STRs and/or a maternal relative is not available for mitochondrial DNA. Mitochondrial DNA (mtdna) mtdna profiles are passed to MALE and FEMALE children, but only from the MOTHER. Mitochondrial (mtdna) Profiles The Importance of mtdna All females sharing the same maternal lineage will share the same mtdna profile. Missing Person mtdna is more resilient to degradation Skeletal remains may no longer yield a full STR or Y-STR profile, but still yield a mtdna profile If we can only develop a mtdna profile for skeletal remains and there is no mtdna profile available for the missing person, we can never make an association between the two cases 3

4 Mitochondrial (mtdna) Profiles Disadvantages: Not unique to an individual associations will not report out of CODIS unless they meet a certain probability bilit threshold. h Advantages: More resilient to degradation. Distant maternal relatives can provide a mtdna profile for comparison purposes when close relates are not available for STRs and/or Y- STRs are not applicable. California Dept of Justice CODIS Mito Laboratories Arizona Dept. of Public Safety MN Bureau of Criminal Apprehension UNT Center for Human ID New York Office of the Chief ME New Jersey State Police Lab FBI Virginia Dept. of Forensic Sciences From Whom To Collect DNA Samples You must collect AT LEAST TWO family reference samples for proper CODIS searching to take place: Offspring of Missing i Person Collect second parent to exclude their STR profile Full Sibling Half Sibling Consider grandparents, aunts, uncles, etc. for Y- STRs and mtdna profiles if closer blood relatives are not available Family Reference Collection Kits Kits can be ordered through the NamUs DNA screen or from: MissingPersons@unthsc.edu Family Reference Collection Kits Collection kits contain: Chain of custody form Consent form Relationship of DNA donor Fax Back form Latex gloves Buccal swab collectors Postage paid return envelope These materials ensure proper documentation, collection, and chain of custody on each collected sample CA Missing and Unidentified Persons Unit 4

5 Direct References Direct reference samples for the Missing Person will have added value in CODIS searches: Blood/tissue samples from prior medical procedures Toothbrush used prior to disappearance Guthrie cards (also known as PKU cards) Articles of unlaundered clothing worn prior to disappearance Baby teeth Only if parent is certain tooth belongs to MP and not a sibling These samples may not yield profiles due to open root Do NOT collect cut hair unless no other mtdna donor exists cut hair will yield only a mtdna profile PKU Card Contact Information Download at Click Resources Terminology CODIS CODIS is an acronym that stands for Combined DNA Index System. CODIS is the software that compares DNA profiles and is the backbone of the. Index : CODIS is a system of pointers, which point back to the originating agency; the system does not contain names or other case-related information, only the information necessary to make associations and notify agencies:» Specimen identifier» Laboratory s identifier» The actual DNA characteristics (profiles) Three Levels to the : National DNA Index System () State DNA Index System () Local DNA Index System () FBI Laboratory Quantico, Virginia Texas Dept. of Public Safety Headquarters Laboratory UNT Center for Human Identification Degraded Samples Degraded DNA Samples (e.g., Low Copy Number) Samples may be degraded to the point where traditional techniques do not yield a DNA profile Ohio Bureau of Criminal Investigation California DOJ - Richmond Jan Bashinski DNA Lab Low Copy Number (LCN) samples can be amplified a greater number of times to produce an STR profile where none could be obtained before Miami Valley Regional Crime Lab Cuyahoga County Coroner s Office Los Angeles Regional Crime Lab San Bernardino County S.O. Profiles developed using these techniques are not yet accepted into the National () - only into the local and state systems, meaning NATIONAL searches will not take place 5

6 Partial STR Profile for UP STR and mtdna Profile for MP The NamUs DNA Screen Complete mitochondrial DNA profile uploaded to along with marginal STR profile (4/13). Nearly complete LOW COPY STR profile (10/13) available at UNT for comparison. Most Commonly Used Indexes Within Each Level of CODIS: Convicted Offender Index Arrestee Index Forensic Unknown Index Missing Person Index Family Reference Index Unidentified Human Index Family Reference Samples Reference samples provided by family members of missing persons can only be searched against the unidentified human index. Missing Person Index Family Reference Index X X Convicted Offender Index Forensic Index Unidentified Human Index Direct Reference Samples Direct reference samples for missing persons are entered into the Missing Person Index and can be searched against ALL other indexes (unidentified humans, offender profiles, and forensic unknown profiles). Missing Person Index Family Reference Index Convicted Offender Index Forensic Index Unidentified Human Index Take-Home Points Collect DNA samples from two or more family members of each missing person. The more closely related the donor, the more useful the STR profiles will be for comparisons. Make sure profiles are developed using two or more DNA technologies for every missing person case (STR + mtdna) Know what level of CODIS your profiles reside in (, or ) to be cognizant of when a potential match from an investigative lead might require a manual DNA comparison. Direct references enable more comprehensive CODIS searching against offender and suspect profiles. 6

7 DNA Statistics From NamUs Missing Person Cases: Complete and Uploaded to CODIS: 3,434 DNA Submitted, Pending Completion: 608 DNA Available, Not Yet Submitted: 299 Unidentified Person Cases: Complete and Uploaded to CODIS: 3,434 DNA Submitted, Pending Completion: 780 DNA Available, Not Yet Submitted: 3,272 No profile obtained: 293 Why Be Proactive? Missing person last seen in the 1990 s Removed from NCIC shortly after initial disappearance DNA collected from family and uploaded to CODIS after the NCIC entry was cancelled because subject was still missing law enforcement declined to make a new NCIC entry No DNA associations were made No NamUs entry was made Why Be Proactive? Unidentified remains were found in the same state where the missing person was last seen, in the same year the subject was last seen date of last contact for MP was incorrect in NCIC. No NCIC entry was made on the UP case NamUs entry was made in the late 2000 s but no DNA was processed NamUs entry prompted tip that led to DNA processing and identification over 10 years after the body had been recovered Contact Information B.J. Spamer Director, Training and Analysis Division UNT Health Science Center Office: BJ.Spamer@unthsc.edu 7

Free Online Training

Free Online Training Using DNA and CODIS to Resolve Missing and Unidentified Person Cases B.J. Spamer NamUs Training and Analysis Division Office: 817-735-5473 Cell: 817-964-1879 Email: BJ.Spamer@unthsc.edu Free Online Training

More information

Primer on Human Pedigree Analysis:

Primer on Human Pedigree Analysis: Primer on Human Pedigree Analysis: Criteria for the selection and collection of appropriate Family Reference Samples John V. Planz. Ph.D. UNT Center for Human Identification Successful Missing Person ID

More information

Find JCD Project Date: Identification-DNA Process Updated:

Find JCD Project Date: Identification-DNA Process Updated: New Look Investigations Created by: Jack Friess Find JCD Project Date: 04-20-2018 Identification-DNA Process Updated: 05-24-2018 Questions and Answers Identification-DNA (ID-DNA) is a scientific process

More information

Non-Paternity: Implications and Resolution

Non-Paternity: Implications and Resolution Non-Paternity: Implications and Resolution Michelle Beckwith PTC Labs 2006 AABB HITA Meeting October 8, 2006 Considerations when identifying victims using relatives Identification requires knowledge of

More information

Large scale kinship:familial Searching and DVI. Seoul, ISFG workshop

Large scale kinship:familial Searching and DVI. Seoul, ISFG workshop Large scale kinship:familial Searching and DVI Seoul, ISFG workshop 29 August 2017 Large scale kinship Familial Searching: search for a relative of an unidentified offender whose profile is available in

More information

50/50. Accreditations 4/13/2016 A B A B A B. Mother. Father. Child. Everything you ever wanted to know about DNA collections and MORE!

50/50. Accreditations 4/13/2016 A B A B A B. Mother. Father. Child. Everything you ever wanted to know about DNA collections and MORE! Everything you ever wanted to know about DNA collections and MORE! Presented by: Kim Levaggi Accreditations 1 50/50 Half of your DNA comes from your mother Half of your DNA comes from your father Mother

More information

4/13/2016. Everything you ever wanted to know about DNA collections and MORE! Presented by: Kim Levaggi

4/13/2016. Everything you ever wanted to know about DNA collections and MORE! Presented by: Kim Levaggi Everything you ever wanted to know about DNA collections and MORE! Presented by: Kim Levaggi 1 Accreditations 1 2 50/50 Half of your DNA comes from your mother Half of your DNA comes from your father Mother

More information

Finally, should you have any questions, queries or issues with regard to the service our company provides, us at

Finally, should you have any questions, queries or issues with regard to the service our company provides,  us at Dear Sir / Madam, To complete the enclosed registration form, please follow the procedure below: 1. Choose a sampler. To comply with current legislation, samples must be taken by a medically qualified

More information

DNA (DeoxyriboNucleic Acid)

DNA (DeoxyriboNucleic Acid) Basics of DNA & Sales and Marketing Presented by: Kim Levaggi of Chromosomal Labs DNA (DeoxyriboNucleic Acid) DNA a very long molecule that is essentially the instruction manual to cells and organisms.

More information

Your mtdna Full Sequence Results

Your mtdna Full Sequence Results Congratulations! You are one of the first to have your entire mitochondrial DNA (DNA) sequenced! Testing the full sequence has already become the standard practice used by researchers studying the DNA,

More information

Basics of DNA & Sales and Marketing

Basics of DNA & Sales and Marketing Basics of DNA & Sales and Marketing Presented by: Kim Levaggi of Chromosomal Labs 1 DNA (DeoxyriboNucleic Acid) DNA a very long molecule that is essentially the instruction manual to cells and organisms.

More information

ICMP DNA REPORTS GUIDE

ICMP DNA REPORTS GUIDE ICMP DNA REPORTS GUIDE Distribution: General Sarajevo, 16 th December 2010 GUIDE TO ICMP DNA REPORTS 1. Purpose of This Document 1. The International Commission on Missing Persons (ICMP) endeavors to secure

More information

DNA PATERNITY TESTING YOUR QUESTIONS ANSWERED. Need some advice on testing? Call us free on:

DNA PATERNITY TESTING YOUR QUESTIONS ANSWERED. Need some advice on testing? Call us free on: DNA PATERNITY TESTING YOUR QUESTIONS ANSWERED Need some advice on testing? Call us free on: 0800 036 2522 Introduction Since 1987 Cellmark has conducted over half a million DNA relationship tests and is

More information

The Mismatch Between Probable Cause and Partial Matching

The Mismatch Between Probable Cause and Partial Matching natalie ram The Mismatch Between Probable Cause and Partial Matching In mid-december, as one of the outgoing Bush Administration s last minute regulations, the Department of Justice radically expanded

More information

THE BASICS OF DNA TESTING. By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library

THE BASICS OF DNA TESTING. By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library THE BASICS OF DNA TESTING By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library TYPES OF TESTS Mitochondrial DNA (mtdna/mdna) Y-DNA Autosomal DNA (atdna/audna) MITOCHONDRIAL DNA Found

More information

DNA Basics. OLLI: Genealogy 101 October 1, ~ Monique E. Rivera ~

DNA Basics. OLLI: Genealogy 101 October 1, ~ Monique E. Rivera ~ DNA Basics OLLI: Genealogy 101 October 1, 2018 ~ Monique E. Rivera ~ WHAT IS DNA? DNA (deoxyribonucleic acid) is found in every living cell everywhere. It is a long chemical chain that tells our cells

More information

DNA: Statistical Guidelines

DNA: Statistical Guidelines Frequency calculations for STR analysis When a probative association between an evidence profile and a reference profile is made, a frequency estimate is calculated to give weight to the association. Frequency

More information

1) Using the sightings data, determine who moved from one area to another and fill this data in on the data sheet.

1) Using the sightings data, determine who moved from one area to another and fill this data in on the data sheet. Parentage and Geography 5. The Life of Lulu the Lioness: A Heroine s Story Name: Objective Using genotypes from many individuals, determine maternity, paternity, and relatedness among a group of lions.

More information

have to get on the phone or family members for the names of more distant relatives.

have to get on the phone or  family members for the names of more distant relatives. Ideas for Teachers: Give each student the family tree worksheet to fill out at home. Explain to them that each family is different and this worksheet is meant to help them plan their family tree. They

More information

Introduction to Autosomal DNA Tools

Introduction to Autosomal DNA Tools GENETIC GENEALOGY JOURNEY Debbie Parker Wayne, CG, CGL Introduction to Autosomal DNA Tools Just as in the old joke about a new genealogist walking into the library and asking for the book that covers my

More information

Walter Steets Houston Genealogical Forum DNA Interest Group April 7, 2018

Walter Steets Houston Genealogical Forum DNA Interest Group April 7, 2018 Ancestry DNA and GEDmatch Walter Steets Houston Genealogical Forum DNA Interest Group April 7, 2018 Today s agenda Recent News about DNA Testing DNA Cautions: DNA Data Used for Forensic Purposes New Technology:

More information

Pizza and Who do you think you are?

Pizza and Who do you think you are? Pizza and Who do you think you are? an overview of one of the newest and possibly more helpful developments in researching genealogy and family history that of using DNA for research What is DNA? Part

More information

Autosomal DNA. What is autosomal DNA? X-DNA

Autosomal DNA. What is autosomal DNA? X-DNA ANGIE BUSH AND PAUL WOODBURY info@thednadetectives.com November 1, 2014 Autosomal DNA What is autosomal DNA? Autosomal DNA consists of all nuclear DNA except for the X and Y sex chromosomes. There are

More information

AFDAA 2012 WINTER MEETING Population Statistics Refresher Course - Lecture 3: Statistics of Kinship Analysis

AFDAA 2012 WINTER MEETING Population Statistics Refresher Course - Lecture 3: Statistics of Kinship Analysis AFDAA 2012 WINTER MEETING Population Statistics Refresher Course - Lecture 3: Statistics of Kinship Analysis Ranajit Chakraborty, PhD Center for Computational Genomics Institute of Applied Genetics Department

More information

DNA Testing What you need to know first

DNA Testing What you need to know first DNA Testing What you need to know first This article is like the Cliff Notes version of several genetic genealogy classes. It is a basic general primer. The general areas include Project support DNA test

More information

Popstats Parentage Statistics Strength of Genetic Evidence In Parentage Testing

Popstats Parentage Statistics Strength of Genetic Evidence In Parentage Testing Popstats Parentage Statistics Strength of Genetic Evidence In Parentage Testing Arthur J. Eisenberg, Ph.D. Director DNA Identity Laboratory UNT-Health Science Center eisenber@hsc.unt.edu PATERNITY TESTING

More information

Halley Family. Mystery? Mystery? Can you solve a. Can you help solve a

Halley Family. Mystery? Mystery? Can you solve a. Can you help solve a Can you solve a Can you help solve a Halley Halley Family Family Mystery? Mystery? Who was the great grandfather of John Bennett Halley? He lived in Maryland around 1797 and might have been born there.

More information

DAR POLICY STATEMENT AND BACKGROUND Using DNA Evidence for DAR Applications

DAR POLICY STATEMENT AND BACKGROUND Using DNA Evidence for DAR Applications Effective January 1, 2014, DAR will begin accepting Y-DNA evidence in support of new member applications and supplemental applications as one element in a structured analysis. This analysis will use a

More information

DNA Parentage Test No Summary Report

DNA Parentage Test No Summary Report Collaborative Testing Services, Inc FORENSIC TESTING PROGRAM DNA Parentage Test No. 16-5870 Summary Report This proficiency test was sent to 27 participants. Each participant received a sample pack consisting

More information

Ewing Surname Y-DNA Project Article 8

Ewing Surname Y-DNA Project Article 8 Ewing Surname Y-DNA Project Article 8 This is the eighth in a series of articles about the Ewing Surname Y-DNA Project. The previous seven articles have appeared in the last seven issues of the Journal

More information

DNA Opening Doors for Today s s Genealogist

DNA Opening Doors for Today s s Genealogist DNA Opening Doors for Today s s Genealogist Presented to JGSI Sunday, March 30, 2008 Presented by Alvin Holtzman Genetic Genealogy Discussion Points What is DNA How can it help genealogists What to expect

More information

Using X-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM

Using X-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM Using X-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.

More information

Finding a Male Hodge(s) Descendant for Y-Chromosome DNA Testing. Prepared by Jan Alpert

Finding a Male Hodge(s) Descendant for Y-Chromosome DNA Testing. Prepared by Jan Alpert Finding a Male Hodge(s) Descendant for Y-Chromosome DNA Testing Prepared by Jan Alpert Why Test Male Y-Chromosome DNA All males carry the Y-Chromosome of their fathers As a result the same DNA markers

More information

San Joaquin County First Families Certificate Program

San Joaquin County First Families Certificate Program San Joaquin County First Families Certificate Program The San Joaquin Genealogical Society and The San Joaquin County Historical Society have partnered to offer the First Families of San Joaquin County

More information

DNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016

DNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016 DNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016 1 What we will cover How testing helps genealogy What is DNA? How do you select from the three testing companies?

More information

Unit 2: THE CRIME SCENE

Unit 2: THE CRIME SCENE Unit 2: THE CRIME SCENE Oh, how simple it would all have been had I been here before they came like a herd of buffalo and wallowed all over it. A. Conan Doyle, in The Boscombe Valley Mystery, 1892 CORPUS

More information

Positive paternity test results letter

Positive paternity test results letter Buscar... Positive paternity test results letter Sequenom (NASDAQ: SQNM) is an American company based in San Diego, California. It develops enabling molecular technologies, and highly sensitive laboratory

More information

A Day Out With Your DNA

A Day Out With Your DNA A Day Out With Your DNA Diahan Southard www.yourdnaguide.com Your testing company has evaluated around 800,000 locations on your DNA to help them determine your origins and your genetic cousins. While

More information

Chromosome X haplotyping in deficiency paternity testing principles and case report

Chromosome X haplotyping in deficiency paternity testing principles and case report International Congress Series 1239 (2003) 815 820 Chromosome X haplotyping in deficiency paternity testing principles and case report R. Szibor a, *, I. Plate a, J. Edelmann b, S. Hering c, E. Kuhlisch

More information

Mix & match: Getting comfortable with DNA reporting. Elmira, New York. Cybergenetics People of New York v Casey Wilson

Mix & match: Getting comfortable with DNA reporting. Elmira, New York. Cybergenetics People of New York v Casey Wilson Mix & match: Getting comfortable with DNA reporting What s in a Match? How to read a forensic DNA report Duquesne University October, 2015 Pittsburgh, PA Mark W Perlin, PhD, MD, PhD Cybergenetics, Pittsburgh,

More information

Walter Steets Houston Genealogical Forum DNA Interest Group May 5, 2018

Walter Steets Houston Genealogical Forum DNA Interest Group May 5, 2018 GEDmatch: The Golden State Killer Tier 1 Tools Walter Steets Houston Genealogical Forum DNA Interest Group May 5, 2018 1 Today s agenda Walter s Take on DNA Developments Growth in Number of DNA Testers

More information

[CLIENT] SmithDNA1701 DE January 2017

[CLIENT] SmithDNA1701 DE January 2017 [CLIENT] SmithDNA1701 DE1704205 11 January 2017 DNA Discovery Plan GOAL Create a research plan to determine how the client s DNA results relate to his family tree as currently constructed. The client s

More information

DNA Testing. February 16, 2018

DNA Testing. February 16, 2018 DNA Testing February 16, 2018 What Is DNA? Double helix ladder structure where the rungs are molecules called nucleotides or bases. DNA contains only four of these nucleotides A, G, C, T The sequence that

More information

TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter

TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter 1-1: DNA: WHERE DO I START? Definition Genetic genealogy is the application of genetics to traditional genealogy. Genetic genealogy uses genealogical

More information

Princess Margaret Cancer Centre Familial Breast and Ovarian Cancer Clinic. Family History Questionnaire

Princess Margaret Cancer Centre Familial Breast and Ovarian Cancer Clinic. Family History Questionnaire Princess Margaret Cancer Centre Familial Breast and Ovarian Cancer Clinic Family History Questionnaire How to complete this questionnaire The information in this questionnaire will be used to determine

More information

Forensic Photographer II

Forensic Photographer II HARRIS COUNTY Human Resource & Risk Management Houston, TX 77002 https://agency.governmentjobs.com//harriscountytx/default.cfm invites applications for the position of: Forensic Photographer II An Equal

More information

DNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding

DNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding DNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding by Dr. Ing. Robert L. Baber 2014 July 26 Rights reserved, see the copyright notice at http://gengen.rlbaber.de

More information

An Introduction. Your DNA. and Your Family Tree. (Mitochondrial DNA) Presentation by: 4/8/17 Page 1 of 10

An Introduction. Your DNA. and Your Family Tree. (Mitochondrial DNA) Presentation by: 4/8/17 Page 1 of 10 An Introduction Your DNA and Your Family Tree (Mitochondrial DNA) Presentation by: FredCoffey@aol.com 4/8/17 Page 1 of 10 Coffey Surname, y-dna Project We're now ready to move on and look at the type of

More information

DNA for Genealogy Librarians. Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District

DNA for Genealogy Librarians. Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District DNA for Genealogy Librarians Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District What does DNA do? It replicates itself. It codes for the production

More information

Genealogical Research

Genealogical Research DNA, Ancestry, and Your Genealogical Research Walter Steets Houston Genealogical Forum DNA Interest Group March 2, 2019 1 Today s Agenda Brief review of basic genetics and terms used in genetic genealogy

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/1122655/dc1 Supporting Online Material for Finding Criminals Through DNA of Their Relatives Frederick R. Bieber,* Charles H. Brenner, David Lazer *Author for correspondence.

More information

DNA SPECIMEN COLLECTION PROCEDURE

DNA SPECIMEN COLLECTION PROCEDURE PATERNITY TESTING CORPORATION DNA SPECIMEN COLLECTION PROCEDURE Legal Private Case CAUTION: If an individual appearing for specimen collection is one of your friends or relatives, please call PTC before

More information

4 / GENERAL. Processing minor crime scenes - Patrol Officer:

4 / GENERAL. Processing minor crime scenes - Patrol Officer: Laurel Police Department General Order Section 4/700 Criminal Investigation 4 / 705 Collection / Preservation of Evidence 8/25/98 Rev 3/08/09 Accreditation Standards 1.2.4/43.1.4/61.2.3/83.1.1/83.2.1/83.2.2/

More information

DNA SPECIMEN COLLECTION PROCEDURE

DNA SPECIMEN COLLECTION PROCEDURE PATERNITY TESTING CORPORATION DNA SPECIMEN COLLECTION PROCEDURE Legal Private Case (Prenatal Paternity Amnio) CAUTION: If an individual appearing for specimen collection is one of your friends or relatives,

More information

CASE STUDY. Montgomery County Sheriff s Office. ADAMS Software Chosen for Managing Photos, Physical Evidence

CASE STUDY. Montgomery County Sheriff s Office. ADAMS Software Chosen for Managing Photos, Physical Evidence Montgomery County Sheriff s Office gains efficiency, cost savings with ADAMS Software for managing physical evidence, digital and latent assets CASE STUDY Montgomery County Sheriff s Office Crime laboratories

More information

DNA Parentage Test No Summary Report

DNA Parentage Test No Summary Report Collaborative Testing Services, Inc FORENSIC TESTING PROGRAM DNA Parentage Test No. 165871 Summary Report This proficiency test was sent to 45 participants. Each participant received a sample pack consisting

More information

APPLICATION FOR ENROLLMENT

APPLICATION FOR ENROLLMENT CTGR-9615 Grand Ronde Rd.; Grand Ronde OR 97347 1-800-422-0232 ext.2253 APPLICATION FOR ENROLLMENT Name: First Middle Last Maiden Gender Female. Male Date of Birth Social security Number Address: Mailing

More information

Using Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM

Using Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM Using Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.

More information

Vital Statistics Registration Act

Vital Statistics Registration Act Issuer: Riigikogu Type: act In force from: 29.12.2012 In force until: 31.12.2013 Translation published: 30.10.2013 Amended by the following acts Passed 20.05.2009 RT I 2009, 30, 177 Entry into force 01.07.2010,

More information

Digital Forensics Lecture 11. Evidence, Reporting, and Action

Digital Forensics Lecture 11. Evidence, Reporting, and Action Digital Forensics Lecture 11 Evidence, Reporting, and Action This Week s Presentations Certifications Risk Analysis Normal (non-it) Parents Keeping Their Children Safe and Happy Encase Sleuth Kit Next

More information

CDIB/Membership Card FAQ and Instructions

CDIB/Membership Card FAQ and Instructions CDIB/Membership Card FAQ and Instructions WHAT IS THE CDIB/MEMBERSHIP CARD? The CDIB/Membership is a new card that combines the Certificate of Degree of Indian Blood (CDIB), Membership, and Photo ID (if

More information

First Results: Intro to FamilyTreeDNA s Family Finder. Learn what to do with results of autosomal DNA testing with FamilyTreeDNA (FTDNA).

First Results: Intro to FamilyTreeDNA s Family Finder. Learn what to do with results of autosomal DNA testing with FamilyTreeDNA (FTDNA). First Results: Family Tree DNA When You First Get Your FamilyTreeDNA (FTDNA) Results Objective: Learn what to do with results of autosomal DNA testing with FamilyTreeDNA (FTDNA). Tools: familytreedna.com

More information

Using Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM

Using Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM Using Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.

More information

DAN L. VOGEL POB 5862 Edmond, OK

DAN L. VOGEL POB 5862 Edmond, OK DAN L. VOGEL POB 5862 Edmond, OK 73083-5862 405-282-0704 dvogel1@cox.net EDUCATION Bachelor Degree (Business Administration), Miami University, Oxford, Ohio (1970). Masters Degree (Administration of Justice),

More information

2. The most common tool for collecting evidence is/are: a. tweezers. b. computers. c. Q-Tips. d. tape. Day 1

2. The most common tool for collecting evidence is/are: a. tweezers. b. computers. c. Q-Tips. d. tape. Day 1 Day 1 1. Which of the items below is NOT evidence? a. A scrap of clothing b. Mud from a footprint c. A fingerprint d. The investigator s birthplace 2. The term Forensic has to do with a(n): a. shoelace.

More information

VIP Personal Information

VIP Personal Information Page of 8 If FemaleMaiden DOB Race Social Security # Birth City StateCountry Birth Hospital MM DD YYYY Address Apt # City State Zip County Country Inside City Limits Religious Preference Education: level

More information

An O-F3288 Y DNA Discovery for Patrilineal Descendants of James Revell (Accomack) By Marie A. Rundquist, DNA Project Administrator November 2018

An O-F3288 Y DNA Discovery for Patrilineal Descendants of James Revell (Accomack) By Marie A. Rundquist, DNA Project Administrator November 2018 Project Scope Rundquist O-F3288 White Paper 11/2018 An O-F3288 Y DNA Discovery for Patrilineal Descendants of James Revell (Accomack) By Marie A. Rundquist, DNA Project Administrator November 2018 The

More information

Getting the Most Out of Your DNA Matches

Getting the Most Out of Your DNA Matches Helen V. Smith PG Dip Public Health, BMedLabSci, ADCLT, Dip. Fam. Hist. PLCGS 46 Kraft Road, Pallara, Qld, 4110 Email: HVSresearch@DragonGenealogy.com Website: www.dragongenealogy.com Blog: http://www.dragongenealogy.com/blog/

More information

Puzzling Pedigrees. Essential Question: How can pedigrees be used to study the inheritance of human traits?

Puzzling Pedigrees. Essential Question: How can pedigrees be used to study the inheritance of human traits? Name: Puzzling Pedigrees Essential Question: How can pedigrees be used to study the inheritance of human traits? Studying inheritance in humans is more difficult than studying inheritance in fruit flies

More information

Statistical Interpretation in Making DNA-based Identification of Mass Victims

Statistical Interpretation in Making DNA-based Identification of Mass Victims Statistical Interretation in Making DNAbased Identification of Mass Victims KyoungJin Shin wan Young Lee Woo Ick Yang Eunho a Det. of Forensic Medicine Yonsei University College of Medicine Det. of Information

More information

Walter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018

Walter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018 DNA, Ancestry, and Your Genealogical Research- Segments and centimorgans Walter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018 1 Today s agenda Brief review of previous DIG session

More information

Determining Relatedness from a Pedigree Diagram

Determining Relatedness from a Pedigree Diagram Kin structure & relatedness Francis L. W. Ratnieks Aims & Objectives Aims 1. To show how to determine regression relatedness among individuals using a pedigree diagram. Social Insects: C1139 2. To show

More information

International Forensic Services

International Forensic Services International Forensic Services Right People. Delivering Results. Experienced scientists delivering forensic effectiveness, unquestionable integrity, focused customer service and value for money. Strengthening

More information

What Can I Learn From DNA Testing?

What Can I Learn From DNA Testing? What Can I Learn From DNA Testing? From where did my ancestors migrate? What is my DNA Signature? Was my ancestor a Jewish Cohanim Priest? Was my great great grandmother really an Indian Princes? I was

More information

Sioux Falls Police Department Partnering with the community to serve, protect, and promote quality of life!

Sioux Falls Police Department Partnering with the community to serve, protect, and promote quality of life! Sioux Falls Police Department Partnering with the community to serve, protect, and promote quality of life! Policy: Evidence Preservation Related Policies: Section #: 1200 Evidence Policy #: 1201 Effective:

More information

An Introduction to Genetic Genealogy

An Introduction to Genetic Genealogy An Introduction to Genetic Genealogy David A. Pike dapike@math.mun.ca Presented To: Family History Society of Newfoundland and Labrador 24 January 2006 Slide 1 of 21 Overview Genetic Genealogy using genetic

More information

4. Kinship Paper Challenge

4. Kinship Paper Challenge 4. António Amorim (aamorim@ipatimup.pt) Nádia Pinto (npinto@ipatimup.pt) 4.1 Approach After a woman dies her child claims for a paternity test of the man who is supposed to be his father. The test is carried

More information

INDIAN RIVER CRIME LABORATORY

INDIAN RIVER CRIME LABORATORY 03166 INDIAN RIVER CRIME LABORATORY at INDIAN RIVER STATE COLLEGE 4602 KIRBY LOOP ROAD FT. PIERCE, FL 34981 August 2, 2016 The Honorable Sheriff Ken Mascara St. Lucie County Sheriffs Office 4700 W. Midway

More information

Fairfield Public Schools Science Curriculum. Draft Forensics I: Never Gone Without a Trace Forensics II: You Can t Fake the Prints.

Fairfield Public Schools Science Curriculum. Draft Forensics I: Never Gone Without a Trace Forensics II: You Can t Fake the Prints. Fairfield Public Schools Science Curriculum Draft Forensics I: Never Gone Without a Trace Forensics II: You Can t Fake the Prints March 12, 2018 Forensics I and Forensics II: Description Forensics I: Never

More information

HFSC Creates Group Dedicated to Lean Six Sigma, Leadership Building

HFSC Creates Group Dedicated to Lean Six Sigma, Leadership Building HOUSTON FORENSIC SCIENCE CENTER. JANUARY 2018 INSIDE THIS EDITION HFSC Creates Group Dedicated to Lean Six Sigma, Leadership Building 2 4 5 6 Dr. Peter Stout addresses the importance of a new LIMS HFSC

More information

DNA Parentage Test No Summary Report

DNA Parentage Test No Summary Report Collaborative Testing Services, Inc FORENSIC TESTING PROGRAM DNA Parentage Test No. 175871 Summary Report This proficiency test was sent to 45 participants. Each participant received a sample pack consisting

More information

DNA Interpretation Test No Summary Report

DNA Interpretation Test No Summary Report Collaborative Testing Services, Inc FORENSIC TESTING PROGRAM DNA Interpretation Test No. 17-588 Summary Report This proficiency test was sent to 3 participants. Each participant received a sample pack

More information

KINSHIP ANALYSIS AND HUMAN IDENTIFICATION IN MASS DISASTERS: THE USE OF MDKAP FOR THE WORLD TRADE CENTER TRAGEDY

KINSHIP ANALYSIS AND HUMAN IDENTIFICATION IN MASS DISASTERS: THE USE OF MDKAP FOR THE WORLD TRADE CENTER TRAGEDY 1 KINSHIP ANALYSIS AND HUMAN IDENTIFICATION IN MASS DISASTERS: THE USE OF MDKAP FOR THE WORLD TRADE CENTER TRAGEDY Benoît Leclair 1, Steve Niezgoda 2, George R. Carmody 3 and Robert C. Shaler 4 1 Myriad

More information

Please complete the information in this packet and return it PRIOR to your appointment with the Familial Cancer Risk Assessment Center.

Please complete the information in this packet and return it PRIOR to your appointment with the Familial Cancer Risk Assessment Center. Please complete the information in this packet and return it PRIOR to your appointment with the Familial Risk Assessment Center. The information gathered from these questionnaires will be used to assess

More information

OHIO STATE UNIVERSITY EXTENSION

OHIO STATE UNIVERSITY EXTENSION Cloverbud Investigators: Career Detectives November Background: When we think of crime scene investigation, we may think of famous fictional characters like Sherlock Holmes, the Hardy Boys, Nancy Drew

More information

Genetic Identity and

Genetic Identity and Genetic Identity and GACATGTAGCTCTTCACTTCACCCAGGTTGGGTTGTGTCAACAGGAAACATTGTAACATATCACTTGGATTAGCACCTAGG/TTAT/TTAT/TTA Community DTC Genetic Testing Workshop The National Academies' August 31 September 1,

More information

Every human cell (except red blood cells and sperm and eggs) has an. identical set of 23 pairs of chromosomes which carry all the hereditary

Every human cell (except red blood cells and sperm and eggs) has an. identical set of 23 pairs of chromosomes which carry all the hereditary Introduction to Genetic Genealogy Every human cell (except red blood cells and sperm and eggs) has an identical set of 23 pairs of chromosomes which carry all the hereditary information that is passed

More information

Family Tree DNA Genetic Genealogy Started Here

Family Tree DNA Genetic Genealogy Started Here Family Tree DNA Genetic Genealogy Started Here With 253,000 samples in our DNA database (the largest of its kind in the world) your genealogical search could become even easier Why Bennett Greenspan founded

More information

UNIVERSITY OF CENTRAL FLORIDA FRONTIERS IN INFORMATION TECHNOLOGY COP 4910 CLASS FINAL REPORT

UNIVERSITY OF CENTRAL FLORIDA FRONTIERS IN INFORMATION TECHNOLOGY COP 4910 CLASS FINAL REPORT UNIVERSITY OF CENTRAL FLORIDA FRONTIERS IN INFORMATION TECHNOLOGY COP 4910 CLASS FINAL REPORT Abstract This report brings together the final papers presented by the students in the Frontiers in Information

More information

DNA Parentage Test No Summary Report

DNA Parentage Test No Summary Report Collaborative Testing Services, Inc FORENSIC TESTING PROGRAM DNA Parentage Test No. 155872 Summary Report This proficiency test was sent to 38 participants. Each participant received a sample pack consisting

More information

Using Mitochondrial DNA (mtdna) for Genealogy Debbie Parker Wayne, CG, CGL SM

Using Mitochondrial DNA (mtdna) for Genealogy Debbie Parker Wayne, CG, CGL SM Using Mitochondrial DNA (mtdna) for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical

More information

LONDONDERRY POLICE DEPARTMENT POLICIES AND PROCEDURES

LONDONDERRY POLICE DEPARTMENT POLICIES AND PROCEDURES POLICY NO: S-301-A LONDONDERRY POLICE DEPARTMENT POLICIES AND PROCEDURES DATE OF ISSUE: December 1, 1997 EFFECTIVE DATE: December 1, 1997 REVISED DATE: January 10, 2016 SUBJECT: COLLECTION AND PRESERVATIONOF

More information

Click here to give us your feedback. New FamilySearch Reference Manual

Click here to give us your feedback. New FamilySearch Reference Manual Click here to give us your feedback. New FamilySearch Reference Manual January 25, 2011 2009 by Intellectual Reserve, Inc. All rights reserved Printed in the United States of America English approval:

More information

Question and Response Guide to Issuing Certified Copies of Vital Records

Question and Response Guide to Issuing Certified Copies of Vital Records February 28, 2011 Question and Response Guide to Issuing Certified Copies of Vital Records Who may receive certified copies of vital record? State law only allows a certified copy of a vital record to

More information

Walter Steets Houston Genealogical Forum DNA Interest Group January 27, 2018

Walter Steets Houston Genealogical Forum DNA Interest Group January 27, 2018 Using Ancestry DNA and Third-Party Tools to Research Your Shared DNA Segments Walter Steets Houston Genealogical Forum DNA Interest Group January 27, 2018 1 Today s agenda Brief review of previous DIG

More information

Name: Date of Birth: First Middle Last (Prior Names)

Name: Date of Birth: First Middle Last (Prior Names) Personal and Family History Questionnaire It is very important for you to complete this form to the best of your ability and return it well in advance of your scheduled appointment. This allows us appropriate

More information

Your Family 101 Beginning Genealogical Research

Your Family 101 Beginning Genealogical Research Your Family 101 Beginning Genealogical Research What Will We Cover Today? Session 1: Getting Started Session 2: Your Resources Session 3: Common Mistakes and Pitfalls Session 4: DNA Testing and Medical

More information

FAMILY HISTORY QUESTIONNAIRE

FAMILY HISTORY QUESTIONNAIRE FAMILY HISTORY QUESTIONNAIRE This form helps us to evaluate if you might have a higher risk of cancer because of your family history. Please complete this form to the best of your ability. If you are unsure

More information

The Meek Family of Allegheny Co., PA Meek Group A Introduction

The Meek Family of Allegheny Co., PA Meek Group A Introduction Meek Group A Introduction In the 1770's a significant number of families named Meek(s) lived in S. W. Pennsylvania and they can be identified in the records of Westmoreland, Allegheny and Washington Counties.

More information

HEREDITARY CANCER FAMILY HISTORY QUESTIONNAIRE

HEREDITARY CANCER FAMILY HISTORY QUESTIONNAIRE Packet received: Appointment: HEREDITARY CANCER FAMILY HISTORY QUESTIONNAIRE Please complete this questionnaire. While this can take some time, a review of your family history will allow us to provide

More information