CAGGNI s DNA Special Interest Group
|
|
- Jonathan Turner
- 6 years ago
- Views:
Transcription
1 CAGGNI s DNA Special Interest Group 10 Jan 2015 Al & Michelle Wilson Agenda Survey Basics in Fan Charts Recombination Exercise Triangulation Overview
2 Survey 1. Have you taken (or sponsored) a DNA test? 2. What kind of test? A. Y-DNA B. Mitochondrial DNA C. Autosomal DNA ( Family Finder, Cousin Finder, Ancestry.com since 2010) 3. What Testing Service? A. Family Tree DNA B. Ancestry.com C. 23andMe D. Genographic Project E. Other 4. Why did you take the DNA test? 5. Have you contacted any of your DNA matches? 6. Have you attempted any triangulation, 3 rd party tools, chromosome mapping, reconstruction of ancestral DNA, or management of a surname project? 7. What can I do with my results?
3 You and Your Ancestors you male female
4 Mitochondrial DNA mtdna Inheritance 16,569 bp
5 Y Chromosome DNA ydna Inheritance 58,000,000 bp 12 marker test, 37 marker test 67, 111, big Y
6 (Ideal) Autosomal DNA atdna or audna Inheritance 6,400,000,000 bps, test looks at 700,000 locations
7 Typical Autosomal DNA atdna or audna Inheritance
8 Ideal vs. Actual Autosomal DNA atdna or audna Inheritance Source - gcbias.org The Coop Lab
9 Pop Beads Nucleus Exercise!
10 Nuclear DNA & Autosomal Testing Nucleus Autosomal Chromosomes Pairs 1-22 A-T rich segments show up dark when Giemsa is applied. Sex Chromosomes 10
11 X Chromosome xdna Inheritance in a Male (1, 1 of 2, 2 of 4, 3 of 8, 5 of 16, 8 of 32, 13 of 64, 21 of 128.)
12 X Chromosome xdna Inheritance in a Female (1, 2 of 2, 3 of 4, 5 of 8, 8 of 16, 13 of 32, 21 of 64, 34 of 128.)
13 Comparing Y-DNA Results: Surname Projects
14 Finding Cousins with at-dna A Second Cousin Match has been found between you and Kathryn H Compare pedigrees use surname lists in their absence Dad 2 nd cousins should share a set of common Gr-Grandparents Kathryn 14
15 More Examples Viewer set to show segments of 5+ cm Length of match is measured in centimorgans (cm) 1 st cousins 2nd cousins 3rd cousins Person comparing to five 2 nd cousins who are siblings 15
16 Your mileage may vary! Centimorgan cm or Map Unit: The distance between chromosome positions for which the expected average crossovers in one generation is 1% Convert cm to % shared: add all shared segments over 5 and divide by % Theoretical % Actual, typ. Shared cm, Theo. Relationship Parent Sibling Grandparent, aunt or uncle, half-sibling, double first cousin Great-grandparent, first cousin, great-uncle/aunt, half-aunt/uncle, half-nephew/niece First cousin once removed, half first cousin Second cousin, first cousin twice removed Second cousin once removed, half second cousin Third cousin, second cousin twice removed Third cousin once removed Fourth cousin Fourth cousin once removed Fifth cousin Fifth cousin once removed 16
17 Autosomal Family Finder Tests Examines ~700,000 SNPs on the 22 autosomal chromosomes known to vary Persons with lots of identical adjacent SNP locations are likely relations Paper trails are needed to determine the specific relation start with best matches Long shared segments indicate common ancestors Finds matches within about 7 generations beyond the 5x gr-grandparent it is just identifying deep ancestry (same population) Results include Ethnic Percentages Relationship Actual cm segment % IBD % IBS Source: John Walden Suggested 1st 2nd 3rd 4th 5th 6th 7th 8th 1 st cousin 97% 3% 2 nd 5% 90% 5% 3 rd 10% 70% 30% 10% 5% 4 th 5% 10% 40% 30% 10% 5% 5th 5% 10% 30% 20% 10% 5% Source: Maurice Gleeson 17 17
18 Third Party Tools: DNAGedcom Autosomal DNA Segment Analyzer (ASDA)
19 Third Party Tools: GedMatch 1 to many tool
20 Third Party Tools: GedMatch 1 to 1 tool
21 Company Comparison Summary DNA Test Family Tree DNA Ancestry DNA 23andMe Y-DNA Offered Big-Y Surname Groups *** Mt-DNA Offered Full Sequence *** At-DNA Offered Chrom. Browser Family Trees Database size ** good huge * ** huge * You see your matches in the Chromosome Browser only if they invite you in. ** Gedcom upload only. Not fully featured. *** mt-dna and Y-DNA haplogroups reported with the At-DNA test
22 Testing Companies and 3 rd Party Tools Ancestry DNA: FT DNA: 23andMe: ISOGG: DNAGedCom: DNAGedMatch:
23 Blogs & Sites Michelle has found useful Kitty Cooper Kitty Cooper s Blog CeCe Moore Your Genetic Genealogist Blaine Bettinger The Genetic Genealogist Roberta Estes DNA Explained Graham Coop Coop Labs (UC Davis) Dieneke s Anthropology Blog And of course The ISOGG Wiki And Wikipedia!
Autosomal DNA. What is autosomal DNA? X-DNA
ANGIE BUSH AND PAUL WOODBURY info@thednadetectives.com November 1, 2014 Autosomal DNA What is autosomal DNA? Autosomal DNA consists of all nuclear DNA except for the X and Y sex chromosomes. There are
More informationWalter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018
DNA, Ancestry, and Your Genealogical Research- Segments and centimorgans Walter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018 1 Today s agenda Brief review of previous DIG session
More informationGenetic Genealogy. Rules and Tools. Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter
Genetic Genealogy Rules and Tools Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter I am NOT this guy! 2 Genealogy s Newest Tool Genealogy research: Study of Family History Identifies
More informationUsing Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM
Using Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.
More informationDNA for Genealogy Librarians. Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District
DNA for Genealogy Librarians Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District What does DNA do? It replicates itself. It codes for the production
More informationIntroduction to Autosomal DNA Tools
GENETIC GENEALOGY JOURNEY Debbie Parker Wayne, CG, CGL Introduction to Autosomal DNA Tools Just as in the old joke about a new genealogist walking into the library and asking for the book that covers my
More informationUsing X-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM
Using X-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.
More informationGenealogical Research
DNA, Ancestry, and Your Genealogical Research Walter Steets Houston Genealogical Forum DNA Interest Group March 2, 2019 1 Today s Agenda Brief review of basic genetics and terms used in genetic genealogy
More informationWalter Steets Houston Genealogical Forum DNA Interest Group April 7, 2018
Ancestry DNA and GEDmatch Walter Steets Houston Genealogical Forum DNA Interest Group April 7, 2018 Today s agenda Recent News about DNA Testing DNA Cautions: DNA Data Used for Forensic Purposes New Technology:
More informationTHE BASICS OF DNA TESTING. By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library
THE BASICS OF DNA TESTING By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library TYPES OF TESTS Mitochondrial DNA (mtdna/mdna) Y-DNA Autosomal DNA (atdna/audna) MITOCHONDRIAL DNA Found
More informationPizza and Who do you think you are?
Pizza and Who do you think you are? an overview of one of the newest and possibly more helpful developments in researching genealogy and family history that of using DNA for research What is DNA? Part
More informationTRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter
TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter 1-1: DNA: WHERE DO I START? Definition Genetic genealogy is the application of genetics to traditional genealogy. Genetic genealogy uses genealogical
More informationGetting the Most Out of Your DNA Matches
Helen V. Smith PG Dip Public Health, BMedLabSci, ADCLT, Dip. Fam. Hist. PLCGS 46 Kraft Road, Pallara, Qld, 4110 Email: HVSresearch@DragonGenealogy.com Website: www.dragongenealogy.com Blog: http://www.dragongenealogy.com/blog/
More informationGenetic Genealogy Journey DNA Projects by Debbie Parker Wayne, CG SM, CGL SM
Genetic Genealogy Journey DNA Projects by Debbie Parker Wayne, CG SM, CGL SM Genealogy can be a solitary pursuit. Genealogists sometimes collaborate to work on common lines, but lone researchers can perform
More informationDNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016
DNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016 1 What we will cover How testing helps genealogy What is DNA? How do you select from the three testing companies?
More information[CLIENT] SmithDNA1701 DE January 2017
[CLIENT] SmithDNA1701 DE1704205 11 January 2017 DNA Discovery Plan GOAL Create a research plan to determine how the client s DNA results relate to his family tree as currently constructed. The client s
More informationWalter Steets Houston Genealogical Forum DNA Interest Group February 24, 2018
Using Ancestry DNA and Third-Party Tools to Research Your Shared DNA Segments Part 2 Walter Steets Houston Genealogical Forum DNA Interest Group February 24, 2018 1 Today s agenda Brief review of previous
More information! FTDNA! Ancestry. ! 23andMe. ! Medical Considera,ons. ! Iden,fying family medical history. ! Communica,ng with the medical community
by JEFF CARPENTER! Brief Defini,ons about YDNA, XDNA, mtdna, atdna (Covered in Part 1)! Benefits of Tes,ng DNA! Examples of DNA TESTING! FTDNA! Ancestry! 3andMe Jeff Carpenter, 016 jeffcarpenter1939@gmal.com!
More informationUnderstanding Third Party DNA Analysis Tools. Copyright 2014 James R. Lannin, Jr. aka Jimmy Chromosomes
Understanding Third Party DNA Analysis Tools Copyright 2014 James R. Lannin, Jr. aka Jimmy Chromosomes A Review of the Basics You have 46 chromosomes and they come to you in 23 pairs from your mother and
More informationDNA Testing What you need to know first
DNA Testing What you need to know first This article is like the Cliff Notes version of several genetic genealogy classes. It is a basic general primer. The general areas include Project support DNA test
More informationMitochondrial DNA (mtdna) JGSGO June 5, 2018
Mitochondrial DNA (mtdna) JGSGO June 5, 2018 MtDNA - outline What is it? What do you do with it? How do you maximize its value? 2 3 mtdna a double-stranded, circular DNA that is stored in mitochondria
More informationThe Structure of DNA Let s take a closer look at how this looks under a microscope.
DNA Basics Adapted from a MyHeritage Blog and the International Society of Genetic Genealogy (ISOGG) Wiki by Earl Cory MyHeritage has started a series to explain DNA, how it works and answer the most common
More informationA Day Out With Your DNA
A Day Out With Your DNA Diahan Southard www.yourdnaguide.com Your testing company has evaluated around 800,000 locations on your DNA to help them determine your origins and your genetic cousins. While
More informationDNA Basics. OLLI: Genealogy 101 October 1, ~ Monique E. Rivera ~
DNA Basics OLLI: Genealogy 101 October 1, 2018 ~ Monique E. Rivera ~ WHAT IS DNA? DNA (deoxyribonucleic acid) is found in every living cell everywhere. It is a long chemical chain that tells our cells
More informationApproaching and Connecting with Your DNA Matches
Approaching and Connecting with Your DNA Matches Shannon Stewart Christmas, MCP throughthetreesblog@gmail.com Understand DNA Tests The four types of DNA and the relevant test companies Segment triangulation
More informationGEDmatch Home Page The upper left corner of your home page has Information about you and links to lots of helpful information. Check them out!
USING GEDMATCH Created March 2015 GEDmatch is a free, non-profit site that accepts raw autosomal data files from Ancestry, FTDNA, and 23andme. As such, it provides a large autosomal database that spans
More informationDNA Testing. February 16, 2018
DNA Testing February 16, 2018 What Is DNA? Double helix ladder structure where the rungs are molecules called nucleotides or bases. DNA contains only four of these nucleotides A, G, C, T The sequence that
More informationTools: 23andMe.com website and test results; DNAAdoption handouts.
When You First Get Your 23andMe Results Objective: Learn what to do with results of atdna testing with 23andMe. Tools: 23andMe.com website and test results; DNAAdoption handouts. Exercises: Practice Exercises
More informationDNA Solu)ons for Brick Walls And Adop)on
DNA Solu)ons for Brick Walls And Adop)on "I have not failed. I've just found ten thousand ways that won't work." Thomas Edison Wise Woman Gene+c Genealogy Comments Listen Carefully! 1. DNA is not the be
More informationFirst Results: Intro to FamilyTreeDNA s Family Finder. Learn what to do with results of autosomal DNA testing with FamilyTreeDNA (FTDNA).
First Results: Family Tree DNA When You First Get Your FamilyTreeDNA (FTDNA) Results Objective: Learn what to do with results of autosomal DNA testing with FamilyTreeDNA (FTDNA). Tools: familytreedna.com
More informationAdvanced Autosomal DNA Techniques used in Genetic Genealogy
Advanced Autosomal DNA Techniques used in Genetic Genealogy Tim Janzen, MD E-mail: tjanzen@comcast.net Summary of Chromosome Mapping Technique The following are specific instructions on how to map your
More informationRobert Warthen
Robert Warthen www.dnagedcom.com GENETIC GENEALOGY STANDARD NINE ISOGG PRIVATIZE OR REDACT THE NAMES OF LIVING GENETIC MATCHES FROM PRESENTATIONS UNLESS THE GENETIC MATCHES HAVE GIVEN THEIR PRIOR PERMISSION
More informationGenetic Genealogy Journey Why Is My Cousin Not on my DNA Match List? Debbie Parker Wayne, CG SM, CGL SM
Genetic Genealogy Journey Why Is My Cousin Not on my DNA Match List? Debbie Parker Wayne, CG SM, CGL SM The CSI television shows have conditioned us to expect exact DNA matches and lead us to think DNA
More informationGliesianDNA (BETA) atdna Relationships Predictions for cms with no influence factors
GliesianDNA (BETA) atdna Relationships Predictions for 562.3 cms with no influence factors Report generated on: 2018-07-07T13:08:31.511 by Gliesian, LLC's GliesianDNA (beta), version 0.4.1 Introduction
More informationWalter Steets Houston Genealogical Forum DNA Interest Group May 5, 2018
GEDmatch: The Golden State Killer Tier 1 Tools Walter Steets Houston Genealogical Forum DNA Interest Group May 5, 2018 1 Today s agenda Walter s Take on DNA Developments Growth in Number of DNA Testers
More informationRecent Results from the Jackson Brigade DNA Project
Recent Results from the Jackson Brigade DNA Project Dr. Daniel C. Hyde Professor Emeritus of Computer Science Bucknell University Lewisburg, PA Presented at Jackson Brigade Reunion, Horner, WV on August
More informationTracking Your Roots With DNA
Tracking Your Roots With DNA Genetic Genealogy Lisa R Franklin RN,BSN 31 Oct 2013/27 Jun 2014 Andalusia, Alabama Why DNA test? Determine if two people are related Determine if two people descend from the
More informationDNA: UNLOCKING THE CODE
DNA: UNLOCKING THE CODE Connecting Cousins for Genetic Genealogy Bryant McAllister, PhD Associate Professor of Biology University of Iowa bryant-mcallister@uiowa.edu Iowa Genealogical Society April 9,
More informationWalter Steets Houston Genealogical Forum DNA Interest Group November 18, 2017
DNA, Ancestry, and Your Genealogical Research Session 2 Walter Steets Houston Genealogical Forum DNA Interest Group November 18, 2017 1 Today s agenda Brief review of previous DIG session Degrees of Separation
More informationUsing Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM
Using Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.
More informationGetting the Most of Your DNA Test. Friends of Irish Research Richard Reid
Getting the Most of Your DNA Test Friends of Irish Research Richard Reid So You Have Been Tested! The results are back and now is time to explore and see if any of your brick walls can be broken down.
More informationUsing Mitochondrial DNA (mtdna) for Genealogy Debbie Parker Wayne, CG, CGL SM
Using Mitochondrial DNA (mtdna) for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical
More informationAutosomal-DNA. How does the nature of Jewish genealogy make autosomal DNA research more challenging?
Autosomal-DNA How does the nature of Jewish genealogy make autosomal DNA research more challenging? Using Family Finder results for genealogy is more challenging for individuals of Jewish ancestry because
More informationRichard Weiss - Director / Exec VP
Richard Weiss - Director / Exec VP www.dnaadoption.com Welcome to DNAGEDCOM GENETIC GENEALOGY STANDARD NINE ISOGG PRIVATIZE OR REDACT THE NAMES OF LIVING GENETIC MATCHES FROM PRESENTATIONS UNLESS THE GENETIC
More informationDNA Opening Doors for Today s s Genealogist
DNA Opening Doors for Today s s Genealogist Presented to JGSI Sunday, March 30, 2008 Presented by Alvin Holtzman Genetic Genealogy Discussion Points What is DNA How can it help genealogists What to expect
More informationDNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding
DNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding by Dr. Ing. Robert L. Baber 2014 July 26 Rights reserved, see the copyright notice at http://gengen.rlbaber.de
More informationVisual Phasing of Chromosome 1
Visual Phasing of Chromosome 1 If you have the possibility to test three full siblings, then the next great thing you could do with your DNA, is to try out the Visual Phasing technique developed by Kathy
More informationYour mtdna Full Sequence Results
Congratulations! You are one of the first to have your entire mitochondrial DNA (DNA) sequenced! Testing the full sequence has already become the standard practice used by researchers studying the DNA,
More informationGenetic Identity and
Genetic Identity and GACATGTAGCTCTTCACTTCACCCAGGTTGGGTTGTGTCAACAGGAAACATTGTAACATATCACTTGGATTAGCACCTAGG/TTAT/TTAT/TTA Community DTC Genetic Testing Workshop The National Academies' August 31 September 1,
More informationYour Family 101 Beginning Genealogical Research
Your Family 101 Beginning Genealogical Research What Will We Cover Today? Session 1: Getting Started Session 2: Your Resources Session 3: Common Mistakes and Pitfalls Session 4: DNA Testing and Medical
More informationOrangeburgh District DNA Project. Finding Family Connections with Autosomal DNA Testing
Orangeburgh District DNA Project Finding Family Connections with Autosomal DNA Testing Review some DNA basics Address privacy issues Evidence vs. Proof Look at some specific examples 3 Types of DNA Testing
More informationLearn what to do with results of autosomal DNA testing from AncestryDNA.
When You First Get Your AncestryDNA Results Objective: Learn what to do with results of autosomal DNA testing from AncestryDNA. Tools: AncestryDNA results; ancestry.com, genesis.gedmatch.com and familytreedna.com
More informationDNA, A Genealogy Tool. The Search for an Expert Genealogist, Photos & Clues
DNA, A Genealogy Tool The Search for an Expert Genealogist, Photos & Clues mydanishancestors.com *Slide Show shared in this class & more web-sites under Toolbar/DNA *One doesn t have to have Danish ancestors
More informationIN THIS ISSUE: February From the Administrator Questions/News...1. George Varner of Missouri Direct Line...2
IN THIS ISSUE: From the Administrator..... 1 Questions/News.......1 George Varner of Missouri Direct Line...2 Do the Newtons & Varners Really Both have Riggs DNA?...2 2016 Newton/Varner Reunion. 5 February
More informationFind JCD Project Date: Identification-DNA Process Updated:
New Look Investigations Created by: Jack Friess Find JCD Project Date: 04-20-2018 Identification-DNA Process Updated: 05-24-2018 Questions and Answers Identification-DNA (ID-DNA) is a scientific process
More informationWalter Steets Houston Genealogical Forum DNA Interest Group January 27, 2018
Using Ancestry DNA and Third-Party Tools to Research Your Shared DNA Segments Walter Steets Houston Genealogical Forum DNA Interest Group January 27, 2018 1 Today s agenda Brief review of previous DIG
More informationGenealogy: DNA And The Family Tree By James Mayflower READ ONLINE
Genealogy: DNA And The Family Tree By James Mayflower READ ONLINE CeCe Moore's "DNA Testing for Genealogy - Getting Started" series is a Family Tree DNA is currently the only commercial laboratory offering
More informationHalley Family. Mystery? Mystery? Can you solve a. Can you help solve a
Can you solve a Can you help solve a Halley Halley Family Family Mystery? Mystery? Who was the great grandfather of John Bennett Halley? He lived in Maryland around 1797 and might have been born there.
More informationPrimer on Human Pedigree Analysis:
Primer on Human Pedigree Analysis: Criteria for the selection and collection of appropriate Family Reference Samples John V. Planz. Ph.D. UNT Center for Human Identification Successful Missing Person ID
More informationUnderstanding DNA in Genealogy. Peter Biggins, BY3164 Darien Library, Darien, CT November 18, 2017
Understanding DNA in Genealogy Peter Biggins, BY3164 Darien Library, Darien, CT November 18, 2017 1953: Watson 25, Crick 37, Franklin 33 My BY3164 SNP 1953 paper published on the structure of DNA 1962
More informationLearn what to do with results of autosomal DNA testing from AncestryDNA. Tools: AncestryDNA results; ancestry.com, gedmatch.com and familytreedna.
First Look : AncestryDNA When You First Get Your AncestryDNA Results Objective: Learn what to do with results of autosomal DNA testing from AncestryDNA. Tools: AncestryDNA results; ancestry.com, gedmatch.com
More informationY-DNA Genetic Testing
Y-DNA Genetic Testing 50 2/24/14 Y-DNA Genetic Testing Y-DNA flows from fathers to sons intact SNPs define Y-DNA haplogroups Haplogroups (clans) migrated together Timeframe between mutations is 2,000 to
More informationDNAGedcom s GWorks Automation Utility using Ancestry.com Results
Developed by Debra Demeester, collaborating genealogist, based on Kitty Cooper's blog post of 26 Sept 2017. PART 1: PARTNER DNAGedcom AND ANCESTRY I. CREATE A PAID ACCOUNT AT DNAGEDCOM 1. Click on the
More informationFamily Tree DNA Genetic Genealogy Started Here
Family Tree DNA Genetic Genealogy Started Here With 253,000 samples in our DNA database (the largest of its kind in the world) your genealogical search could become even easier Why Bennett Greenspan founded
More informationDNA TESTING. This is the testing regime for FamilyTreeDNA. Other SNP tests were ordered from Yseq.
DNA & GENEALOGY DNA TESTING This is the testing regime for FamilyTreeDNA. Other SNP tests were ordered from Yseq. Product Date Batch Family Finder 30-May-14 Completed 569 05-Aug-14 Batched 569 05-Jul-14
More informationWINSLOW HERITAGE SOCIETY ~~~~~~~~~~~~~~~~~~
Newsletter, Vol. 2, No. 1 March, 2015 WINSLOW HERITAGE SOCIETY ~~~~~~~~~~~~~~~~~~ In Vol. 1, No. 1 of the Winslow Heritage Society Newsletter, Kathy Myers, Society Governor, a descendant of Kenelm Winslow,
More informationComputer - aided Genealogy. Rob Drew
Computer - aided Genealogy Rob Drew Topics Building your family tree Off-line tools for your laptop or desktop at home. What s a gedcom file? Building an on-line tree. Research websites Where to get help
More informationUse of DNA information in family research information for IOWFHS members
Use of DNA information in family research information for IOWFHS members What is DNA? Since the discovery of deoxyribonucleic acid (DNA) in the 1950s, we have come to understand more about its role as
More informationBefore India: Exploring Your Ancestry With DNA By David G. Mahal
Before India: Exploring Your Ancestry With DNA By David G. Mahal You then receive an email notifying you that your results are ready to explore on utilize your DNA results for family history by Ancestry.com
More informationcompany does improve its ethnicity estimates, your profile will automatically be updated, too. You won't have to retake the test to get the new
Ancestry dna kit The Y-DNA test is more limited than the ones from Family Tree DNA Does not offer a less expensive 'autosomal DNA-only' test Can't connect with other matches Can't upload raw data from
More informationSouhrada Family Reunion U.S.A. #36
Souhrada Family Reunion U.S.A. #36 CEDAR FALLS, IOWA AUGUST 11, 2018 THANKS TO DAVE & CHERIE SOUHRADA AND JANEL STEPHENS! NOTE: SOUHRADA REUNION IN THE CZECH REPUBLIC SEPTEMBER 15, 2018 In memory of Leota
More informationUsing Autosomal DNA to Solve a Family Mystery
Using Autosomal DNA to Solve a Family Mystery W. Jones, Ph.D., CG, CGL, FASG, FUGA, FNGS Tom@JonesResearchServices.com This case study shows how targeted autosomal-dna testing supplemented documentary
More informationDNA and Ancestry. An Update on New Tests. Steve Louis. Jewish Genealogical Society of Washington State. January 13, 2014
DNA and Ancestry An Update on New Tests Steve Louis Jewish Genealogical Society of Washington State January 13, 2014 DISCLAIMER This document was prepared as a result of independent work and opinions of
More informationGenetic Genealogy. Using DNA to research your maternal & paternal lines. Ed McGuire. Vermont Genealogy Library 2/24/14
Genetic Genealogy Using DNA to research your maternal & paternal lines Ed McGuire 2/24/14 Introduction Soprano Family Tree 2 2/24/14 Introduction 3 2/24/14 Introduction 4 2/24/14 Introduction Contradictory
More informationThe Charles Alfred and Blanche Missouri Rhodes Hyde Family
Hyde Families Newsletter of the Hyde Genealogy Association!!Volume!2,!Number!2!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!March!2015
More informationDiscovering Hard to Find Ancestry DNA Matches Page 1
Discovering Hard To Find Ancestry DNA Matches Alice Kalush 5/15/2018 This document discusses several methods for finding matches to your Ancestry DNA test that do not easily show up for you in the Hints
More informationEller DNA Project. Status Report for Nashville EFA Conference----July 25, Tom Eller, DNA Project Administrator
Eller DNA Project Status Report for Nashville EFA Conference----July 25, 2009 Tom Eller, DNA Project Administrator Eller DNA Project This presentation used material from Family Tree DNA and from World
More informationFrom Sticky Mucus to Probing our Past: Aspects and problems of the Biotechnological use of Macromolecules
From Sticky Mucus to Probing our Past: Aspects and problems of the Biotechnological use of Macromolecules DNA natures most important glycoconjugate DNA natures most important glycoconjugate High molecular
More informationContributed by "Kathy Hallett"
National Geographic: The Genographic Project Name Background The National Geographic Society is undertaking the ambitious process of tracking human migration using genetic technology. By using the latest
More informationDAR POLICY STATEMENT AND BACKGROUND Using DNA Evidence for DAR Applications
Effective January 1, 2014, DAR will begin accepting Y-DNA evidence in support of new member applications and supplemental applications as one element in a structured analysis. This analysis will use a
More informationWhat Can I Learn From DNA Testing?
What Can I Learn From DNA Testing? From where did my ancestors migrate? What is my DNA Signature? Was my ancestor a Jewish Cohanim Priest? Was my great great grandmother really an Indian Princes? I was
More informationAn Introduction. Your DNA. and Your Family Tree. (Mitochondrial DNA) Presentation by: 4/8/17 Page 1 of 10
An Introduction Your DNA and Your Family Tree (Mitochondrial DNA) Presentation by: FredCoffey@aol.com 4/8/17 Page 1 of 10 Coffey Surname, y-dna Project We're now ready to move on and look at the type of
More informationMEET YOUR VOLUNTEER PRATER PROJECT ADMINISTRATORS
Prater* Project NEWSLETTER i Vol I, No 1 Click on graphic above to view the latest Prater Project Results Tables using the drop-down menus MEET YOUR VOLUNTEER PRATER PROJECT ADMINISTRATORS Laverne Piatt
More informationWhat to Expect When You re Clustering
What to Expect When You re Clustering Walter Steets Houston Genealogical Forum DNA Interest Group January 5, 2018 1 Today s agenda New Ancestry Match Comparison Report Clustering for DNA Matches Describe
More informationFREQUENTLY ASKED QUESTIONS ABOUT THE OWSTON/OUSTON DNA PROJECT
FREQUENTLY ASKED QUESTIONS ABOUT THE OWSTON/OUSTON DNA PROJECT 1. What has been discovered thus far and what may be discovered with testing? The Owston/Ouston DNA project grew out of the combined genealogical
More informationIdentification of the Hypothesized African Ancestry of the Wife of Pvt. Henry Windecker Using Genomic Testing of the Autosomes.
Identification of the Hypothesized African Ancestry of the Wife of Pvt. Henry Windecker Using Genomic Testing of the Autosomes Introduction African Ancestry: The hypothesis, based on considerable circumstantial
More informationPedigree Reconstruction using Identity by Descent
Pedigree Reconstruction using Identity by Descent Bonnie Kirkpatrick Electrical Engineering and Computer Sciences University of California at Berkeley Technical Report No. UCB/EECS-2010-43 http://www.eecs.berkeley.edu/pubs/techrpts/2010/eecs-2010-43.html
More informationAcademic Path to a Genetic Genealogy Curriculum
International Journal of Humanities Social Sciences and Education (IJHSSE) Volume 5, Issue 10, October 2018, PP 34-42 ISSN 2349-0373 (Print) & ISSN 2349-0381 (Online) http://dx.doi.org/10.20431/2349-0381.0510004
More informationBETTER TOGETHER: MAKING YOUR CASE WITH DOCUMENTS AND DNA BCG-sponsored Webinar (https://bcgcertification.org) Patricia Lee Hobbs, CG
BETTER TOGETHER: MAKING YOUR CASE WITH DOCUMENTS AND DNA BCG-sponsored Webinar (https://bcgcertification.org) Patricia Lee Hobbs, CG LIMITATIONS & BENEFITS OF DNA TESTING DNA test results do not solve
More informationGenetic Genealogy Journey Tips for Initial Contact with a Match Debbie Parker Wayne, CG SM, CGL SM
Genetic Genealogy Journey Tips for Initial Contact with a Match Debbie Parker Wayne, CG SM, CGL SM Genetic genealogists frequently complain about the low response rate to requests for contact with our
More informationGenetic Genealogy Resources
Genetic Genealogy Resources ISOGG International Society of Genetic Genealogists ISOGG was formed in 2003 by a group of surname administrators after the first International DNA Conference in Houston. Membership
More informationFrom Story for to Reference to : Genetic Genealogy and Origin Setting
Research Article Volume 6 Issue 5 - October 2018 DOI: 10.19080/GJAA.2018.06.555700 Lolita Nikolova* Glob J Arch & Anthropol Copyright All rights are reserved by Lolita Nikolova From Story for to Reference
More informationCalling Ancestors to the Table. Presenters Sharon Leslie Morgan Rachel Unkefer
Calling Ancestors to the Table Presenters Sharon Leslie Morgan Rachel Unkefer About the Presenters Sharon Leslie Morgan Rachel Unkefer Writer & genealogist Genealogist for 30+ years 30+ years experience
More informationClan Galbraith Association Application for or Renewal of Membership
Clan Galbraith Association Application for or Renewal of Membership ELIGIBILITY FOR MEMBERSHIP: Membership in the Clan Galbraith Association is open to any person related by blood or marriage to the Galbraith
More informationDNA SEGMENT SHARING in DESCENDANTS of ADAM YOUNG ( ) and CATHARINE E. SCHREMLING ( ) David K. Faux
DNA SEGMENT SHARING in DESCENDANTS of ADAM YOUNG (1717-1790) and CATHARINE E. SCHREMLING (1720-1798) By David K. Faux The following manuscript is an interpretive guide to the data from the autosomal and
More informationEwing Surname Y-DNA Project Article 8
Ewing Surname Y-DNA Project Article 8 This is the eighth in a series of articles about the Ewing Surname Y-DNA Project. The previous seven articles have appeared in the last seven issues of the Journal
More informationEntire Chromosome 21 Inherited from 5 th Great Grandparents Captain Daniel and Elizabeth (Windecker) Young
Entire Chromosome 21 Inherited from 5 th Great Grandparents Captain Daniel and Elizabeth (Windecker) Young The Ancestors: Daniel Young was born about 1755 in the Canajoharie District of the Mohawk Valley
More informationDeveloping Conclusions About Different Modes of Inheritance
Pedigree Analysis Introduction A pedigree is a diagram of family relationships that uses symbols to represent people and lines to represent genetic relationships. These diagrams make it easier to visualize
More informationYoder Doors Opened by DNA Studies
Yoder Doors Opened by DNA Studies A Special Report to the 2012 North Carolina Yoder Reunion By Chris Yoder Yoder Newsletter Oct. 2012 www.yodernewsletter.org Established 1983 BACKGROUND How DNA Testing
More informationBOUSE GENIES NEWSLETTER
BOUSE GENIES NEWSLETTER Volume 10, Number 2 Spring 2016 GENETIC GENEALOGY [From the Spring 2016 SKP Genies Newsletter] Today there is so much more to doing genealogy research than studying the roots, branches
More information