Large scale kinship:familial Searching and DVI. Seoul, ISFG workshop

Size: px
Start display at page:

Download "Large scale kinship:familial Searching and DVI. Seoul, ISFG workshop"

Transcription

1 Large scale kinship:familial Searching and DVI Seoul, ISFG workshop 29 August 2017

2 Large scale kinship Familial Searching: search for a relative of an unidentified offender whose profile is available in a DNA database, with the intention of identifying the offender indirectly DVI: search a list of unidentified persons against each other and against a list of missing persons, with the intention of making identifications Familial searching is used to generate investigative leads; it is generally impossible to achieve a very high power (probability to find relatives if present) without having too many false positives In DVI it is important not to overlook any identifications Both are large scale applications; statistical properties need to be understood for optimal application and understanding of results. 2

3 Familial Searching Compute likelihood ratios for paternity (PI) or for being sibs (SI) Most efficient strategy (in terms of number of false positives per true positive) is to extract everyone whose LR exceeds a prespecified threshold t Large t: fewer false positives, but also less probability to find a relative Small t: more probability to find relative, but also more false positives The theory of Block 2 can be used to make ROC curves, in which we plot Log 10 P LR > 10 t H d, P LR > 10 t H p ) = Log 10 FPR 10 t, TPR 10 t as a function of t This can be done for a specific profile, or averaged 3

4 ROC curve Sibling Index (Averaged over profiles) Black:NGM Dotted:SGMPlus TPR: True Positive Rate FPR: False Positive Rate E.g.: on NGM profiles, LR-threshold of corresponds to FPR of about 10^-5 and TPR about 0.6 4

5 ROC curve Paternity Index (Averaged over profiles) 5

6 Different case, different challenge If someone has very common alleles then he ll share common alleles with his relatives. These give rise to a low LR, since it s fairly easy to obtain them by chance Since it s easy to obtain them by chance, relatively many unrelated people will genetically look like they could be related Hence, relatives hard to find If someone has very rare alleles then he s likely to share rare alleles with his relatives. These give rise to a high LR, since it s fairly hard to obtain them by chance Since it s hard to obtain them by chance, relatively few unrelated people will genetically look like they could be related Hence, relatives easier to find 6

7 SI, SGMPlus loci, various profiles 7

8 Siblings: LR-ranking in SGM+ profiles 8

9 Fully Bayesian interpretation Assuming that, in a database with N individuals There is at most one relative of a given kind The probability of this relative being person i is π i and the probability of there not being any relative is π 0 = 1 Suppose the obtained likelihood ratios are r 1,, r N. Set r 0 = 1. Then the probability that person i is the relative we look for is π i r i N j=0 π j r j Interpretation: the posterior probability is proportional to the prior probability and to the LR; for people outside the database no information is obtained. N i=1 π i 9

10 Case of equal priors If all π i are the same then the LR for the hypotheses 1. The database contains a relative of the specified type (H1) 2. The database does not contain a relative of the specified type (H2), is equal to 1 N r N i i=1 i.e., the average obtained LR for all individuals. Note that, if there is no relative in the whole database, we expect all r i to be 1, and so also the LR for the two hypotheses above is 1 in expectation, which it also needs to be in accordance with general theory. If there is no relative in the database, we expect the sum of all LR s that we obtain to be equal to the number of people searched against. 10

11 Analogy with possibly tricked deck of cards Familial search database size N Deck of N=52 cards Person 1 has PI=N and all other PI=0 Person 1 is parent/child of unknown offender N i=1 PI i = N No evidence that the database contains a relative If it does contain a relative, it has to be person 1 First card drawn is ace of spades Deck is tricked as aces of spades only LR in favour of tricked as aces of spades is 52; LR in favour of other tricks is 0; sum of 52 LR s is 52. No evidence that the deck is tricked If it is tricked, it has to be tricked as aces of spades. 11

12 Example 12

13 Strategy at the NFI 1. Autosomal search by PI and SI LR-threshold for further investigation equal to 1000, irrespective of number of loci compared This is enough to warrant interest but not nearly enough for identification Carry out additional DNA testing until either LR<1000 (stop) or LR>1,000,000,000 When no more additional testing can/needs be done, also compute Halfsib index for other types of relatedness Report any PI/SI/HSI equal to 100,000 or more 2. Y-chromosomal search: further type all profiles with at most one difference 13

14 By the book Utrecht: serial sex offender, unknown FS top ranked SI equals 5 million Additional profiling: SI> 10^9, Y-STR 22/23 match, mtdna 1 mismatch A brother of the database person was arrested and turned out to yield a direct dna match. Convicted. 14

15 Not by the book Familial search yields woman with PI=39000 Further testing: parent-child relation excluded Further testing: mitochondrial profiles match Age of woman + moment of crime: full/ maternal half siblings unlikely; paternal half-sibs? Mito-match best explained by maternal relationship Most support for autosomal and mitochondrial profiles: woman is sister of offender s mother. This was indeed verified with a full match. 15

16 Familial Searching illustrates The utility of LR distributions for case pre-assessment: ROC curves for the specific profile at hand, or averaged out to judge applicability of the method The irrelevance of LR distributions once the LR s have been calculated: posterior probabilities depend only on evidence we have, not on evidence we could have had That evidence should not be interpreted in terms of false rates: even if the false positive rate is very small, it may be that most of the positives are false positives That one should be careful with an equal prior for paternity testing: doing this with familial searching could lead to a probability of paternity >99,99% for several fathers which is clearly absurd. A LR alone can not be used to conclude about the true relationship. 16

17 Disaster Victim Identification Large lists of missing persons MP i and of unidentified individuals UI j Usually software would compute LR i,j, the LR for MP i = UI j versus Mp i is not related to Ui j If missing persons are related to each other, then neither hypothesis may be true In order not to overlook a possible identification, NFI uses a uniform mutation model Real mutations are often single step but a uniform model can be helpful when inconsistencies between genotypes are due to silent alleles or clerical errors 17

18 Pedigree with several MP s MN MG FN FG FGS MS1 MS2 MS3 M F FS1 FS1P FS2 FS2P Squares: men V X Y Z J K L Circles: women Reported Killed Not Available Reference Sample V1 V2 V4 V3 V5 : 5 victims 18

19 Hypothesis choosing With our 5 victims and 12 missing persons, we can construct many hypotheses: H 1 specifying that some victims are some MP s: number of possible such propositions is: 1 victim: 60 possibilities 2 victims: 1320 possibilities 3 victims: possibilities 4 victims: possibilities 5 victims: possibilities. H 2 : can specify that all victims are unrelated to the MP s, but relations between the victims are also possible. Huge number of combinations! For conceptual and computational reasons: choice to start with 1 victim versus 1 MP, equality vs. unrelatedness. Result: 60 Likelihood Ratios. 19

20 Resulting LR>100 victim 1-m V-f LR = 6x10 4 victim 2-m FS2-m / F-m FN-f J-m / K-m / L-f LR = 2x10 4 LR = 8x10 3 LR = 4x10 2 victim 3-f M-f LR = 1x10 9 victim 4-m Y-m / Z-f LR = 2x10 5 victim 5-f FS2-m / F-m J-m / K-m / L-f FN-f LR = 4x10 4 LR = 5x10 2 LR = 1x

21 Since Identification P(DNA Victim 3 is M) P(DNA Victim 3 is unrelated to M) = 10 9 and no other LR s relating Victim 3 to the pedigree are large, we decide that Victim 3 is M. Now we can continue in the same way as before, calculating 4*11=44 LR s: 21

22 Calculation 2: 4 victims with pedigree victim 1-m V-f GENDER!! LR = 2x10 6 victim 2-m FS2-m / F-m FN-f J-m / K-m / L-f LR = 2x10 4 LR = 8x10 3 LR = 4x10 2 victim 3 = M victim 4-m Y-m / Z-f LR = 2x10 5 victim 5-f FS2-m / F-m J-m / K-m / L-f FN-f LR = 4x10 4 LR = 5x10 2 LR = 1x

23 Combined Likelihood Ratio For analogous reasons, decide that Victim 1 is V. The joint LR for (Victim 3=M, Victim 1=V) vs. unrelated is the product of the two LR s that we ve computed: let G(V3) be the DNA-profile of victim 3 and analogous for G(V1). Then P(G(V3),G(V1) V3=M, V1=V) P(G(V3),G(V1) unrelated) = P(G(V3) V3=M,V1=V) P(G(V1) G(V3),V3=M,V1=V) P(G(V3) unrelated) P(G(V1) G(V3), unrelated) = = However: the unrelatedness assumption is questionable: V3 and V1 have large LR for being parent-child! If we choose as alternative hypothesis that they are parent-child unrelated to the pedigree, then the combined LR is again one billion.

24 Pedigree so far MN MG FN FG FGS MS1 MS2 MS3 V3 F FS1 FS1P FS2 FS2P V1 X Y Z J K L Missing persons Not Available V2 Reference Sample V4 V5 : 3 victims left Victim added 24

25 victim 1 = V Calculation 3: 3 victims with pedigree victim 2-m F-m LR = 1x10 9 FS2-m LR = 5x10 6 FN-f LR = 4x10 6 Gender mismatch! victim 3 = M victim 4-m Y-m / Z-f LR = 2x10 5 victim 5-f FS2-m / F-m J-m / K-m / L-f FN-f LR = 2x10 5 LR = 1x10 3 LR = 6x

26 Branching LR for (V2=F) versus (V2 unrelated to pedigree) is 10 9 LR for (V2=FS2) versus (V2 unrelated to pedigree) is This is not a contradiction: it just shows that the alternative hypothesis (V2 unrelated to pedigree) is far less likely than these two propositions. Conclusion: without other information (i.e. equal prior odds) the probability that V2=F is (almost) 99,5 %; the probability that V2=FS2 is (almost) 0,5 %. Continuing with both pedigrees in this case does not alter these probabilities: we get high LR s for Victim 4=Y, Victim 5=FN. These positions in the pedigree can not distinguish between F and FS2 either. So: high LR s alone are not sufficient to draw hard conclusions. 26

ICMP DNA REPORTS GUIDE

ICMP DNA REPORTS GUIDE ICMP DNA REPORTS GUIDE Distribution: General Sarajevo, 16 th December 2010 GUIDE TO ICMP DNA REPORTS 1. Purpose of This Document 1. The International Commission on Missing Persons (ICMP) endeavors to secure

More information

Primer on Human Pedigree Analysis:

Primer on Human Pedigree Analysis: Primer on Human Pedigree Analysis: Criteria for the selection and collection of appropriate Family Reference Samples John V. Planz. Ph.D. UNT Center for Human Identification Successful Missing Person ID

More information

4. Kinship Paper Challenge

4. Kinship Paper Challenge 4. António Amorim (aamorim@ipatimup.pt) Nádia Pinto (npinto@ipatimup.pt) 4.1 Approach After a woman dies her child claims for a paternity test of the man who is supposed to be his father. The test is carried

More information

AFDAA 2012 WINTER MEETING Population Statistics Refresher Course - Lecture 3: Statistics of Kinship Analysis

AFDAA 2012 WINTER MEETING Population Statistics Refresher Course - Lecture 3: Statistics of Kinship Analysis AFDAA 2012 WINTER MEETING Population Statistics Refresher Course - Lecture 3: Statistics of Kinship Analysis Ranajit Chakraborty, PhD Center for Computational Genomics Institute of Applied Genetics Department

More information

Popstats Parentage Statistics Strength of Genetic Evidence In Parentage Testing

Popstats Parentage Statistics Strength of Genetic Evidence In Parentage Testing Popstats Parentage Statistics Strength of Genetic Evidence In Parentage Testing Arthur J. Eisenberg, Ph.D. Director DNA Identity Laboratory UNT-Health Science Center eisenber@hsc.unt.edu PATERNITY TESTING

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/1122655/dc1 Supporting Online Material for Finding Criminals Through DNA of Their Relatives Frederick R. Bieber,* Charles H. Brenner, David Lazer *Author for correspondence.

More information

Non-Paternity: Implications and Resolution

Non-Paternity: Implications and Resolution Non-Paternity: Implications and Resolution Michelle Beckwith PTC Labs 2006 AABB HITA Meeting October 8, 2006 Considerations when identifying victims using relatives Identification requires knowledge of

More information

Methods of Parentage Analysis in Natural Populations

Methods of Parentage Analysis in Natural Populations Methods of Parentage Analysis in Natural Populations Using molecular markers, estimates of genetic maternity or paternity can be achieved by excluding as parents all adults whose genotypes are incompatible

More information

1/8/2013. Free Online Training. Using DNA and CODIS to Resolve Missing and Unidentified Person Cases. Click Online Training

1/8/2013. Free Online Training. Using DNA and CODIS to Resolve Missing and Unidentified Person Cases.  Click Online Training Free Online Training Using DNA and CODIS to Resolve Missing and Unidentified Person Cases B.J. Spamer NamUs Training and Analysis Division Office: 817-735-5473 Cell: 817-964-1879 Email: BJ.Spamer@unthsc.edu

More information

Free Online Training

Free Online Training Using DNA and CODIS to Resolve Missing and Unidentified Person Cases B.J. Spamer NamUs Training and Analysis Division Office: 817-735-5473 Cell: 817-964-1879 Email: BJ.Spamer@unthsc.edu Free Online Training

More information

1) Using the sightings data, determine who moved from one area to another and fill this data in on the data sheet.

1) Using the sightings data, determine who moved from one area to another and fill this data in on the data sheet. Parentage and Geography 5. The Life of Lulu the Lioness: A Heroine s Story Name: Objective Using genotypes from many individuals, determine maternity, paternity, and relatedness among a group of lions.

More information

Pedigrees How do scientists trace hereditary diseases through a family history?

Pedigrees How do scientists trace hereditary diseases through a family history? Why? Pedigrees How do scientists trace hereditary diseases through a family history? Imagine you want to learn about an inherited genetic trait present in your family. How would you find out the chances

More information

DNA Parentage Test No Summary Report

DNA Parentage Test No Summary Report Collaborative Testing Services, Inc FORENSIC TESTING PROGRAM DNA Parentage Test No. 165871 Summary Report This proficiency test was sent to 45 participants. Each participant received a sample pack consisting

More information

Detection of Misspecified Relationships in Inbred and Outbred Pedigrees

Detection of Misspecified Relationships in Inbred and Outbred Pedigrees Detection of Misspecified Relationships in Inbred and Outbred Pedigrees Lei Sun 1, Mark Abney 1,2, Mary Sara McPeek 1,2 1 Department of Statistics, 2 Department of Human Genetics, University of Chicago,

More information

Developing Conclusions About Different Modes of Inheritance

Developing Conclusions About Different Modes of Inheritance Pedigree Analysis Introduction A pedigree is a diagram of family relationships that uses symbols to represent people and lines to represent genetic relationships. These diagrams make it easier to visualize

More information

Manual for Familias 3

Manual for Familias 3 Manual for Familias 3 Daniel Kling 1 (daniellkling@gmailcom) Petter F Mostad 2 (mostad@chalmersse) ThoreEgeland 1,3 (thoreegeland@nmbuno) 1 Oslo University Hospital Department of Forensic Services Oslo,

More information

DNA: Statistical Guidelines

DNA: Statistical Guidelines Frequency calculations for STR analysis When a probative association between an evidence profile and a reference profile is made, a frequency estimate is calculated to give weight to the association. Frequency

More information

DNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding

DNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding DNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding by Dr. Ing. Robert L. Baber 2014 July 26 Rights reserved, see the copyright notice at http://gengen.rlbaber.de

More information

BAYESIAN STATISTICAL CONCEPTS

BAYESIAN STATISTICAL CONCEPTS BAYESIAN STATISTICAL CONCEPTS A gentle introduction Alex Etz @alxetz ß Twitter (no e in alex) alexanderetz.com ß Blog November 5 th 2015 Why do we do statistics? Deal with uncertainty Will it rain today?

More information

Pedigree Charts. The family tree of genetics

Pedigree Charts. The family tree of genetics Pedigree Charts The family tree of genetics Pedigree Charts I II III What is a Pedigree? A pedigree is a chart of the genetic history of family over several generations. Scientists or a genetic counselor

More information

Puzzling Pedigrees. Essential Question: How can pedigrees be used to study the inheritance of human traits?

Puzzling Pedigrees. Essential Question: How can pedigrees be used to study the inheritance of human traits? Name: Puzzling Pedigrees Essential Question: How can pedigrees be used to study the inheritance of human traits? Studying inheritance in humans is more difficult than studying inheritance in fruit flies

More information

Halley Family. Mystery? Mystery? Can you solve a. Can you help solve a

Halley Family. Mystery? Mystery? Can you solve a. Can you help solve a Can you solve a Can you help solve a Halley Halley Family Family Mystery? Mystery? Who was the great grandfather of John Bennett Halley? He lived in Maryland around 1797 and might have been born there.

More information

Statistical methods in genetic relatedness and pedigree analysis

Statistical methods in genetic relatedness and pedigree analysis Statistical methods in genetic relatedness and pedigree analysis Oslo, January 2018 Magnus Dehli Vigeland and Thore Egeland Exercise set III: Coecients of pairwise relatedness Exercise III-1. Use Wright's

More information

DAR POLICY STATEMENT AND BACKGROUND Using DNA Evidence for DAR Applications

DAR POLICY STATEMENT AND BACKGROUND Using DNA Evidence for DAR Applications Effective January 1, 2014, DAR will begin accepting Y-DNA evidence in support of new member applications and supplemental applications as one element in a structured analysis. This analysis will use a

More information

Pizza and Who do you think you are?

Pizza and Who do you think you are? Pizza and Who do you think you are? an overview of one of the newest and possibly more helpful developments in researching genealogy and family history that of using DNA for research What is DNA? Part

More information

DNA Basics. OLLI: Genealogy 101 October 1, ~ Monique E. Rivera ~

DNA Basics. OLLI: Genealogy 101 October 1, ~ Monique E. Rivera ~ DNA Basics OLLI: Genealogy 101 October 1, 2018 ~ Monique E. Rivera ~ WHAT IS DNA? DNA (deoxyribonucleic acid) is found in every living cell everywhere. It is a long chemical chain that tells our cells

More information

Statistical Interpretation in Making DNA-based Identification of Mass Victims

Statistical Interpretation in Making DNA-based Identification of Mass Victims Statistical Interretation in Making DNAbased Identification of Mass Victims KyoungJin Shin wan Young Lee Woo Ick Yang Eunho a Det. of Forensic Medicine Yonsei University College of Medicine Det. of Information

More information

DNA Parentage Test No Summary Report

DNA Parentage Test No Summary Report Collaborative Testing Services, Inc FORENSIC TESTING PROGRAM DNA Parentage Test No. 175871 Summary Report This proficiency test was sent to 45 participants. Each participant received a sample pack consisting

More information

Lecture 1: Introduction to pedigree analysis

Lecture 1: Introduction to pedigree analysis Lecture 1: Introduction to pedigree analysis Magnus Dehli Vigeland NORBIS course, 8 th 12 th of January 2018, Oslo Outline Part I: Brief introductions Pedigrees symbols and terminology Some common relationships

More information

DNA Parentage Test No Summary Report

DNA Parentage Test No Summary Report Collaborative Testing Services, Inc FORENSIC TESTING PROGRAM DNA Parentage Test No. 16-5870 Summary Report This proficiency test was sent to 27 participants. Each participant received a sample pack consisting

More information

[CLIENT] SmithDNA1701 DE January 2017

[CLIENT] SmithDNA1701 DE January 2017 [CLIENT] SmithDNA1701 DE1704205 11 January 2017 DNA Discovery Plan GOAL Create a research plan to determine how the client s DNA results relate to his family tree as currently constructed. The client s

More information

Using Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM

Using Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM Using Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.

More information

TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter

TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter 1-1: DNA: WHERE DO I START? Definition Genetic genealogy is the application of genetics to traditional genealogy. Genetic genealogy uses genealogical

More information

Contributed by "Kathy Hallett"

Contributed by Kathy Hallett National Geographic: The Genographic Project Name Background The National Geographic Society is undertaking the ambitious process of tracking human migration using genetic technology. By using the latest

More information

THE BASICS OF DNA TESTING. By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library

THE BASICS OF DNA TESTING. By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library THE BASICS OF DNA TESTING By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library TYPES OF TESTS Mitochondrial DNA (mtdna/mdna) Y-DNA Autosomal DNA (atdna/audna) MITOCHONDRIAL DNA Found

More information

Automated Discovery of Pedigrees and Their Structures in Collections of STR DNA Specimens Using a Link Discovery Tool

Automated Discovery of Pedigrees and Their Structures in Collections of STR DNA Specimens Using a Link Discovery Tool University of Tennessee, Knoxville Trace: Tennessee Research and Creative Exchange Masters Theses Graduate School 5-2010 Automated Discovery of Pedigrees and Their Structures in Collections of STR DNA

More information

Pedigree Reconstruction using Identity by Descent

Pedigree Reconstruction using Identity by Descent Pedigree Reconstruction using Identity by Descent Bonnie Kirkpatrick Electrical Engineering and Computer Sciences University of California at Berkeley Technical Report No. UCB/EECS-2010-43 http://www.eecs.berkeley.edu/pubs/techrpts/2010/eecs-2010-43.html

More information

On identification problems requiring linked autosomal markers

On identification problems requiring linked autosomal markers * Title Page (with authors & addresses) On identification problems requiring linked autosomal markers Thore Egeland a Nuala Sheehan b a Department of Medical Genetics, Ulleval University Hospital, 0407

More information

Chapter 2: Genes in Pedigrees

Chapter 2: Genes in Pedigrees Chapter 2: Genes in Pedigrees Chapter 2-0 2.1 Pedigree definitions and terminology 2-1 2.2 Gene identity by descent (ibd) 2-5 2.3 ibd of more than 2 genes 2-14 2.4 Data on relatives 2-21 2.1.1 GRAPHICAL

More information

Chromosome X haplotyping in deficiency paternity testing principles and case report

Chromosome X haplotyping in deficiency paternity testing principles and case report International Congress Series 1239 (2003) 815 820 Chromosome X haplotyping in deficiency paternity testing principles and case report R. Szibor a, *, I. Plate a, J. Edelmann b, S. Hering c, E. Kuhlisch

More information

Autosomal DNA. What is autosomal DNA? X-DNA

Autosomal DNA. What is autosomal DNA? X-DNA ANGIE BUSH AND PAUL WOODBURY info@thednadetectives.com November 1, 2014 Autosomal DNA What is autosomal DNA? Autosomal DNA consists of all nuclear DNA except for the X and Y sex chromosomes. There are

More information

What Can I Learn From DNA Testing?

What Can I Learn From DNA Testing? What Can I Learn From DNA Testing? From where did my ancestors migrate? What is my DNA Signature? Was my ancestor a Jewish Cohanim Priest? Was my great great grandmother really an Indian Princes? I was

More information

Two-point linkage analysis using the LINKAGE/FASTLINK programs

Two-point linkage analysis using the LINKAGE/FASTLINK programs 1 Two-point linkage analysis using the LINKAGE/FASTLINK programs Copyrighted 2018 Maria Chahrour and Suzanne M. Leal These exercises will introduce the LINKAGE file format which is the standard format

More information

Autosomal-DNA. How does the nature of Jewish genealogy make autosomal DNA research more challenging?

Autosomal-DNA. How does the nature of Jewish genealogy make autosomal DNA research more challenging? Autosomal-DNA How does the nature of Jewish genealogy make autosomal DNA research more challenging? Using Family Finder results for genealogy is more challenging for individuals of Jewish ancestry because

More information

KINSHIP ANALYSIS AND HUMAN IDENTIFICATION IN MASS DISASTERS: THE USE OF MDKAP FOR THE WORLD TRADE CENTER TRAGEDY

KINSHIP ANALYSIS AND HUMAN IDENTIFICATION IN MASS DISASTERS: THE USE OF MDKAP FOR THE WORLD TRADE CENTER TRAGEDY 1 KINSHIP ANALYSIS AND HUMAN IDENTIFICATION IN MASS DISASTERS: THE USE OF MDKAP FOR THE WORLD TRADE CENTER TRAGEDY Benoît Leclair 1, Steve Niezgoda 2, George R. Carmody 3 and Robert C. Shaler 4 1 Myriad

More information

DNA Testing. February 16, 2018

DNA Testing. February 16, 2018 DNA Testing February 16, 2018 What Is DNA? Double helix ladder structure where the rungs are molecules called nucleotides or bases. DNA contains only four of these nucleotides A, G, C, T The sequence that

More information

Using Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM

Using Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM Using Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.

More information

Kenneth Nordtvedt. Many genetic genealogists eventually employ a time-tomost-recent-common-ancestor

Kenneth Nordtvedt. Many genetic genealogists eventually employ a time-tomost-recent-common-ancestor Kenneth Nordtvedt Many genetic genealogists eventually employ a time-tomost-recent-common-ancestor (TMRCA) tool to estimate how far back in time the common ancestor existed for two Y-STR haplotypes obtained

More information

Introduction to Autosomal DNA Tools

Introduction to Autosomal DNA Tools GENETIC GENEALOGY JOURNEY Debbie Parker Wayne, CG, CGL Introduction to Autosomal DNA Tools Just as in the old joke about a new genealogist walking into the library and asking for the book that covers my

More information

An Introduction. Your DNA. and Your Family Tree. (Mitochondrial DNA) Presentation by: 4/8/17 Page 1 of 10

An Introduction. Your DNA. and Your Family Tree. (Mitochondrial DNA) Presentation by: 4/8/17 Page 1 of 10 An Introduction Your DNA and Your Family Tree (Mitochondrial DNA) Presentation by: FredCoffey@aol.com 4/8/17 Page 1 of 10 Coffey Surname, y-dna Project We're now ready to move on and look at the type of

More information

Ewing Surname Y-DNA Project Article 8

Ewing Surname Y-DNA Project Article 8 Ewing Surname Y-DNA Project Article 8 This is the eighth in a series of articles about the Ewing Surname Y-DNA Project. The previous seven articles have appeared in the last seven issues of the Journal

More information

Using Pedigrees to interpret Mode of Inheritance

Using Pedigrees to interpret Mode of Inheritance Using Pedigrees to interpret Mode of Inheritance Objectives Use a pedigree to interpret the mode of inheritance the given trait is with 90% accuracy. 11.2 Pedigrees (It s in your genes) Pedigree Charts

More information

NON-RANDOM MATING AND INBREEDING

NON-RANDOM MATING AND INBREEDING Instructor: Dr. Martha B. Reiskind AEC 495/AEC592: Conservation Genetics DEFINITIONS Nonrandom mating: Mating individuals are more closely related or less closely related than those drawn by chance from

More information

Your Family 101 Beginning Genealogical Research

Your Family 101 Beginning Genealogical Research Your Family 101 Beginning Genealogical Research What Will We Cover Today? Session 1: Getting Started Session 2: Your Resources Session 3: Common Mistakes and Pitfalls Session 4: DNA Testing and Medical

More information

Genesis and Genetics Matthew Price

Genesis and Genetics Matthew Price Genesis and Genetics Matthew Price Apologetics and Creation Camp 16 June 2018 Karakariki Christian Camp, Waikato, NZ 1 What is Science? 2 What is Science? Hypothesis Theory Start with a hypothesis; a reasonable

More information

Laboratory 1: Uncertainty Analysis

Laboratory 1: Uncertainty Analysis University of Alabama Department of Physics and Astronomy PH101 / LeClair May 26, 2014 Laboratory 1: Uncertainty Analysis Hypothesis: A statistical analysis including both mean and standard deviation can

More information

University of Washington, TOPMed DCC July 2018

University of Washington, TOPMed DCC July 2018 Module 12: Comput l Pipeline for WGS Relatedness Inference from Genetic Data Timothy Thornton (tathornt@uw.edu) & Stephanie Gogarten (sdmorris@uw.edu) University of Washington, TOPMed DCC July 2018 1 /

More information

1.4.1(Question should be rather: Another sibling of these two brothers) 25% % % (population risk of heterozygot*2/3*1/4)

1.4.1(Question should be rather: Another sibling of these two brothers) 25% % % (population risk of heterozygot*2/3*1/4) ----------------------------------------------------------Chapter 1--------------------------------------------------------------- (each task of this chapter is dedicated as x (x meaning the exact task.

More information

Getting the Most Out of Your DNA Matches

Getting the Most Out of Your DNA Matches Helen V. Smith PG Dip Public Health, BMedLabSci, ADCLT, Dip. Fam. Hist. PLCGS 46 Kraft Road, Pallara, Qld, 4110 Email: HVSresearch@DragonGenealogy.com Website: www.dragongenealogy.com Blog: http://www.dragongenealogy.com/blog/

More information

Using X-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM

Using X-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM Using X-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.

More information

Spring 2013 Assignment Set #3 Pedigree Analysis. Set 3 Problems sorted by analytical and/or content type

Spring 2013 Assignment Set #3 Pedigree Analysis. Set 3 Problems sorted by analytical and/or content type Biology 321 Spring 2013 Assignment Set #3 Pedigree Analysis You are responsible for working through on your own, the general rules of thumb for analyzing pedigree data to differentiate autosomal and sex-linked

More information

Algorithms for Genetics: Basics of Wright Fisher Model and Coalescent Theory

Algorithms for Genetics: Basics of Wright Fisher Model and Coalescent Theory Algorithms for Genetics: Basics of Wright Fisher Model and Coalescent Theory Vineet Bafna Harish Nagarajan and Nitin Udpa 1 Disclaimer Please note that a lot of the text and figures here are copied from

More information

GEDmatch Home Page The upper left corner of your home page has Information about you and links to lots of helpful information. Check them out!

GEDmatch Home Page The upper left corner of your home page has Information about you and links to lots of helpful information. Check them out! USING GEDMATCH Created March 2015 GEDmatch is a free, non-profit site that accepts raw autosomal data files from Ancestry, FTDNA, and 23andme. As such, it provides a large autosomal database that spans

More information

DNA Solu)ons for Brick Walls And Adop)on

DNA Solu)ons for Brick Walls And Adop)on DNA Solu)ons for Brick Walls And Adop)on "I have not failed. I've just found ten thousand ways that won't work." Thomas Edison Wise Woman Gene+c Genealogy Comments Listen Carefully! 1. DNA is not the be

More information

have to get on the phone or family members for the names of more distant relatives.

have to get on the phone or  family members for the names of more distant relatives. Ideas for Teachers: Give each student the family tree worksheet to fill out at home. Explain to them that each family is different and this worksheet is meant to help them plan their family tree. They

More information

Lutz Roewer, Sascha Willuweit Dept. Forensic Genetics, Institute of Legal Medicine and Forensic Sciences Charité Universitätsmedizin Berlin, Germany

Lutz Roewer, Sascha Willuweit Dept. Forensic Genetics, Institute of Legal Medicine and Forensic Sciences Charité Universitätsmedizin Berlin, Germany The new YHRD Lutz Roewer, Sascha Willuweit Dept. Forensic Genetics, Institute of Legal Medicine and Forensic Sciences Charité Universitätsmedizin Berlin, Germany 2000 2004 2008 2014 Aug 99 Jun 00 Jan 03

More information

Genetic Identity and

Genetic Identity and Genetic Identity and GACATGTAGCTCTTCACTTCACCCAGGTTGGGTTGTGTCAACAGGAAACATTGTAACATATCACTTGGATTAGCACCTAGG/TTAT/TTAT/TTA Community DTC Genetic Testing Workshop The National Academies' August 31 September 1,

More information

The genealogical history of a population The coalescent process. Identity by descent Distribution of pairwise coalescence times

The genealogical history of a population The coalescent process. Identity by descent Distribution of pairwise coalescence times The coalescent The genealogical history of a population The coalescent process Identity by descent Distribution of pairwise coalescence times Adding mutations Expected pairwise differences Evolutionary

More information

Coalescence. Outline History. History, Model, and Application. Coalescence. The Model. Application

Coalescence. Outline History. History, Model, and Application. Coalescence. The Model. Application Coalescence History, Model, and Application Outline History Origins of theory/approach Trace the incorporation of other s ideas Coalescence Definition and descriptions The Model Assumptions and Uses Application

More information

Inbreeding and self-fertilization

Inbreeding and self-fertilization Inbreeding and self-fertilization Introduction Remember that long list of assumptions associated with derivation of the Hardy-Weinberg principle that we just finished? Well, we re about to begin violating

More information

and g2. The second genotype, however, has a doubled opportunity of transmitting the gene X to any

and g2. The second genotype, however, has a doubled opportunity of transmitting the gene X to any Brit. J. prev. soc. Med. (1958), 12, 183-187 GENOTYPIC FREQUENCIES AMONG CLOSE RELATIVES OF PROPOSITI WITH CONDITIONS DETERMINED BY X-RECESSIVE GENES BY GEORGE KNOX* From the Department of Social Medicine,

More information

Statistical DNA Forensics Theory, Methods and Computation

Statistical DNA Forensics Theory, Methods and Computation Statistical DNA Forensics Theory, Methods and Computation Wing Kam Fung and Yue-Qing Hu Department of Statistics and Actuarial Science, The University of Hong Kong, Hong Kong Statistical DNA Forensics

More information

Linkage Analysis in Merlin. Meike Bartels Kate Morley Danielle Posthuma

Linkage Analysis in Merlin. Meike Bartels Kate Morley Danielle Posthuma Linkage Analysis in Merlin Meike Bartels Kate Morley Danielle Posthuma Software for linkage analyses Genehunter Mendel Vitesse Allegro Simwalk Loki Merlin. Mx R Lisrel MERLIN software Programs: MERLIN

More information

Gene coancestry in pedigrees and populations

Gene coancestry in pedigrees and populations Gene coancestry in pedigrees and populations Thompson, Elizabeth University of Washington, Department of Statistics Box 354322 Seattle, WA 98115-4322, USA E-mail: eathomp@uw.edu Glazner, Chris University

More information

DNA Testing What you need to know first

DNA Testing What you need to know first DNA Testing What you need to know first This article is like the Cliff Notes version of several genetic genealogy classes. It is a basic general primer. The general areas include Project support DNA test

More information

Probability and Counting Rules. Chapter 3

Probability and Counting Rules. Chapter 3 Probability and Counting Rules Chapter 3 Probability as a general concept can be defined as the chance of an event occurring. Many people are familiar with probability from observing or playing games of

More information

Inbreeding and self-fertilization

Inbreeding and self-fertilization Inbreeding and self-fertilization Introduction Remember that long list of assumptions associated with derivation of the Hardy-Weinberg principle that I went over a couple of lectures ago? Well, we re about

More information

Genetics. 7 th Grade Mrs. Boguslaw

Genetics. 7 th Grade Mrs. Boguslaw Genetics 7 th Grade Mrs. Boguslaw Introduction and Background Genetics = the study of heredity During meiosis, gametes receive ½ of their parent s chromosomes During sexual reproduction, two gametes (male

More information

DNA Parentage Test No Summary Report

DNA Parentage Test No Summary Report Collaborative Testing Services, Inc FORENSIC TESTING PROGRAM DNA Parentage Test No. 155872 Summary Report This proficiency test was sent to 38 participants. Each participant received a sample pack consisting

More information

Statistical DNA Forensics Theory, Methods and Computation

Statistical DNA Forensics Theory, Methods and Computation Statistical DNA Forensics Theory, Methods and Computation Wing Kam Fung and Yue-Qing Hu Department of Statistics and Actuarial Science, The University of Hong Kong, Hong Kong Statistical DNA Forensics

More information

Population Genetics using Trees. Peter Beerli Genome Sciences University of Washington Seattle WA

Population Genetics using Trees. Peter Beerli Genome Sciences University of Washington Seattle WA Population Genetics using Trees Peter Beerli Genome Sciences University of Washington Seattle WA Outline 1. Introduction to the basic coalescent Population models The coalescent Likelihood estimation of

More information

Genetic Genealogy. Rules and Tools. Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter

Genetic Genealogy. Rules and Tools. Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter Genetic Genealogy Rules and Tools Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter I am NOT this guy! 2 Genealogy s Newest Tool Genealogy research: Study of Family History Identifies

More information

Revising how the computer program

Revising how the computer program Molecular Ecology (2007) 6, 099 06 doi: 0./j.365-294X.2007.03089.x Revising how the computer program Blackwell Publishing Ltd CERVUS accommodates genotyping error increases success in paternity assignment

More information

Bias and Power in the Estimation of a Maternal Family Variance Component in the Presence of Incomplete and Incorrect Pedigree Information

Bias and Power in the Estimation of a Maternal Family Variance Component in the Presence of Incomplete and Incorrect Pedigree Information J. Dairy Sci. 84:944 950 American Dairy Science Association, 2001. Bias and Power in the Estimation of a Maternal Family Variance Component in the Presence of Incomplete and Incorrect Pedigree Information

More information

Lecture 6: Inbreeding. September 10, 2012

Lecture 6: Inbreeding. September 10, 2012 Lecture 6: Inbreeding September 0, 202 Announcements Hari s New Office Hours Tues 5-6 pm Wed 3-4 pm Fri 2-3 pm In computer lab 3306 LSB Last Time More Hardy-Weinberg Calculations Merle Patterning in Dogs:

More information

Growing the Family Tree: The Power of DNA in Reconstructing Family Relationships

Growing the Family Tree: The Power of DNA in Reconstructing Family Relationships Growing the Family Tree: The Power of DNA in Reconstructing Family Relationships Luke A. D. Hutchison Natalie M. Myres Scott R. Woodward Sorenson Molecular Genealogy Foundation (www.smgf.org) 2511 South

More information

Kinship/relatedness. David Balding Professor of Statistical Genetics University of Melbourne, and University College London.

Kinship/relatedness. David Balding Professor of Statistical Genetics University of Melbourne, and University College London. Kinship/relatedness David Balding Professor of Statistical Genetics University of Melbourne, and University College London 2 Feb 2016 1 Ways to measure relatedness 2 Pedigree-based kinship coefficients

More information

Objective: Why? 4/6/2014. Outlines:

Objective: Why? 4/6/2014. Outlines: Objective: Develop mathematical models that quantify/model resemblance between relatives for phenotypes of a quantitative trait : - based on pedigree - based on markers Outlines: Causal model for covariances

More information

Populations. Arindam RoyChoudhury. Department of Biostatistics, Columbia University, New York NY 10032, U.S.A.,

Populations. Arindam RoyChoudhury. Department of Biostatistics, Columbia University, New York NY 10032, U.S.A., Change in Recessive Lethal Alleles Frequency in Inbred Populations arxiv:1304.2955v1 [q-bio.pe] 10 Apr 2013 Arindam RoyChoudhury Department of Biostatistics, Columbia University, New York NY 10032, U.S.A.,

More information

The Mismatch Between Probable Cause and Partial Matching

The Mismatch Between Probable Cause and Partial Matching natalie ram The Mismatch Between Probable Cause and Partial Matching In mid-december, as one of the outgoing Bush Administration s last minute regulations, the Department of Justice radically expanded

More information

Enhanced Kinship Analysis and STR-based DNA Typing for Human Identification in Mass Fatality Incidents: The Swissair Flight 111 Disaster

Enhanced Kinship Analysis and STR-based DNA Typing for Human Identification in Mass Fatality Incidents: The Swissair Flight 111 Disaster JForensicSci,Sept. 2004, Vol. 49, No. 5 Paper ID JFS2003311 Available online at: www.astm.org Benoît Leclair, 1,2 Ph.D.; Chantal J. Frégeau, 1 Ph.D.; Kathy L. Bowen, 1 B.Sc.; and Ron M. Fourney, 1 Ph.D.

More information

Mathematics 'A' level Module MS1: Statistics 1. Probability. The aims of this lesson are to enable you to. calculate and understand probability

Mathematics 'A' level Module MS1: Statistics 1. Probability. The aims of this lesson are to enable you to. calculate and understand probability Mathematics 'A' level Module MS1: Statistics 1 Lesson Three Aims The aims of this lesson are to enable you to calculate and understand probability apply the laws of probability in a variety of situations

More information

TDT vignette Use of snpstats in family based studies

TDT vignette Use of snpstats in family based studies TDT vignette Use of snpstats in family based studies David Clayton April 30, 2018 Pedigree data The snpstats package contains some tools for analysis of family-based studies. These assume that a subject

More information

Meek DNA Project Group B Ancestral Signature

Meek DNA Project Group B Ancestral Signature Meek DNA Project Group B Ancestral Signature The purpose of this paper is to explore the method and logic used by the author in establishing the Y-DNA ancestral signature for The Meek DNA Project Group

More information

DNA for Genealogy Librarians. Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District

DNA for Genealogy Librarians. Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District DNA for Genealogy Librarians Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District What does DNA do? It replicates itself. It codes for the production

More information

Mitochondrial DNA (mtdna) JGSGO June 5, 2018

Mitochondrial DNA (mtdna) JGSGO June 5, 2018 Mitochondrial DNA (mtdna) JGSGO June 5, 2018 MtDNA - outline What is it? What do you do with it? How do you maximize its value? 2 3 mtdna a double-stranded, circular DNA that is stored in mitochondria

More information

Identification of the Hypothesized African Ancestry of the Wife of Pvt. Henry Windecker Using Genomic Testing of the Autosomes.

Identification of the Hypothesized African Ancestry of the Wife of Pvt. Henry Windecker Using Genomic Testing of the Autosomes. Identification of the Hypothesized African Ancestry of the Wife of Pvt. Henry Windecker Using Genomic Testing of the Autosomes Introduction African Ancestry: The hypothesis, based on considerable circumstantial

More information

Compound Probability. Set Theory. Basic Definitions

Compound Probability. Set Theory. Basic Definitions Compound Probability Set Theory A probability measure P is a function that maps subsets of the state space Ω to numbers in the interval [0, 1]. In order to study these functions, we need to know some basic

More information

Genealogical Research

Genealogical Research DNA, Ancestry, and Your Genealogical Research Walter Steets Houston Genealogical Forum DNA Interest Group March 2, 2019 1 Today s Agenda Brief review of basic genetics and terms used in genetic genealogy

More information

Find JCD Project Date: Identification-DNA Process Updated:

Find JCD Project Date: Identification-DNA Process Updated: New Look Investigations Created by: Jack Friess Find JCD Project Date: 04-20-2018 Identification-DNA Process Updated: 05-24-2018 Questions and Answers Identification-DNA (ID-DNA) is a scientific process

More information