CAGGNI s DNA Special Interest Group

Size: px
Start display at page:

Download "CAGGNI s DNA Special Interest Group"

Transcription

1 CAGGNI s DNA Special Interest Group 10 Jan 2015 Al & Michelle Wilson Agenda Survey Basics in Fan Charts Recombination Exercise Triangulation Overview

2 Survey 1. Have you taken (or sponsored) a DNA test? 2. What kind of test? A. Y-DNA B. Mitochondrial DNA C. Autosomal DNA ( Family Finder, Cousin Finder, Ancestry.com since 2010) 3. What Testing Service? A. Family Tree DNA B. Ancestry.com C. 23andMe D. Genographic Project E. Other 4. Why did you take the DNA test? 5. Have you contacted any of your DNA matches? 6. Have you attempted any triangulation, 3 rd party tools, chromosome mapping, reconstruction of ancestral DNA, or management of a surname project? 7. What can I do with my results?

3 You and Your Ancestors you male female

4 Mitochondrial DNA mtdna Inheritance 16,569 bp

5 Y Chromosome DNA ydna Inheritance 58,000,000 bp 12 marker test, 37 marker test 67, 111, big Y

6 (Ideal) Autosomal DNA atdna or audna Inheritance 6,400,000,000 bps, test looks at 700,000 locations

7 Typical Autosomal DNA atdna or audna Inheritance

8 Ideal vs. Actual Autosomal DNA atdna or audna Inheritance Source - gcbias.org The Coop Lab

9 Pop Beads Nucleus Exercise!

10 Nuclear DNA & Autosomal Testing Nucleus Autosomal Chromosomes Pairs 1-22 A-T rich segments show up dark when Giemsa is applied. Sex Chromosomes 10

11 X Chromosome xdna Inheritance in a Male (1, 1 of 2, 2 of 4, 3 of 8, 5 of 16, 8 of 32, 13 of 64, 21 of 128.)

12 X Chromosome xdna Inheritance in a Female (1, 2 of 2, 3 of 4, 5 of 8, 8 of 16, 13 of 32, 21 of 64, 34 of 128.)

13 Comparing Y-DNA Results: Surname Projects

14 Finding Cousins with at-dna A Second Cousin Match has been found between you and Kathryn H Compare pedigrees use surname lists in their absence Dad 2 nd cousins should share a set of common Gr-Grandparents Kathryn 14

15 More Examples Viewer set to show segments of 5+ cm Length of match is measured in centimorgans (cm) 1 st cousins 2nd cousins 3rd cousins Person comparing to five 2 nd cousins who are siblings 15

16 Your mileage may vary! Centimorgan cm or Map Unit: The distance between chromosome positions for which the expected average crossovers in one generation is 1% Convert cm to % shared: add all shared segments over 5 and divide by % Theoretical % Actual, typ. Shared cm, Theo. Relationship Parent Sibling Grandparent, aunt or uncle, half-sibling, double first cousin Great-grandparent, first cousin, great-uncle/aunt, half-aunt/uncle, half-nephew/niece First cousin once removed, half first cousin Second cousin, first cousin twice removed Second cousin once removed, half second cousin Third cousin, second cousin twice removed Third cousin once removed Fourth cousin Fourth cousin once removed Fifth cousin Fifth cousin once removed 16

17 Autosomal Family Finder Tests Examines ~700,000 SNPs on the 22 autosomal chromosomes known to vary Persons with lots of identical adjacent SNP locations are likely relations Paper trails are needed to determine the specific relation start with best matches Long shared segments indicate common ancestors Finds matches within about 7 generations beyond the 5x gr-grandparent it is just identifying deep ancestry (same population) Results include Ethnic Percentages Relationship Actual cm segment % IBD % IBS Source: John Walden Suggested 1st 2nd 3rd 4th 5th 6th 7th 8th 1 st cousin 97% 3% 2 nd 5% 90% 5% 3 rd 10% 70% 30% 10% 5% 4 th 5% 10% 40% 30% 10% 5% 5th 5% 10% 30% 20% 10% 5% Source: Maurice Gleeson 17 17

18 Third Party Tools: DNAGedcom Autosomal DNA Segment Analyzer (ASDA)

19 Third Party Tools: GedMatch 1 to many tool

20 Third Party Tools: GedMatch 1 to 1 tool

21 Company Comparison Summary DNA Test Family Tree DNA Ancestry DNA 23andMe Y-DNA Offered Big-Y Surname Groups *** Mt-DNA Offered Full Sequence *** At-DNA Offered Chrom. Browser Family Trees Database size ** good huge * ** huge * You see your matches in the Chromosome Browser only if they invite you in. ** Gedcom upload only. Not fully featured. *** mt-dna and Y-DNA haplogroups reported with the At-DNA test

22 Testing Companies and 3 rd Party Tools Ancestry DNA: FT DNA: 23andMe: ISOGG: DNAGedCom: DNAGedMatch:

23 Blogs & Sites Michelle has found useful Kitty Cooper Kitty Cooper s Blog CeCe Moore Your Genetic Genealogist Blaine Bettinger The Genetic Genealogist Roberta Estes DNA Explained Graham Coop Coop Labs (UC Davis) Dieneke s Anthropology Blog And of course The ISOGG Wiki And Wikipedia!

Autosomal DNA. What is autosomal DNA? X-DNA

Autosomal DNA. What is autosomal DNA? X-DNA ANGIE BUSH AND PAUL WOODBURY info@thednadetectives.com November 1, 2014 Autosomal DNA What is autosomal DNA? Autosomal DNA consists of all nuclear DNA except for the X and Y sex chromosomes. There are

More information

Walter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018

Walter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018 DNA, Ancestry, and Your Genealogical Research- Segments and centimorgans Walter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018 1 Today s agenda Brief review of previous DIG session

More information

Genetic Genealogy. Rules and Tools. Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter

Genetic Genealogy. Rules and Tools. Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter Genetic Genealogy Rules and Tools Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter I am NOT this guy! 2 Genealogy s Newest Tool Genealogy research: Study of Family History Identifies

More information

Using Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM

Using Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM Using Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.

More information

DNA for Genealogy Librarians. Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District

DNA for Genealogy Librarians. Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District DNA for Genealogy Librarians Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District What does DNA do? It replicates itself. It codes for the production

More information

Introduction to Autosomal DNA Tools

Introduction to Autosomal DNA Tools GENETIC GENEALOGY JOURNEY Debbie Parker Wayne, CG, CGL Introduction to Autosomal DNA Tools Just as in the old joke about a new genealogist walking into the library and asking for the book that covers my

More information

Using X-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM

Using X-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM Using X-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.

More information

Genealogical Research

Genealogical Research DNA, Ancestry, and Your Genealogical Research Walter Steets Houston Genealogical Forum DNA Interest Group March 2, 2019 1 Today s Agenda Brief review of basic genetics and terms used in genetic genealogy

More information

Walter Steets Houston Genealogical Forum DNA Interest Group April 7, 2018

Walter Steets Houston Genealogical Forum DNA Interest Group April 7, 2018 Ancestry DNA and GEDmatch Walter Steets Houston Genealogical Forum DNA Interest Group April 7, 2018 Today s agenda Recent News about DNA Testing DNA Cautions: DNA Data Used for Forensic Purposes New Technology:

More information

THE BASICS OF DNA TESTING. By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library

THE BASICS OF DNA TESTING. By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library THE BASICS OF DNA TESTING By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library TYPES OF TESTS Mitochondrial DNA (mtdna/mdna) Y-DNA Autosomal DNA (atdna/audna) MITOCHONDRIAL DNA Found

More information

Pizza and Who do you think you are?

Pizza and Who do you think you are? Pizza and Who do you think you are? an overview of one of the newest and possibly more helpful developments in researching genealogy and family history that of using DNA for research What is DNA? Part

More information

TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter

TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter 1-1: DNA: WHERE DO I START? Definition Genetic genealogy is the application of genetics to traditional genealogy. Genetic genealogy uses genealogical

More information

Getting the Most Out of Your DNA Matches

Getting the Most Out of Your DNA Matches Helen V. Smith PG Dip Public Health, BMedLabSci, ADCLT, Dip. Fam. Hist. PLCGS 46 Kraft Road, Pallara, Qld, 4110 Email: HVSresearch@DragonGenealogy.com Website: www.dragongenealogy.com Blog: http://www.dragongenealogy.com/blog/

More information

Genetic Genealogy Journey DNA Projects by Debbie Parker Wayne, CG SM, CGL SM

Genetic Genealogy Journey DNA Projects by Debbie Parker Wayne, CG SM, CGL SM Genetic Genealogy Journey DNA Projects by Debbie Parker Wayne, CG SM, CGL SM Genealogy can be a solitary pursuit. Genealogists sometimes collaborate to work on common lines, but lone researchers can perform

More information

DNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016

DNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016 DNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016 1 What we will cover How testing helps genealogy What is DNA? How do you select from the three testing companies?

More information

[CLIENT] SmithDNA1701 DE January 2017

[CLIENT] SmithDNA1701 DE January 2017 [CLIENT] SmithDNA1701 DE1704205 11 January 2017 DNA Discovery Plan GOAL Create a research plan to determine how the client s DNA results relate to his family tree as currently constructed. The client s

More information

Walter Steets Houston Genealogical Forum DNA Interest Group February 24, 2018

Walter Steets Houston Genealogical Forum DNA Interest Group February 24, 2018 Using Ancestry DNA and Third-Party Tools to Research Your Shared DNA Segments Part 2 Walter Steets Houston Genealogical Forum DNA Interest Group February 24, 2018 1 Today s agenda Brief review of previous

More information

! FTDNA! Ancestry. ! 23andMe. ! Medical Considera,ons. ! Iden,fying family medical history. ! Communica,ng with the medical community

! FTDNA! Ancestry. ! 23andMe. ! Medical Considera,ons. ! Iden,fying family medical history. ! Communica,ng with the medical community by JEFF CARPENTER! Brief Defini,ons about YDNA, XDNA, mtdna, atdna (Covered in Part 1)! Benefits of Tes,ng DNA! Examples of DNA TESTING! FTDNA! Ancestry! 3andMe Jeff Carpenter, 016 jeffcarpenter1939@gmal.com!

More information

Understanding Third Party DNA Analysis Tools. Copyright 2014 James R. Lannin, Jr. aka Jimmy Chromosomes

Understanding Third Party DNA Analysis Tools. Copyright 2014 James R. Lannin, Jr. aka Jimmy Chromosomes Understanding Third Party DNA Analysis Tools Copyright 2014 James R. Lannin, Jr. aka Jimmy Chromosomes A Review of the Basics You have 46 chromosomes and they come to you in 23 pairs from your mother and

More information

DNA Testing What you need to know first

DNA Testing What you need to know first DNA Testing What you need to know first This article is like the Cliff Notes version of several genetic genealogy classes. It is a basic general primer. The general areas include Project support DNA test

More information

Mitochondrial DNA (mtdna) JGSGO June 5, 2018

Mitochondrial DNA (mtdna) JGSGO June 5, 2018 Mitochondrial DNA (mtdna) JGSGO June 5, 2018 MtDNA - outline What is it? What do you do with it? How do you maximize its value? 2 3 mtdna a double-stranded, circular DNA that is stored in mitochondria

More information

The Structure of DNA Let s take a closer look at how this looks under a microscope.

The Structure of DNA Let s take a closer look at how this looks under a microscope. DNA Basics Adapted from a MyHeritage Blog and the International Society of Genetic Genealogy (ISOGG) Wiki by Earl Cory MyHeritage has started a series to explain DNA, how it works and answer the most common

More information

A Day Out With Your DNA

A Day Out With Your DNA A Day Out With Your DNA Diahan Southard www.yourdnaguide.com Your testing company has evaluated around 800,000 locations on your DNA to help them determine your origins and your genetic cousins. While

More information

DNA Basics. OLLI: Genealogy 101 October 1, ~ Monique E. Rivera ~

DNA Basics. OLLI: Genealogy 101 October 1, ~ Monique E. Rivera ~ DNA Basics OLLI: Genealogy 101 October 1, 2018 ~ Monique E. Rivera ~ WHAT IS DNA? DNA (deoxyribonucleic acid) is found in every living cell everywhere. It is a long chemical chain that tells our cells

More information

Approaching and Connecting with Your DNA Matches

Approaching and Connecting with Your DNA Matches Approaching and Connecting with Your DNA Matches Shannon Stewart Christmas, MCP throughthetreesblog@gmail.com Understand DNA Tests The four types of DNA and the relevant test companies Segment triangulation

More information

GEDmatch Home Page The upper left corner of your home page has Information about you and links to lots of helpful information. Check them out!

GEDmatch Home Page The upper left corner of your home page has Information about you and links to lots of helpful information. Check them out! USING GEDMATCH Created March 2015 GEDmatch is a free, non-profit site that accepts raw autosomal data files from Ancestry, FTDNA, and 23andme. As such, it provides a large autosomal database that spans

More information

DNA Testing. February 16, 2018

DNA Testing. February 16, 2018 DNA Testing February 16, 2018 What Is DNA? Double helix ladder structure where the rungs are molecules called nucleotides or bases. DNA contains only four of these nucleotides A, G, C, T The sequence that

More information

Tools: 23andMe.com website and test results; DNAAdoption handouts.

Tools: 23andMe.com website and test results; DNAAdoption handouts. When You First Get Your 23andMe Results Objective: Learn what to do with results of atdna testing with 23andMe. Tools: 23andMe.com website and test results; DNAAdoption handouts. Exercises: Practice Exercises

More information

DNA Solu)ons for Brick Walls And Adop)on

DNA Solu)ons for Brick Walls And Adop)on DNA Solu)ons for Brick Walls And Adop)on "I have not failed. I've just found ten thousand ways that won't work." Thomas Edison Wise Woman Gene+c Genealogy Comments Listen Carefully! 1. DNA is not the be

More information

First Results: Intro to FamilyTreeDNA s Family Finder. Learn what to do with results of autosomal DNA testing with FamilyTreeDNA (FTDNA).

First Results: Intro to FamilyTreeDNA s Family Finder. Learn what to do with results of autosomal DNA testing with FamilyTreeDNA (FTDNA). First Results: Family Tree DNA When You First Get Your FamilyTreeDNA (FTDNA) Results Objective: Learn what to do with results of autosomal DNA testing with FamilyTreeDNA (FTDNA). Tools: familytreedna.com

More information

Advanced Autosomal DNA Techniques used in Genetic Genealogy

Advanced Autosomal DNA Techniques used in Genetic Genealogy Advanced Autosomal DNA Techniques used in Genetic Genealogy Tim Janzen, MD E-mail: tjanzen@comcast.net Summary of Chromosome Mapping Technique The following are specific instructions on how to map your

More information

Robert Warthen

Robert Warthen Robert Warthen www.dnagedcom.com GENETIC GENEALOGY STANDARD NINE ISOGG PRIVATIZE OR REDACT THE NAMES OF LIVING GENETIC MATCHES FROM PRESENTATIONS UNLESS THE GENETIC MATCHES HAVE GIVEN THEIR PRIOR PERMISSION

More information

Genetic Genealogy Journey Why Is My Cousin Not on my DNA Match List? Debbie Parker Wayne, CG SM, CGL SM

Genetic Genealogy Journey Why Is My Cousin Not on my DNA Match List? Debbie Parker Wayne, CG SM, CGL SM Genetic Genealogy Journey Why Is My Cousin Not on my DNA Match List? Debbie Parker Wayne, CG SM, CGL SM The CSI television shows have conditioned us to expect exact DNA matches and lead us to think DNA

More information

GliesianDNA (BETA) atdna Relationships Predictions for cms with no influence factors

GliesianDNA (BETA) atdna Relationships Predictions for cms with no influence factors GliesianDNA (BETA) atdna Relationships Predictions for 562.3 cms with no influence factors Report generated on: 2018-07-07T13:08:31.511 by Gliesian, LLC's GliesianDNA (beta), version 0.4.1 Introduction

More information

Walter Steets Houston Genealogical Forum DNA Interest Group May 5, 2018

Walter Steets Houston Genealogical Forum DNA Interest Group May 5, 2018 GEDmatch: The Golden State Killer Tier 1 Tools Walter Steets Houston Genealogical Forum DNA Interest Group May 5, 2018 1 Today s agenda Walter s Take on DNA Developments Growth in Number of DNA Testers

More information

Recent Results from the Jackson Brigade DNA Project

Recent Results from the Jackson Brigade DNA Project Recent Results from the Jackson Brigade DNA Project Dr. Daniel C. Hyde Professor Emeritus of Computer Science Bucknell University Lewisburg, PA Presented at Jackson Brigade Reunion, Horner, WV on August

More information

Tracking Your Roots With DNA

Tracking Your Roots With DNA Tracking Your Roots With DNA Genetic Genealogy Lisa R Franklin RN,BSN 31 Oct 2013/27 Jun 2014 Andalusia, Alabama Why DNA test? Determine if two people are related Determine if two people descend from the

More information

DNA: UNLOCKING THE CODE

DNA: UNLOCKING THE CODE DNA: UNLOCKING THE CODE Connecting Cousins for Genetic Genealogy Bryant McAllister, PhD Associate Professor of Biology University of Iowa bryant-mcallister@uiowa.edu Iowa Genealogical Society April 9,

More information

Walter Steets Houston Genealogical Forum DNA Interest Group November 18, 2017

Walter Steets Houston Genealogical Forum DNA Interest Group November 18, 2017 DNA, Ancestry, and Your Genealogical Research Session 2 Walter Steets Houston Genealogical Forum DNA Interest Group November 18, 2017 1 Today s agenda Brief review of previous DIG session Degrees of Separation

More information

Using Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM

Using Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM Using Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.

More information

Getting the Most of Your DNA Test. Friends of Irish Research Richard Reid

Getting the Most of Your DNA Test. Friends of Irish Research Richard Reid Getting the Most of Your DNA Test Friends of Irish Research Richard Reid So You Have Been Tested! The results are back and now is time to explore and see if any of your brick walls can be broken down.

More information

Using Mitochondrial DNA (mtdna) for Genealogy Debbie Parker Wayne, CG, CGL SM

Using Mitochondrial DNA (mtdna) for Genealogy Debbie Parker Wayne, CG, CGL SM Using Mitochondrial DNA (mtdna) for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical

More information

Autosomal-DNA. How does the nature of Jewish genealogy make autosomal DNA research more challenging?

Autosomal-DNA. How does the nature of Jewish genealogy make autosomal DNA research more challenging? Autosomal-DNA How does the nature of Jewish genealogy make autosomal DNA research more challenging? Using Family Finder results for genealogy is more challenging for individuals of Jewish ancestry because

More information

Richard Weiss - Director / Exec VP

Richard Weiss - Director / Exec VP Richard Weiss - Director / Exec VP www.dnaadoption.com Welcome to DNAGEDCOM GENETIC GENEALOGY STANDARD NINE ISOGG PRIVATIZE OR REDACT THE NAMES OF LIVING GENETIC MATCHES FROM PRESENTATIONS UNLESS THE GENETIC

More information

DNA Opening Doors for Today s s Genealogist

DNA Opening Doors for Today s s Genealogist DNA Opening Doors for Today s s Genealogist Presented to JGSI Sunday, March 30, 2008 Presented by Alvin Holtzman Genetic Genealogy Discussion Points What is DNA How can it help genealogists What to expect

More information

DNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding

DNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding DNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding by Dr. Ing. Robert L. Baber 2014 July 26 Rights reserved, see the copyright notice at http://gengen.rlbaber.de

More information

Visual Phasing of Chromosome 1

Visual Phasing of Chromosome 1 Visual Phasing of Chromosome 1 If you have the possibility to test three full siblings, then the next great thing you could do with your DNA, is to try out the Visual Phasing technique developed by Kathy

More information

Your mtdna Full Sequence Results

Your mtdna Full Sequence Results Congratulations! You are one of the first to have your entire mitochondrial DNA (DNA) sequenced! Testing the full sequence has already become the standard practice used by researchers studying the DNA,

More information

Genetic Identity and

Genetic Identity and Genetic Identity and GACATGTAGCTCTTCACTTCACCCAGGTTGGGTTGTGTCAACAGGAAACATTGTAACATATCACTTGGATTAGCACCTAGG/TTAT/TTAT/TTA Community DTC Genetic Testing Workshop The National Academies' August 31 September 1,

More information

Your Family 101 Beginning Genealogical Research

Your Family 101 Beginning Genealogical Research Your Family 101 Beginning Genealogical Research What Will We Cover Today? Session 1: Getting Started Session 2: Your Resources Session 3: Common Mistakes and Pitfalls Session 4: DNA Testing and Medical

More information

Orangeburgh District DNA Project. Finding Family Connections with Autosomal DNA Testing

Orangeburgh District DNA Project. Finding Family Connections with Autosomal DNA Testing Orangeburgh District DNA Project Finding Family Connections with Autosomal DNA Testing Review some DNA basics Address privacy issues Evidence vs. Proof Look at some specific examples 3 Types of DNA Testing

More information

Learn what to do with results of autosomal DNA testing from AncestryDNA.

Learn what to do with results of autosomal DNA testing from AncestryDNA. When You First Get Your AncestryDNA Results Objective: Learn what to do with results of autosomal DNA testing from AncestryDNA. Tools: AncestryDNA results; ancestry.com, genesis.gedmatch.com and familytreedna.com

More information

DNA, A Genealogy Tool. The Search for an Expert Genealogist, Photos & Clues

DNA, A Genealogy Tool. The Search for an Expert Genealogist, Photos & Clues DNA, A Genealogy Tool The Search for an Expert Genealogist, Photos & Clues mydanishancestors.com *Slide Show shared in this class & more web-sites under Toolbar/DNA *One doesn t have to have Danish ancestors

More information

IN THIS ISSUE: February From the Administrator Questions/News...1. George Varner of Missouri Direct Line...2

IN THIS ISSUE: February From the Administrator Questions/News...1. George Varner of Missouri Direct Line...2 IN THIS ISSUE: From the Administrator..... 1 Questions/News.......1 George Varner of Missouri Direct Line...2 Do the Newtons & Varners Really Both have Riggs DNA?...2 2016 Newton/Varner Reunion. 5 February

More information

Find JCD Project Date: Identification-DNA Process Updated:

Find JCD Project Date: Identification-DNA Process Updated: New Look Investigations Created by: Jack Friess Find JCD Project Date: 04-20-2018 Identification-DNA Process Updated: 05-24-2018 Questions and Answers Identification-DNA (ID-DNA) is a scientific process

More information

Walter Steets Houston Genealogical Forum DNA Interest Group January 27, 2018

Walter Steets Houston Genealogical Forum DNA Interest Group January 27, 2018 Using Ancestry DNA and Third-Party Tools to Research Your Shared DNA Segments Walter Steets Houston Genealogical Forum DNA Interest Group January 27, 2018 1 Today s agenda Brief review of previous DIG

More information

Genealogy: DNA And The Family Tree By James Mayflower READ ONLINE

Genealogy: DNA And The Family Tree By James Mayflower READ ONLINE Genealogy: DNA And The Family Tree By James Mayflower READ ONLINE CeCe Moore's "DNA Testing for Genealogy - Getting Started" series is a Family Tree DNA is currently the only commercial laboratory offering

More information

Halley Family. Mystery? Mystery? Can you solve a. Can you help solve a

Halley Family. Mystery? Mystery? Can you solve a. Can you help solve a Can you solve a Can you help solve a Halley Halley Family Family Mystery? Mystery? Who was the great grandfather of John Bennett Halley? He lived in Maryland around 1797 and might have been born there.

More information

Primer on Human Pedigree Analysis:

Primer on Human Pedigree Analysis: Primer on Human Pedigree Analysis: Criteria for the selection and collection of appropriate Family Reference Samples John V. Planz. Ph.D. UNT Center for Human Identification Successful Missing Person ID

More information

Understanding DNA in Genealogy. Peter Biggins, BY3164 Darien Library, Darien, CT November 18, 2017

Understanding DNA in Genealogy. Peter Biggins, BY3164 Darien Library, Darien, CT November 18, 2017 Understanding DNA in Genealogy Peter Biggins, BY3164 Darien Library, Darien, CT November 18, 2017 1953: Watson 25, Crick 37, Franklin 33 My BY3164 SNP 1953 paper published on the structure of DNA 1962

More information

Learn what to do with results of autosomal DNA testing from AncestryDNA. Tools: AncestryDNA results; ancestry.com, gedmatch.com and familytreedna.

Learn what to do with results of autosomal DNA testing from AncestryDNA. Tools: AncestryDNA results; ancestry.com, gedmatch.com and familytreedna. First Look : AncestryDNA When You First Get Your AncestryDNA Results Objective: Learn what to do with results of autosomal DNA testing from AncestryDNA. Tools: AncestryDNA results; ancestry.com, gedmatch.com

More information

Y-DNA Genetic Testing

Y-DNA Genetic Testing Y-DNA Genetic Testing 50 2/24/14 Y-DNA Genetic Testing Y-DNA flows from fathers to sons intact SNPs define Y-DNA haplogroups Haplogroups (clans) migrated together Timeframe between mutations is 2,000 to

More information

DNAGedcom s GWorks Automation Utility using Ancestry.com Results

DNAGedcom s GWorks Automation Utility using Ancestry.com Results Developed by Debra Demeester, collaborating genealogist, based on Kitty Cooper's blog post of 26 Sept 2017. PART 1: PARTNER DNAGedcom AND ANCESTRY I. CREATE A PAID ACCOUNT AT DNAGEDCOM 1. Click on the

More information

Family Tree DNA Genetic Genealogy Started Here

Family Tree DNA Genetic Genealogy Started Here Family Tree DNA Genetic Genealogy Started Here With 253,000 samples in our DNA database (the largest of its kind in the world) your genealogical search could become even easier Why Bennett Greenspan founded

More information

DNA TESTING. This is the testing regime for FamilyTreeDNA. Other SNP tests were ordered from Yseq.

DNA TESTING. This is the testing regime for FamilyTreeDNA. Other SNP tests were ordered from Yseq. DNA & GENEALOGY DNA TESTING This is the testing regime for FamilyTreeDNA. Other SNP tests were ordered from Yseq. Product Date Batch Family Finder 30-May-14 Completed 569 05-Aug-14 Batched 569 05-Jul-14

More information

WINSLOW HERITAGE SOCIETY ~~~~~~~~~~~~~~~~~~

WINSLOW HERITAGE SOCIETY ~~~~~~~~~~~~~~~~~~ Newsletter, Vol. 2, No. 1 March, 2015 WINSLOW HERITAGE SOCIETY ~~~~~~~~~~~~~~~~~~ In Vol. 1, No. 1 of the Winslow Heritage Society Newsletter, Kathy Myers, Society Governor, a descendant of Kenelm Winslow,

More information

Computer - aided Genealogy. Rob Drew

Computer - aided Genealogy. Rob Drew Computer - aided Genealogy Rob Drew Topics Building your family tree Off-line tools for your laptop or desktop at home. What s a gedcom file? Building an on-line tree. Research websites Where to get help

More information

Use of DNA information in family research information for IOWFHS members

Use of DNA information in family research information for IOWFHS members Use of DNA information in family research information for IOWFHS members What is DNA? Since the discovery of deoxyribonucleic acid (DNA) in the 1950s, we have come to understand more about its role as

More information

Before India: Exploring Your Ancestry With DNA By David G. Mahal

Before India: Exploring Your Ancestry With DNA By David G. Mahal Before India: Exploring Your Ancestry With DNA By David G. Mahal You then receive an email notifying you that your results are ready to explore on utilize your DNA results for family history by Ancestry.com

More information

company does improve its ethnicity estimates, your profile will automatically be updated, too. You won't have to retake the test to get the new

company does improve its ethnicity estimates, your profile will automatically be updated, too. You won't have to retake the test to get the new Ancestry dna kit The Y-DNA test is more limited than the ones from Family Tree DNA Does not offer a less expensive 'autosomal DNA-only' test Can't connect with other matches Can't upload raw data from

More information

Souhrada Family Reunion U.S.A. #36

Souhrada Family Reunion U.S.A. #36 Souhrada Family Reunion U.S.A. #36 CEDAR FALLS, IOWA AUGUST 11, 2018 THANKS TO DAVE & CHERIE SOUHRADA AND JANEL STEPHENS! NOTE: SOUHRADA REUNION IN THE CZECH REPUBLIC SEPTEMBER 15, 2018 In memory of Leota

More information

Using Autosomal DNA to Solve a Family Mystery

Using Autosomal DNA to Solve a Family Mystery Using Autosomal DNA to Solve a Family Mystery W. Jones, Ph.D., CG, CGL, FASG, FUGA, FNGS Tom@JonesResearchServices.com This case study shows how targeted autosomal-dna testing supplemented documentary

More information

DNA and Ancestry. An Update on New Tests. Steve Louis. Jewish Genealogical Society of Washington State. January 13, 2014

DNA and Ancestry. An Update on New Tests. Steve Louis. Jewish Genealogical Society of Washington State. January 13, 2014 DNA and Ancestry An Update on New Tests Steve Louis Jewish Genealogical Society of Washington State January 13, 2014 DISCLAIMER This document was prepared as a result of independent work and opinions of

More information

Genetic Genealogy. Using DNA to research your maternal & paternal lines. Ed McGuire. Vermont Genealogy Library 2/24/14

Genetic Genealogy. Using DNA to research your maternal & paternal lines. Ed McGuire. Vermont Genealogy Library 2/24/14 Genetic Genealogy Using DNA to research your maternal & paternal lines Ed McGuire 2/24/14 Introduction Soprano Family Tree 2 2/24/14 Introduction 3 2/24/14 Introduction 4 2/24/14 Introduction Contradictory

More information

The Charles Alfred and Blanche Missouri Rhodes Hyde Family

The Charles Alfred and Blanche Missouri Rhodes Hyde Family Hyde Families Newsletter of the Hyde Genealogy Association!!Volume!2,!Number!2!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!March!2015

More information

Discovering Hard to Find Ancestry DNA Matches Page 1

Discovering Hard to Find Ancestry DNA Matches Page 1 Discovering Hard To Find Ancestry DNA Matches Alice Kalush 5/15/2018 This document discusses several methods for finding matches to your Ancestry DNA test that do not easily show up for you in the Hints

More information

Eller DNA Project. Status Report for Nashville EFA Conference----July 25, Tom Eller, DNA Project Administrator

Eller DNA Project. Status Report for Nashville EFA Conference----July 25, Tom Eller, DNA Project Administrator Eller DNA Project Status Report for Nashville EFA Conference----July 25, 2009 Tom Eller, DNA Project Administrator Eller DNA Project This presentation used material from Family Tree DNA and from World

More information

From Sticky Mucus to Probing our Past: Aspects and problems of the Biotechnological use of Macromolecules

From Sticky Mucus to Probing our Past: Aspects and problems of the Biotechnological use of Macromolecules From Sticky Mucus to Probing our Past: Aspects and problems of the Biotechnological use of Macromolecules DNA natures most important glycoconjugate DNA natures most important glycoconjugate High molecular

More information

Contributed by "Kathy Hallett"

Contributed by Kathy Hallett National Geographic: The Genographic Project Name Background The National Geographic Society is undertaking the ambitious process of tracking human migration using genetic technology. By using the latest

More information

DAR POLICY STATEMENT AND BACKGROUND Using DNA Evidence for DAR Applications

DAR POLICY STATEMENT AND BACKGROUND Using DNA Evidence for DAR Applications Effective January 1, 2014, DAR will begin accepting Y-DNA evidence in support of new member applications and supplemental applications as one element in a structured analysis. This analysis will use a

More information

What Can I Learn From DNA Testing?

What Can I Learn From DNA Testing? What Can I Learn From DNA Testing? From where did my ancestors migrate? What is my DNA Signature? Was my ancestor a Jewish Cohanim Priest? Was my great great grandmother really an Indian Princes? I was

More information

An Introduction. Your DNA. and Your Family Tree. (Mitochondrial DNA) Presentation by: 4/8/17 Page 1 of 10

An Introduction. Your DNA. and Your Family Tree. (Mitochondrial DNA) Presentation by: 4/8/17 Page 1 of 10 An Introduction Your DNA and Your Family Tree (Mitochondrial DNA) Presentation by: FredCoffey@aol.com 4/8/17 Page 1 of 10 Coffey Surname, y-dna Project We're now ready to move on and look at the type of

More information

MEET YOUR VOLUNTEER PRATER PROJECT ADMINISTRATORS

MEET YOUR VOLUNTEER PRATER PROJECT ADMINISTRATORS Prater* Project NEWSLETTER i Vol I, No 1 Click on graphic above to view the latest Prater Project Results Tables using the drop-down menus MEET YOUR VOLUNTEER PRATER PROJECT ADMINISTRATORS Laverne Piatt

More information

What to Expect When You re Clustering

What to Expect When You re Clustering What to Expect When You re Clustering Walter Steets Houston Genealogical Forum DNA Interest Group January 5, 2018 1 Today s agenda New Ancestry Match Comparison Report Clustering for DNA Matches Describe

More information

FREQUENTLY ASKED QUESTIONS ABOUT THE OWSTON/OUSTON DNA PROJECT

FREQUENTLY ASKED QUESTIONS ABOUT THE OWSTON/OUSTON DNA PROJECT FREQUENTLY ASKED QUESTIONS ABOUT THE OWSTON/OUSTON DNA PROJECT 1. What has been discovered thus far and what may be discovered with testing? The Owston/Ouston DNA project grew out of the combined genealogical

More information

Identification of the Hypothesized African Ancestry of the Wife of Pvt. Henry Windecker Using Genomic Testing of the Autosomes.

Identification of the Hypothesized African Ancestry of the Wife of Pvt. Henry Windecker Using Genomic Testing of the Autosomes. Identification of the Hypothesized African Ancestry of the Wife of Pvt. Henry Windecker Using Genomic Testing of the Autosomes Introduction African Ancestry: The hypothesis, based on considerable circumstantial

More information

Pedigree Reconstruction using Identity by Descent

Pedigree Reconstruction using Identity by Descent Pedigree Reconstruction using Identity by Descent Bonnie Kirkpatrick Electrical Engineering and Computer Sciences University of California at Berkeley Technical Report No. UCB/EECS-2010-43 http://www.eecs.berkeley.edu/pubs/techrpts/2010/eecs-2010-43.html

More information

Academic Path to a Genetic Genealogy Curriculum

Academic Path to a Genetic Genealogy Curriculum International Journal of Humanities Social Sciences and Education (IJHSSE) Volume 5, Issue 10, October 2018, PP 34-42 ISSN 2349-0373 (Print) & ISSN 2349-0381 (Online) http://dx.doi.org/10.20431/2349-0381.0510004

More information

BETTER TOGETHER: MAKING YOUR CASE WITH DOCUMENTS AND DNA BCG-sponsored Webinar (https://bcgcertification.org) Patricia Lee Hobbs, CG

BETTER TOGETHER: MAKING YOUR CASE WITH DOCUMENTS AND DNA BCG-sponsored Webinar (https://bcgcertification.org) Patricia Lee Hobbs, CG BETTER TOGETHER: MAKING YOUR CASE WITH DOCUMENTS AND DNA BCG-sponsored Webinar (https://bcgcertification.org) Patricia Lee Hobbs, CG LIMITATIONS & BENEFITS OF DNA TESTING DNA test results do not solve

More information

Genetic Genealogy Journey Tips for Initial Contact with a Match Debbie Parker Wayne, CG SM, CGL SM

Genetic Genealogy Journey Tips for Initial Contact with a Match Debbie Parker Wayne, CG SM, CGL SM Genetic Genealogy Journey Tips for Initial Contact with a Match Debbie Parker Wayne, CG SM, CGL SM Genetic genealogists frequently complain about the low response rate to requests for contact with our

More information

Genetic Genealogy Resources

Genetic Genealogy Resources Genetic Genealogy Resources ISOGG International Society of Genetic Genealogists ISOGG was formed in 2003 by a group of surname administrators after the first International DNA Conference in Houston. Membership

More information

From Story for to Reference to : Genetic Genealogy and Origin Setting

From Story for to Reference to : Genetic Genealogy and Origin Setting Research Article Volume 6 Issue 5 - October 2018 DOI: 10.19080/GJAA.2018.06.555700 Lolita Nikolova* Glob J Arch & Anthropol Copyright All rights are reserved by Lolita Nikolova From Story for to Reference

More information

Calling Ancestors to the Table. Presenters Sharon Leslie Morgan Rachel Unkefer

Calling Ancestors to the Table. Presenters Sharon Leslie Morgan Rachel Unkefer Calling Ancestors to the Table Presenters Sharon Leslie Morgan Rachel Unkefer About the Presenters Sharon Leslie Morgan Rachel Unkefer Writer & genealogist Genealogist for 30+ years 30+ years experience

More information

Clan Galbraith Association Application for or Renewal of Membership

Clan Galbraith Association Application for or Renewal of Membership Clan Galbraith Association Application for or Renewal of Membership ELIGIBILITY FOR MEMBERSHIP: Membership in the Clan Galbraith Association is open to any person related by blood or marriage to the Galbraith

More information

DNA SEGMENT SHARING in DESCENDANTS of ADAM YOUNG ( ) and CATHARINE E. SCHREMLING ( ) David K. Faux

DNA SEGMENT SHARING in DESCENDANTS of ADAM YOUNG ( ) and CATHARINE E. SCHREMLING ( ) David K. Faux DNA SEGMENT SHARING in DESCENDANTS of ADAM YOUNG (1717-1790) and CATHARINE E. SCHREMLING (1720-1798) By David K. Faux The following manuscript is an interpretive guide to the data from the autosomal and

More information

Ewing Surname Y-DNA Project Article 8

Ewing Surname Y-DNA Project Article 8 Ewing Surname Y-DNA Project Article 8 This is the eighth in a series of articles about the Ewing Surname Y-DNA Project. The previous seven articles have appeared in the last seven issues of the Journal

More information

Entire Chromosome 21 Inherited from 5 th Great Grandparents Captain Daniel and Elizabeth (Windecker) Young

Entire Chromosome 21 Inherited from 5 th Great Grandparents Captain Daniel and Elizabeth (Windecker) Young Entire Chromosome 21 Inherited from 5 th Great Grandparents Captain Daniel and Elizabeth (Windecker) Young The Ancestors: Daniel Young was born about 1755 in the Canajoharie District of the Mohawk Valley

More information

Developing Conclusions About Different Modes of Inheritance

Developing Conclusions About Different Modes of Inheritance Pedigree Analysis Introduction A pedigree is a diagram of family relationships that uses symbols to represent people and lines to represent genetic relationships. These diagrams make it easier to visualize

More information

Yoder Doors Opened by DNA Studies

Yoder Doors Opened by DNA Studies Yoder Doors Opened by DNA Studies A Special Report to the 2012 North Carolina Yoder Reunion By Chris Yoder Yoder Newsletter Oct. 2012 www.yodernewsletter.org Established 1983 BACKGROUND How DNA Testing

More information

BOUSE GENIES NEWSLETTER

BOUSE GENIES NEWSLETTER BOUSE GENIES NEWSLETTER Volume 10, Number 2 Spring 2016 GENETIC GENEALOGY [From the Spring 2016 SKP Genies Newsletter] Today there is so much more to doing genealogy research than studying the roots, branches

More information