What Can I Learn From DNA Testing?
|
|
- Noreen Brown
- 6 years ago
- Views:
Transcription
1 What Can I Learn From DNA Testing? From where did my ancestors migrate? What is my DNA Signature? Was my ancestor a Jewish Cohanim Priest? Was my great great grandmother really an Indian Princes? I was adopted. Who was my father? By Are we related? Douglas M. Mumma 8 August 2006
2 Chromosomes (your genetic blueprint ) 46 chromosomes in the cell nucleus - 23 from the father and 23 from the mother. First 22 are called autosomal and can exchange material between each other. Chromosome number 23 is the sex chromosome. Women have two X chromosomes, but men have an X and a Y chromosome. The male sperm contains either an X or a Y. 2
3 Your DNA 3
4 Unique Cell Properties Exploited for Genealogy Mitochrondrial DNA ( mtdna ) The mtdnais onlypassed from a mother to her children (sons & daughters). Y-Chromosome DNA ( Y-DNA or nucleic DNA) The male Y-chromosome is only passed from father to his sons. Polymorphisms The DNA alphabet sequence changes or mutates slowly after many generations. About 1 mutation every 500 generations for each Y-DNA marker, slower for mtdna. 4
5 mtdna & Y-DNA Inheritance Chart 5
6 Male Y-DNA Descendancy 6
7 So, What Can I Learn From My DNA - Genealogically Speaking? Your DNA signature - Gee Whiz! The migration path your ancient ancestors and possible ethnic makeup. Whether men share a recent common paternal ancestor. Whether two women or a man & woman share a recent common maternal ancestor. 7
8 Solving a Genealogical Puzzle Clearly state the genealogical question. Evaluate whether DNA can answer the question. Have the participants DNA analyzed. Analyze the results matching or not matching. Hopefully your puzzle will be solved. 8
9 Partial screen shot of Haplogroup results Haplogroup - A genetic population group associated with early human migrations determined from SNP tests or Y-STRs. Haplotype - One person's set of Y-STR values for the markers that have been tested. Two individuals that match exactly on all markers have the same haplotype. 9
10 Y-DNA R1b Haplogroup Migration 10
11 mtdna Haplogroup Results» 11
12 Partial screen shot of Y-DNA results 12
13 William F. Mumaw illegitimate? Traditional genealogy could not connect William F. Mumaw. Data Suggested William was the illegitimate son of Anna Mumaw. -- Hypothesis! DNA confirms he is not a Mumaw. -- Fact! a 385b i ii MUMMA Haplotype William s Descendant
14 William F. Mumaw illegitimate? YES! Traditional genealogy could not connect William F. Mumaw. Data Suggested William was the illegitimate son of Anna Mumaw. -- Hypothesis! DNA confirms he is not a Mumaw. -- Fact! Further research suggests father is a Webb. Two Webb descendants provide DNA samples. DNA Results prove a conclusive Webb relationship a 385b i ii MUMMA Haplotype William s Descendant Webb # Webb #
15 Tom Bell discovers his genetic surname (A needle in the hay stack!) Tom Bell s great grandfather was adopted. Tom submits his DNA to FTDNA for analysis. Has a perfect DNA match with immigrant Peter Mumma, 37 out of 37 markers. Tom s genetic great grandfather was identified as a Mumma. Results confirmed through obscure documentation 15
16 Results Of Markers Three Immigrant Branches Have Unique Mutations < Y-STR > < Y-STR > < Y-STR > Cells in red G Y Y C C 4 4 D don't match A C C D D 4 3 E ID Reference # the Momma T A A Y Y 2 8 L & Comment modal a b i ii ii-i a b a b c d e A II a II b a b T haplotype * * * * * * * * * * * * * H4 * A Kit# M# Surname <= Modal Haplotype European MOMMA / REENSTJERNA Descendants M Reenstjerna _E d11151 M Momma _E M Momma _E Descendants of Immigrant JACOB MUMMA - allele 17 at DYS Mumma _ Mumma _ M-07 7 Mumma _ Mumma _ UNCONNECTED - allele 17 or 18 at DYS Mumma _U (brother) Mumma _U (brother) M-08 8 Moomau _U Moomau _U Moma _U M Mumah _U Descendants of Immigrant PETER MUMMA - allele 13 at DYS388 & allele 35 at DYS CDYa M Muma _U M Mumma _U Mumma _U Mumma _ Bell _ Descendants of Immigrant LEONARD MUMMA - allele 16 at DYS570 M Mummau _ (father) M-04 4 Mummau _ (son) Moomaw _ M-03 3 Moomaw _217415a11 M Mumma _ M Mumma _ (brother) M Mumma _ (brother) Mumma _ M Mumaw _ M-05 5 Mumma _ M-01 1 Mumma _ Mumma _ M-02 2 Mumma _ M Moomaw _ M-06 6 Moomaw _ M Moomaw _ Mumma _ M Mumaugh _ M Moomaw _ M Moomaw _ M Mummah _ M-09 9 Mumma _ UNCONNECTED - allele 16 at DYS570 M Muma _U M Muma _U M Muma _U Mumma _U Mewmaw _U Mumma _U M Mumma _U Mummaugh _U Stevenson _U Mumma 0 ## _U
17 Mumma DNA Results Cladogram (Phylogenetic Chart) 17
18 YHRD Database Haplotype Matches 3 out of 15,815 samples 18
19 12-18 Markers ($95 - $99) How Many Markers? (measurements along the chromosome) Generally adequate to prove Non-Relationships Markers ($138 - $155) Non-relationships become clear. May define close relationships Markers ($189 - $199) Family branches may become clear. 67 -? Markers ($269 - $?) For serious surname research projects Perfect matches are related 19
20 MRCA Number of Markers vs. Generations 20
21 Relatedness Based on Genetic Distance (number of mutations) Relatedness based on genetic distances 12 Markers 25 Markers 37 Markers 67 Markers Closely Related TBD Possibly Related TBD Doubtful Relationship TBD Not Related 3 or more 5 or more 7 or more 8 or more 21
22 DNA Genealogical Testing Companies Family Tree DNA 12, 25, 37 & 67 markers (Uni. of Arizona) Relative Genetics 18, 26, 43 markers (BYU Sorenson laboratories) DNA Heritage markers (Sorenson - English $6/marker) GeneTree 43 markers (Sorenson - specialty is paternity testing) Oxford Ancestors 10 markers ( 180 Oxford University) 22
23 SMGF Database (Sorenson Molecular Genealogy Foundation) Goal - Build the world's foremost collection of DNA and corresponding genealogical information. Begun in 2000 by BYU as the Molecular Genealogy Research Project funded by Sorenson. SMGF formed to create the SMGF databases. Participation is Free with DNA & 4 gen pedigree. I RECOMMEND PARTICIPATION! 23
24 Search of the SMFG Database 24
25 SMFG Pedigree of Participant 25
26 Partial Screen Shot of Pedigree 26
27 YHRD DNA Y-Chromosome Databases European Forensic 42,000+ results - 11 markers - number of matches only Ysearch FTDNA supported 30,000+ results markers, surname & haplotypes RAO FTDNA users only 72,000+ results - 67 markers SMGF Sorensen Molecular database 25,000+ results markers surnames & haplotypes & pedigrees Relative Genetics Results - Surnames(?) & haplotypes Y-base DNA heritage supported 9, markers surnames & haplotypes 27
28 DNA Resource Information Y-Chromosome Tutorial (101) DNA Information Links Mumma Surname Project Results FTDNA Mumma Surname Project Results My Site 28
29 Book Resources Trace Your Roots with DNA (2004) by Megan Smoleynak Smolenyak & Ann Turner $10 DNA & Genealogy (2005) by Colleen Fitzpatrick & Andrew Yeiser $22 The Seven Daughters of Eve (2000) mtdna by Dr. Bryan Sykes $16 29
30 CODIS (FBI) COmbined DNA Indexing System 30
31
DNA Testing What you need to know first
DNA Testing What you need to know first This article is like the Cliff Notes version of several genetic genealogy classes. It is a basic general primer. The general areas include Project support DNA test
More informationHalley Family. Mystery? Mystery? Can you solve a. Can you help solve a
Can you solve a Can you help solve a Halley Halley Family Family Mystery? Mystery? Who was the great grandfather of John Bennett Halley? He lived in Maryland around 1797 and might have been born there.
More informationDNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016
DNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016 1 What we will cover How testing helps genealogy What is DNA? How do you select from the three testing companies?
More informationDNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding
DNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding by Dr. Ing. Robert L. Baber 2014 July 26 Rights reserved, see the copyright notice at http://gengen.rlbaber.de
More informationUsing Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM
Using Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.
More informationTRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter
TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter 1-1: DNA: WHERE DO I START? Definition Genetic genealogy is the application of genetics to traditional genealogy. Genetic genealogy uses genealogical
More informationDNA Opening Doors for Today s s Genealogist
DNA Opening Doors for Today s s Genealogist Presented to JGSI Sunday, March 30, 2008 Presented by Alvin Holtzman Genetic Genealogy Discussion Points What is DNA How can it help genealogists What to expect
More informationAutosomal-DNA. How does the nature of Jewish genealogy make autosomal DNA research more challenging?
Autosomal-DNA How does the nature of Jewish genealogy make autosomal DNA research more challenging? Using Family Finder results for genealogy is more challenging for individuals of Jewish ancestry because
More informationRecent Results from the Jackson Brigade DNA Project
Recent Results from the Jackson Brigade DNA Project Dr. Daniel C. Hyde Professor Emeritus of Computer Science Bucknell University Lewisburg, PA Presented at Jackson Brigade Reunion, Horner, WV on August
More informationDNA Basics. OLLI: Genealogy 101 October 1, ~ Monique E. Rivera ~
DNA Basics OLLI: Genealogy 101 October 1, 2018 ~ Monique E. Rivera ~ WHAT IS DNA? DNA (deoxyribonucleic acid) is found in every living cell everywhere. It is a long chemical chain that tells our cells
More informationAn Introduction. Your DNA. and Your Family Tree. (Mitochondrial DNA) Presentation by: 4/8/17 Page 1 of 10
An Introduction Your DNA and Your Family Tree (Mitochondrial DNA) Presentation by: FredCoffey@aol.com 4/8/17 Page 1 of 10 Coffey Surname, y-dna Project We're now ready to move on and look at the type of
More informationYour mtdna Full Sequence Results
Congratulations! You are one of the first to have your entire mitochondrial DNA (DNA) sequenced! Testing the full sequence has already become the standard practice used by researchers studying the DNA,
More informationGenetic Identity and
Genetic Identity and GACATGTAGCTCTTCACTTCACCCAGGTTGGGTTGTGTCAACAGGAAACATTGTAACATATCACTTGGATTAGCACCTAGG/TTAT/TTAT/TTA Community DTC Genetic Testing Workshop The National Academies' August 31 September 1,
More informationY-DNA Genetic Testing
Y-DNA Genetic Testing 50 2/24/14 Y-DNA Genetic Testing Y-DNA flows from fathers to sons intact SNPs define Y-DNA haplogroups Haplogroups (clans) migrated together Timeframe between mutations is 2,000 to
More informationMitochondrial DNA (mtdna) JGSGO June 5, 2018
Mitochondrial DNA (mtdna) JGSGO June 5, 2018 MtDNA - outline What is it? What do you do with it? How do you maximize its value? 2 3 mtdna a double-stranded, circular DNA that is stored in mitochondria
More informationMeek DNA Project Group B Ancestral Signature
Meek DNA Project Group B Ancestral Signature The purpose of this paper is to explore the method and logic used by the author in establishing the Y-DNA ancestral signature for The Meek DNA Project Group
More informationTHE BASICS OF DNA TESTING. By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library
THE BASICS OF DNA TESTING By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library TYPES OF TESTS Mitochondrial DNA (mtdna/mdna) Y-DNA Autosomal DNA (atdna/audna) MITOCHONDRIAL DNA Found
More informationPizza and Who do you think you are?
Pizza and Who do you think you are? an overview of one of the newest and possibly more helpful developments in researching genealogy and family history that of using DNA for research What is DNA? Part
More informationEller DNA Project. Status Report for Nashville EFA Conference----July 25, Tom Eller, DNA Project Administrator
Eller DNA Project Status Report for Nashville EFA Conference----July 25, 2009 Tom Eller, DNA Project Administrator Eller DNA Project This presentation used material from Family Tree DNA and from World
More informationThe Meek Family of Allegheny Co., PA Meek Group A Introduction
Meek Group A Introduction In the 1770's a significant number of families named Meek(s) lived in S. W. Pennsylvania and they can be identified in the records of Westmoreland, Allegheny and Washington Counties.
More information! FTDNA! Ancestry. ! 23andMe. ! Medical Considera,ons. ! Iden,fying family medical history. ! Communica,ng with the medical community
by JEFF CARPENTER! Brief Defini,ons about YDNA, XDNA, mtdna, atdna (Covered in Part 1)! Benefits of Tes,ng DNA! Examples of DNA TESTING! FTDNA! Ancestry! 3andMe Jeff Carpenter, 016 jeffcarpenter1939@gmal.com!
More informationEvery human cell (except red blood cells and sperm and eggs) has an. identical set of 23 pairs of chromosomes which carry all the hereditary
Introduction to Genetic Genealogy Every human cell (except red blood cells and sperm and eggs) has an identical set of 23 pairs of chromosomes which carry all the hereditary information that is passed
More informationUsing Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM
Using Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.
More informationFamily Tree DNA Genetic Genealogy Started Here
Family Tree DNA Genetic Genealogy Started Here With 253,000 samples in our DNA database (the largest of its kind in the world) your genealogical search could become even easier Why Bennett Greenspan founded
More informationDNA and Ancestry. An Update on New Tests. Steve Louis. Jewish Genealogical Society of Washington State. January 13, 2014
DNA and Ancestry An Update on New Tests Steve Louis Jewish Genealogical Society of Washington State January 13, 2014 DISCLAIMER This document was prepared as a result of independent work and opinions of
More informationThe Meek Family of Allegheny Co., PA Meek Group A Introduction
Meek Group A Introduction In the 1770's a significant number of families named Meek(s) lived in S. W. Pennsylvania and they can be identified in the records of Westmoreland, Allegheny and Washington Counties.
More informationAn Introduction to Genetic Genealogy
An Introduction to Genetic Genealogy David A. Pike dapike@math.mun.ca Presented To: Family History Society of Newfoundland and Labrador 24 January 2006 Slide 1 of 21 Overview Genetic Genealogy using genetic
More informationUsing X-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM
Using X-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.
More informationGEDmatch Home Page The upper left corner of your home page has Information about you and links to lots of helpful information. Check them out!
USING GEDMATCH Created March 2015 GEDmatch is a free, non-profit site that accepts raw autosomal data files from Ancestry, FTDNA, and 23andme. As such, it provides a large autosomal database that spans
More informationThe DNA Signature of the Dál gcais
The DNA Signature of the Dál gcais We are merely the present-day custodians of our Ancestor s genes. 1 Dennis Wright 2014 My Paper Genealogy Researching for 40 years 2 My Paper Genealogy Researching for
More informationDAR POLICY STATEMENT AND BACKGROUND Using DNA Evidence for DAR Applications
Effective January 1, 2014, DAR will begin accepting Y-DNA evidence in support of new member applications and supplemental applications as one element in a structured analysis. This analysis will use a
More informationEwing Surname Y-DNA Project Article 8
Ewing Surname Y-DNA Project Article 8 This is the eighth in a series of articles about the Ewing Surname Y-DNA Project. The previous seven articles have appeared in the last seven issues of the Journal
More informationReport on the VAN_TUYL Surname Project Y-STR Results 3/11/2013 Rory Van Tuyl
Report on the VAN_TUYL Surname Project Y-STR Results 3/11/2013 Rory Van Tuyl Abstract: Recent data for two descendants of Ott van Tuyl has been added to the project, bringing the total number of Gameren
More informationErnie Ebayley s Adventure in DNA-Land. A Resource for Beginning Your Own Adventure into Genealogical Genetics
Ernie Ebayley s Adventure in DNA-Land A Resource for Beginning Your Own Adventure into Genealogical Genetics 2006 C.E. Smith Museum of Anthropology College of Arts, Letters, and Social Sciences (CLASS)
More informationUsing Mitochondrial DNA (mtdna) for Genealogy Debbie Parker Wayne, CG, CGL SM
Using Mitochondrial DNA (mtdna) for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical
More informationKenneth Nordtvedt. Many genetic genealogists eventually employ a time-tomost-recent-common-ancestor
Kenneth Nordtvedt Many genetic genealogists eventually employ a time-tomost-recent-common-ancestor (TMRCA) tool to estimate how far back in time the common ancestor existed for two Y-STR haplotypes obtained
More informationThe Structure of DNA Let s take a closer look at how this looks under a microscope.
DNA Basics Adapted from a MyHeritage Blog and the International Society of Genetic Genealogy (ISOGG) Wiki by Earl Cory MyHeritage has started a series to explain DNA, how it works and answer the most common
More informationDNA Haplogroups Report
DNA Haplogroups Report for Matthew Mayberry Generated and printed on Sep 25 2011, 01:59 pm X This is a mtdna Haplogroup Report This is a mtdna Subclade Report Search criteria used in this report: HVR-1
More informationMeek/Meeks Families of Virginia Meek Group F Introduction
Meek Group F Introduction The Meek/Meeks DNA Project 1 has established Y-DNA signatures 2 for a significant number of early American ancestors based on tests of living descendants. This allows for a determination
More informationPrimer on Human Pedigree Analysis:
Primer on Human Pedigree Analysis: Criteria for the selection and collection of appropriate Family Reference Samples John V. Planz. Ph.D. UNT Center for Human Identification Successful Missing Person ID
More informationYour Family 101 Beginning Genealogical Research
Your Family 101 Beginning Genealogical Research What Will We Cover Today? Session 1: Getting Started Session 2: Your Resources Session 3: Common Mistakes and Pitfalls Session 4: DNA Testing and Medical
More informationIN THIS ISSUE: February From the Administrator Questions/News...1. George Varner of Missouri Direct Line...2
IN THIS ISSUE: From the Administrator..... 1 Questions/News.......1 George Varner of Missouri Direct Line...2 Do the Newtons & Varners Really Both have Riggs DNA?...2 2016 Newton/Varner Reunion. 5 February
More informationAn O-F3288 Y DNA Discovery for Patrilineal Descendants of James Revell (Accomack) By Marie A. Rundquist, DNA Project Administrator November 2018
Project Scope Rundquist O-F3288 White Paper 11/2018 An O-F3288 Y DNA Discovery for Patrilineal Descendants of James Revell (Accomack) By Marie A. Rundquist, DNA Project Administrator November 2018 The
More information[CLIENT] SmithDNA1701 DE January 2017
[CLIENT] SmithDNA1701 DE1704205 11 January 2017 DNA Discovery Plan GOAL Create a research plan to determine how the client s DNA results relate to his family tree as currently constructed. The client s
More informationFREQUENTLY ASKED QUESTIONS ABOUT THE OWSTON/OUSTON DNA PROJECT
FREQUENTLY ASKED QUESTIONS ABOUT THE OWSTON/OUSTON DNA PROJECT 1. What has been discovered thus far and what may be discovered with testing? The Owston/Ouston DNA project grew out of the combined genealogical
More informationGenealogical Research
DNA, Ancestry, and Your Genealogical Research Walter Steets Houston Genealogical Forum DNA Interest Group March 2, 2019 1 Today s Agenda Brief review of basic genetics and terms used in genetic genealogy
More informationGetting the Most Out of Your DNA Matches
Helen V. Smith PG Dip Public Health, BMedLabSci, ADCLT, Dip. Fam. Hist. PLCGS 46 Kraft Road, Pallara, Qld, 4110 Email: HVSresearch@DragonGenealogy.com Website: www.dragongenealogy.com Blog: http://www.dragongenealogy.com/blog/
More informationThe Jewish Genealogical Society of Great Britain
Edition No. 1-04/2007 (currently under revision) Reformatted and reissued 01/2010 Written by Jill L. Whitehead, M.A. Issued for JGSGB by JGSGB Education & Mentoring JGSGB 33 Seymour Place London W1H 5AP
More informationDNA Solu)ons for Brick Walls And Adop)on
DNA Solu)ons for Brick Walls And Adop)on "I have not failed. I've just found ten thousand ways that won't work." Thomas Edison Wise Woman Gene+c Genealogy Comments Listen Carefully! 1. DNA is not the be
More informationGrowing the Family Tree: The Power of DNA in Reconstructing Family Relationships
Growing the Family Tree: The Power of DNA in Reconstructing Family Relationships Luke A. D. Hutchison Natalie M. Myres Scott R. Woodward Sorenson Molecular Genealogy Foundation (www.smgf.org) 2511 South
More informationHow to Use DNA in Your Genealogical Research
How to Use DNA in Your Genealogical Research William Remus Emeritus Professor of Information Technology Management University of Hawaii Honolulu, HI 96822 Email: Remus@hawaii.edu www.remus.shidler.hawaii.edu/
More informationDNA TESTING. This is the testing regime for FamilyTreeDNA. Other SNP tests were ordered from Yseq.
DNA & GENEALOGY DNA TESTING This is the testing regime for FamilyTreeDNA. Other SNP tests were ordered from Yseq. Product Date Batch Family Finder 30-May-14 Completed 569 05-Aug-14 Batched 569 05-Jul-14
More informationWelcome to this issue of Facts & Genes, the only publication devoted to Genetic Genealogy.
Facts & Genes from Family Tree DNA ================================== March 3, 2004 Volume 3, Issue 2 In This Issue ============= Editor's Corner In the News: Family Tree DNA Announcements Haplogroups:
More informationAutosomal DNA. What is autosomal DNA? X-DNA
ANGIE BUSH AND PAUL WOODBURY info@thednadetectives.com November 1, 2014 Autosomal DNA What is autosomal DNA? Autosomal DNA consists of all nuclear DNA except for the X and Y sex chromosomes. There are
More informationYoder Doors Opened by DNA Studies
Yoder Doors Opened by DNA Studies A Special Report to the 2012 North Carolina Yoder Reunion By Chris Yoder Yoder Newsletter Oct. 2012 www.yodernewsletter.org Established 1983 BACKGROUND How DNA Testing
More informationThe DNA Case for Bethuel Riggs
The DNA Case for Bethuel Riggs The following was originally intended as an appendix to Alvy Ray Smith, Edwardian Riggses of America I: Elder Bethuel Riggs (1757 1835) of Morris County, New Jersey, and
More informationGenetic Genealogy Journey DNA Projects by Debbie Parker Wayne, CG SM, CGL SM
Genetic Genealogy Journey DNA Projects by Debbie Parker Wayne, CG SM, CGL SM Genealogy can be a solitary pursuit. Genealogists sometimes collaborate to work on common lines, but lone researchers can perform
More informationGenesis and Genetics Matthew Price
Genesis and Genetics Matthew Price Apologetics and Creation Camp 16 June 2018 Karakariki Christian Camp, Waikato, NZ 1 What is Science? 2 What is Science? Hypothesis Theory Start with a hypothesis; a reasonable
More informationBig Y-700 White Paper
Big Y-700 White Paper Powering discovery in the field of paternal ancestry Authors: Caleb Davis, Michael Sager, Göran Runfeldt, Elliott Greenspan, Arjan Bormans, Bennett Greenspan, and Connie Bormans Last
More informationOrigins: Coffey/Keogh Families By Fred Coffey. ONLINE:
Origins: Coffey/Keogh Families By Fred Coffey ONLINE: http://www.coffey.ws/familytree/dna/origins-coffeykeoghfamilies.pdf My name is Coffey, and I m very interested in working out the origins of my family.
More informationWalter Steets Houston Genealogical Forum DNA Interest Group April 7, 2018
Ancestry DNA and GEDmatch Walter Steets Houston Genealogical Forum DNA Interest Group April 7, 2018 Today s agenda Recent News about DNA Testing DNA Cautions: DNA Data Used for Forensic Purposes New Technology:
More informationMEET YOUR VOLUNTEER PRATER PROJECT ADMINISTRATORS
Prater* Project NEWSLETTER i Vol I, No 1 Click on graphic above to view the latest Prater Project Results Tables using the drop-down menus MEET YOUR VOLUNTEER PRATER PROJECT ADMINISTRATORS Laverne Piatt
More informationGenetic Genealogy. Rules and Tools. Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter
Genetic Genealogy Rules and Tools Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter I am NOT this guy! 2 Genealogy s Newest Tool Genealogy research: Study of Family History Identifies
More informationDNA Testing. February 16, 2018
DNA Testing February 16, 2018 What Is DNA? Double helix ladder structure where the rungs are molecules called nucleotides or bases. DNA contains only four of these nucleotides A, G, C, T The sequence that
More informationChart 2 Group A, 37-Marker Level Entire R1b-M222 Group Generations to Include MRCA at 99% Probability
Chart 2 Group A, 37-Marker Level Entire R1b-M222 Group Generations to Include MRCA at 99% Probability 18 Irish R1b-M222 Section Overview The members of this group demonstrate a wide web of linkage over
More informationHow a DNA Project has produced discoveries in the Meates One- Name Study not possible with paper records alone
How a DNA Project has produced discoveries in the Meates One- Name Study not possible with paper records alone By Susan C. Meates ORE AND more one-namers are fascinated by the new genealogy of DNA testing
More informationSubgroup A2: Reilly-McGovern Cluster
Subgroup A2: Reilly-McGovern Cluster Charts 15 & 16 below shows the names and origins for the members of this cluster, except for the Faughnans, who are placed with the A2 Various Lineages for economy
More informationFind JCD Project Date: Identification-DNA Process Updated:
New Look Investigations Created by: Jack Friess Find JCD Project Date: 04-20-2018 Identification-DNA Process Updated: 05-24-2018 Questions and Answers Identification-DNA (ID-DNA) is a scientific process
More informationContributed by "Kathy Hallett"
National Geographic: The Genographic Project Name Background The National Geographic Society is undertaking the ambitious process of tracking human migration using genetic technology. By using the latest
More informationFirst Results: Intro to FamilyTreeDNA s Family Finder. Learn what to do with results of autosomal DNA testing with FamilyTreeDNA (FTDNA).
First Results: Family Tree DNA When You First Get Your FamilyTreeDNA (FTDNA) Results Objective: Learn what to do with results of autosomal DNA testing with FamilyTreeDNA (FTDNA). Tools: familytreedna.com
More informationUsing a Y-DNA Surname Project to Dig Deeper Into Your Genealogy: A Case Study
Using a Y-DNA Surname Project to Dig Deeper Into Your Genealogy: A Case Study Allan H. Westreich, Ph.D. Address for correspondence: Allan H. Westreich, Ph.D., 250 Route 28, Suite 206, Bridgewater, NJ 08807,
More informationNew Advances Reconstructing the Y Chromosome Haplotype of Napoléon the First Based on Three of his Living Descendants
Journal of Molecular Biology Research; Vol. 5, No. 1; 20 ISSN 125-430X E-ISSN 125-4318 Published by Canadian Center of Science and Education New Advances Reconstructing the Y Chromosome Haplotype of Napoléon
More informationPutting the genes into genealogy
Putting the genes into genealogy DNA testing can help find lost branches of your family tree. Susan C Meates describes how DNA surname projects work DNA testing for genealogy has been available since 2000,
More informationWalter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018
DNA, Ancestry, and Your Genealogical Research- Segments and centimorgans Walter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018 1 Today s agenda Brief review of previous DIG session
More informationA Day Out With Your DNA
A Day Out With Your DNA Diahan Southard www.yourdnaguide.com Your testing company has evaluated around 800,000 locations on your DNA to help them determine your origins and your genetic cousins. While
More informationGenetic Genealogy Resources
Genetic Genealogy Resources ISOGG International Society of Genetic Genealogists ISOGG was formed in 2003 by a group of surname administrators after the first International DNA Conference in Houston. Membership
More informationDNA: UNLOCKING THE CODE
DNA: UNLOCKING THE CODE Connecting Cousins for Genetic Genealogy Bryant McAllister, PhD Associate Professor of Biology University of Iowa bryant-mcallister@uiowa.edu Iowa Genealogical Society April 9,
More informationWINSLOW HERITAGE SOCIETY ~~~~~~~~~~~~~~~~~~
Newsletter, Vol. 2, No. 1 March, 2015 WINSLOW HERITAGE SOCIETY ~~~~~~~~~~~~~~~~~~ In Vol. 1, No. 1 of the Winslow Heritage Society Newsletter, Kathy Myers, Society Governor, a descendant of Kenelm Winslow,
More informationAPPLICATION FOR ENROLLMENT
CTGR-9615 Grand Ronde Rd.; Grand Ronde OR 97347 1-800-422-0232 ext.2253 APPLICATION FOR ENROLLMENT Name: First Middle Last Maiden Gender Female. Male Date of Birth Social security Number Address: Mailing
More informationFinding a Male Hodge(s) Descendant for Y-Chromosome DNA Testing. Prepared by Jan Alpert
Finding a Male Hodge(s) Descendant for Y-Chromosome DNA Testing Prepared by Jan Alpert Why Test Male Y-Chromosome DNA All males carry the Y-Chromosome of their fathers As a result the same DNA markers
More informationComputer - aided Genealogy. Rob Drew
Computer - aided Genealogy Rob Drew Topics Building your family tree Off-line tools for your laptop or desktop at home. What s a gedcom file? Building an on-line tree. Research websites Where to get help
More informationTracking Your Roots With DNA
Tracking Your Roots With DNA Genetic Genealogy Lisa R Franklin RN,BSN 31 Oct 2013/27 Jun 2014 Andalusia, Alabama Why DNA test? Determine if two people are related Determine if two people descend from the
More informationDNA for Genealogy Librarians. Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District
DNA for Genealogy Librarians Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District What does DNA do? It replicates itself. It codes for the production
More informationCAGGNI s DNA Special Interest Group
CAGGNI s DNA Special Interest Group 10 Jan 2015 Al & Michelle Wilson Agenda Survey Basics in Fan Charts Recombination Exercise Triangulation Overview Survey 1. Have you taken (or sponsored) a DNA test?
More informationChromosome X haplotyping in deficiency paternity testing principles and case report
International Congress Series 1239 (2003) 815 820 Chromosome X haplotyping in deficiency paternity testing principles and case report R. Szibor a, *, I. Plate a, J. Edelmann b, S. Hering c, E. Kuhlisch
More informationGenetic Genealogy. Using DNA to research your maternal & paternal lines. Ed McGuire. Vermont Genealogy Library 2/24/14
Genetic Genealogy Using DNA to research your maternal & paternal lines Ed McGuire 2/24/14 Introduction Soprano Family Tree 2 2/24/14 Introduction 3 2/24/14 Introduction 4 2/24/14 Introduction Contradictory
More informationSteve Harding, *Turi King and *Mark Jobling Universities of Nottingham & *Leicester, UK
Viking DNA Steve Harding, *Turi King and *Mark Jobling Universities of Nottingham & *Leicester, UK Viking DNA in Northern England Project Part 1 - Wirral and West Lancashire (2002-2007) Part 2 - North
More informationUsing Pedigrees to interpret Mode of Inheritance
Using Pedigrees to interpret Mode of Inheritance Objectives Use a pedigree to interpret the mode of inheritance the given trait is with 90% accuracy. 11.2 Pedigrees (It s in your genes) Pedigree Charts
More informationThe FERGUS(S)ON DNA project was organized in August of Currently there are about 450 participants whose y-chromosome has been analyzed.
FERGUS(S)ON DNA Project by Colin R. Ferguson, PhD (First Published in The Bee Line, Clan Fergusson Society of North America, Issue No. 94, Spring 2006 and perpetually revised since then) The FERGUS(S)ON
More informationDeveloping Conclusions About Different Modes of Inheritance
Pedigree Analysis Introduction A pedigree is a diagram of family relationships that uses symbols to represent people and lines to represent genetic relationships. These diagrams make it easier to visualize
More informationcompany does improve its ethnicity estimates, your profile will automatically be updated, too. You won't have to retake the test to get the new
Ancestry dna kit The Y-DNA test is more limited than the ones from Family Tree DNA Does not offer a less expensive 'autosomal DNA-only' test Can't connect with other matches Can't upload raw data from
More informationIdentification of the Hypothesized African Ancestry of the Wife of Pvt. Henry Windecker Using Genomic Testing of the Autosomes.
Identification of the Hypothesized African Ancestry of the Wife of Pvt. Henry Windecker Using Genomic Testing of the Autosomes Introduction African Ancestry: The hypothesis, based on considerable circumstantial
More informationICMP DNA REPORTS GUIDE
ICMP DNA REPORTS GUIDE Distribution: General Sarajevo, 16 th December 2010 GUIDE TO ICMP DNA REPORTS 1. Purpose of This Document 1. The International Commission on Missing Persons (ICMP) endeavors to secure
More informationTools: 23andMe.com website and test results; DNAAdoption handouts.
When You First Get Your 23andMe Results Objective: Learn what to do with results of atdna testing with 23andMe. Tools: 23andMe.com website and test results; DNAAdoption handouts. Exercises: Practice Exercises
More informationWhen I started my genealogy
Beyond the paper records When I started my genealogy research a few years after my father died in 1989, the only information I had on my paternal grandfather was his name, Richard Frederick Meates, and
More informationDNa. FOr Family HisTOriaNs THE COMPLETE GUIDE TO
THE COMPLETE GUIDE TO DNa FOr Family HisTOriaNs Gene testing can provide a useful supplement to genealogical records or family history legends in researching our ancestry, in both the near and distant
More informationBefore India: Exploring Your Ancestry With DNA By David G. Mahal
Before India: Exploring Your Ancestry With DNA By David G. Mahal You then receive an email notifying you that your results are ready to explore on utilize your DNA results for family history by Ancestry.com
More informationLecture 1: Introduction to pedigree analysis
Lecture 1: Introduction to pedigree analysis Magnus Dehli Vigeland NORBIS course, 8 th 12 th of January 2018, Oslo Outline Part I: Brief introductions Pedigrees symbols and terminology Some common relationships
More informationLarge scale kinship:familial Searching and DVI. Seoul, ISFG workshop
Large scale kinship:familial Searching and DVI Seoul, ISFG workshop 29 August 2017 Large scale kinship Familial Searching: search for a relative of an unidentified offender whose profile is available in
More informationThe Kaighins of Scaresdale, Kirk German, Isle of Man
The Kaighins of Scaresdale, Kirk German, Isle of Man Greg Kaighin May 16, 2015 Background After twelve years of research, the parents of John Kaighin (Family 7600) 1 of Kirk German, Isle of Man have finally
More information