Primer on Human Pedigree Analysis:

Size: px
Start display at page:

Download "Primer on Human Pedigree Analysis:"

Transcription

1 Primer on Human Pedigree Analysis: Criteria for the selection and collection of appropriate Family Reference Samples John V. Planz. Ph.D. UNT Center for Human Identification Successful Missing Person ID Missing persons identification is driven by the Family Reference Samples Law enforcement is primary point of contact for families Strategy for sample collection is critical How do you know who to collect Understanding genetics of relationship Level of relatedness First Order Second Order Tertiary 1

2 First Order Relative A direct descendant or predecessor of Missing Person SPOUSE - Not a Biological Relative but Critical to evaluation Second Order Relative A direct descendant or predecessor of a First Order Relative Tertiary Relatives Mostly, cousins descendants of Second Order Relatives 2

3 What genetic technologies are used Primary sorting- Lineage Specific Markers These markers are used to associate DNA obtained from a set of unidentified remains to reference individuals along Maternal and Paternal lines INSIST that mtdna is run on your samples when appropriate!! Maternal Lineages Mitochondrial DNA (mtdna) is transferred along the Maternal line Paternal Lineages Y Chromosome markers are transferred along the Paternal line 3

4 Autosomal Markers The DNA most folks talk about diffuses as you move away from the source Target for collection First Order Priority 1!! Both parents of Missing Person One parent and two or more Siblings One parent, Spouse and one or more children of Missing Person One parent and one sibling (might throw in an aunt or uncle too) Two or more siblings Both parents of Missing Person ab cd ac This is a slam dunk! One type from Mom and one from Dad must match the remains at every marker tested mtdna from Mom Y STR from Dad 4

5 One parent and Siblings ab cd bd ac ac One type from Mom must match the remains at every marker tested and so does mtdna A brother will share the Y STR type from Dad With Mom and the sibs we may possibly reconstruct what Dad might have been. One parent, spouse and children ab ab a/b ac de ce cd One type from Mom must match the remains at every marker tested and so does mtdna A son will share the father s Y STR type With Mom and the kids we may possibly reconstruct what Dad must have. One parent, one sibling and Uncle One type from Mom must match the remains at every marker tested and so does mtdna An Uncle will share the Y STR type from Dad Sister may share types with Missing Person and will identify one type from Dad Uncle may help here too maybe 5

6 What about siblings Siblings will share the mother s mtdna Brothers will share the fathers Y STR type Siblings generally share some autosomal markers but they don t have to! Enough siblings could reconstruct the parents IF they are Full Siblings! What about siblings who are not Reality some folks just don t know Test Brothers for shared Y STR type Test Siblings for shared mtdna type Known Half-siblings are helpful with the lineage specific markers but worthless with the autosomal markers So, what is needed Target First Order Relatives Need minimum of 2, better yet 3 family reference samples Represent both Maternal and Paternal Lineages Don t bother with distant relative except for a lineage specific markers Don t bother with direct samples i.e toothbrush, combs, underwear, etc 6

7 What s wrong with the direct samples Largely unreliable Must be proofed out with family reference samples Many result in DNA mixtures True Known samples: Guthrie Card, tissue biopsy, Military DNA repository sample card Identifications can be made if the right samples go into the database nothing happens if they don t! Now we will look at what you get back when an association is made for one of your cases and what it means. Each case is unique! Many scenarios can exist, and in each case the assumptions being made should be clearly stated. Lets look at a simple one: Scenario: Reference samples available from a mother and son of a missing person. Bones of a male are submitted as unidentified remains. 7

8 Reference Samples Unidentified Remains Metadata: Anthropology Sex Dental What can unite these cases Reference Samples = Unidentified Remains mtdna Reference Samples Unidentified Remains = Y STRs 8

9 Reference Samples P D Unidentified Remains B C Autosomal STRs Hypotheses: H o : The remains are from the missing person H a : The remains are unrelated to pedigree Hypotheses: H o : The remains are from the missing person H a : The remains are unrelated to pedigree These hypotheses allow for additional statistical understanding: we can calculate a probability associated with each hypothesis since the genetic markers are quantitative markers we won t bore you with the math When we look at these two hypotheses one may be more strongly supported than the other based on the data obtained in the case. All we really do at this point is compare the probabilities associated with each hypothesis and see which is favored. Or which scenario is more Likely. 9

10 For something like our example we might have the following conclusion: Given the genetic data and scenario proposed, it is approximately 10 times more likely to observe these results if the remains originated from the missing individual rather than the remains representing an individual unrelated to the pedigree examined. If we included the mtdna and Y STR data it would increase the likelihood substantially since in most cases these haplotypes have very small frequencies in the population. If we include all 13 STR markers we routinely test, the likelihood also increases substantially. But if we add another relative. quantum leaps at all levels For our example Pedigree M, C 1 10 Kinship Index M, S, C 1 20 M, S, C 1, C 2 40 M, S, C 1, C 2 20 The KI has a range of >0 to infinity So what is meaningful 10

11 So what is meaningful Comparison of UHR to a single sibling KI~0.8 Same UHR to both parents KI~385 Billion Same UHR to a direct blood sample ~ 43 Trillion Comparison of UHR to a mother & sibling KI~10K Same samples with mtdna KI~0 excluded! UHR to two siblings (13 STRs) KI~105 UHR to two siblings ( 6 STRs) KI~10,200 While the success and statistical relevance rests with how good a pedigree you have to compare to, the remains sample is still the limiting factor. We have good 2 lineage specific markers CODIS STRs have limited it statistical ti ti strength mtdna works extremely well on compromised samples insist that it is done!! Better markers are on the horizon When a lab sends out a report on a putative association, they put the ball in your court! Call them if you have questions Let them know if other relatives are available Let them know if an ID is rendered Let them know if a suspect is developed! They do care! 11

Non-Paternity: Implications and Resolution

Non-Paternity: Implications and Resolution Non-Paternity: Implications and Resolution Michelle Beckwith PTC Labs 2006 AABB HITA Meeting October 8, 2006 Considerations when identifying victims using relatives Identification requires knowledge of

More information

Free Online Training

Free Online Training Using DNA and CODIS to Resolve Missing and Unidentified Person Cases B.J. Spamer NamUs Training and Analysis Division Office: 817-735-5473 Cell: 817-964-1879 Email: BJ.Spamer@unthsc.edu Free Online Training

More information

Pizza and Who do you think you are?

Pizza and Who do you think you are? Pizza and Who do you think you are? an overview of one of the newest and possibly more helpful developments in researching genealogy and family history that of using DNA for research What is DNA? Part

More information

1/8/2013. Free Online Training. Using DNA and CODIS to Resolve Missing and Unidentified Person Cases. Click Online Training

1/8/2013. Free Online Training. Using DNA and CODIS to Resolve Missing and Unidentified Person Cases.  Click Online Training Free Online Training Using DNA and CODIS to Resolve Missing and Unidentified Person Cases B.J. Spamer NamUs Training and Analysis Division Office: 817-735-5473 Cell: 817-964-1879 Email: BJ.Spamer@unthsc.edu

More information

Large scale kinship:familial Searching and DVI. Seoul, ISFG workshop

Large scale kinship:familial Searching and DVI. Seoul, ISFG workshop Large scale kinship:familial Searching and DVI Seoul, ISFG workshop 29 August 2017 Large scale kinship Familial Searching: search for a relative of an unidentified offender whose profile is available in

More information

DNA Testing What you need to know first

DNA Testing What you need to know first DNA Testing What you need to know first This article is like the Cliff Notes version of several genetic genealogy classes. It is a basic general primer. The general areas include Project support DNA test

More information

AFDAA 2012 WINTER MEETING Population Statistics Refresher Course - Lecture 3: Statistics of Kinship Analysis

AFDAA 2012 WINTER MEETING Population Statistics Refresher Course - Lecture 3: Statistics of Kinship Analysis AFDAA 2012 WINTER MEETING Population Statistics Refresher Course - Lecture 3: Statistics of Kinship Analysis Ranajit Chakraborty, PhD Center for Computational Genomics Institute of Applied Genetics Department

More information

Popstats Parentage Statistics Strength of Genetic Evidence In Parentage Testing

Popstats Parentage Statistics Strength of Genetic Evidence In Parentage Testing Popstats Parentage Statistics Strength of Genetic Evidence In Parentage Testing Arthur J. Eisenberg, Ph.D. Director DNA Identity Laboratory UNT-Health Science Center eisenber@hsc.unt.edu PATERNITY TESTING

More information

ICMP DNA REPORTS GUIDE

ICMP DNA REPORTS GUIDE ICMP DNA REPORTS GUIDE Distribution: General Sarajevo, 16 th December 2010 GUIDE TO ICMP DNA REPORTS 1. Purpose of This Document 1. The International Commission on Missing Persons (ICMP) endeavors to secure

More information

DNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding

DNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding DNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding by Dr. Ing. Robert L. Baber 2014 July 26 Rights reserved, see the copyright notice at http://gengen.rlbaber.de

More information

Autosomal-DNA. How does the nature of Jewish genealogy make autosomal DNA research more challenging?

Autosomal-DNA. How does the nature of Jewish genealogy make autosomal DNA research more challenging? Autosomal-DNA How does the nature of Jewish genealogy make autosomal DNA research more challenging? Using Family Finder results for genealogy is more challenging for individuals of Jewish ancestry because

More information

Find JCD Project Date: Identification-DNA Process Updated:

Find JCD Project Date: Identification-DNA Process Updated: New Look Investigations Created by: Jack Friess Find JCD Project Date: 04-20-2018 Identification-DNA Process Updated: 05-24-2018 Questions and Answers Identification-DNA (ID-DNA) is a scientific process

More information

THE BASICS OF DNA TESTING. By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library

THE BASICS OF DNA TESTING. By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library THE BASICS OF DNA TESTING By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library TYPES OF TESTS Mitochondrial DNA (mtdna/mdna) Y-DNA Autosomal DNA (atdna/audna) MITOCHONDRIAL DNA Found

More information

[CLIENT] SmithDNA1701 DE January 2017

[CLIENT] SmithDNA1701 DE January 2017 [CLIENT] SmithDNA1701 DE1704205 11 January 2017 DNA Discovery Plan GOAL Create a research plan to determine how the client s DNA results relate to his family tree as currently constructed. The client s

More information

Your mtdna Full Sequence Results

Your mtdna Full Sequence Results Congratulations! You are one of the first to have your entire mitochondrial DNA (DNA) sequenced! Testing the full sequence has already become the standard practice used by researchers studying the DNA,

More information

DNA Opening Doors for Today s s Genealogist

DNA Opening Doors for Today s s Genealogist DNA Opening Doors for Today s s Genealogist Presented to JGSI Sunday, March 30, 2008 Presented by Alvin Holtzman Genetic Genealogy Discussion Points What is DNA How can it help genealogists What to expect

More information

Autosomal DNA. What is autosomal DNA? X-DNA

Autosomal DNA. What is autosomal DNA? X-DNA ANGIE BUSH AND PAUL WOODBURY info@thednadetectives.com November 1, 2014 Autosomal DNA What is autosomal DNA? Autosomal DNA consists of all nuclear DNA except for the X and Y sex chromosomes. There are

More information

What Can I Learn From DNA Testing?

What Can I Learn From DNA Testing? What Can I Learn From DNA Testing? From where did my ancestors migrate? What is my DNA Signature? Was my ancestor a Jewish Cohanim Priest? Was my great great grandmother really an Indian Princes? I was

More information

TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter

TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter 1-1: DNA: WHERE DO I START? Definition Genetic genealogy is the application of genetics to traditional genealogy. Genetic genealogy uses genealogical

More information

DAR POLICY STATEMENT AND BACKGROUND Using DNA Evidence for DAR Applications

DAR POLICY STATEMENT AND BACKGROUND Using DNA Evidence for DAR Applications Effective January 1, 2014, DAR will begin accepting Y-DNA evidence in support of new member applications and supplemental applications as one element in a structured analysis. This analysis will use a

More information

4. Kinship Paper Challenge

4. Kinship Paper Challenge 4. António Amorim (aamorim@ipatimup.pt) Nádia Pinto (npinto@ipatimup.pt) 4.1 Approach After a woman dies her child claims for a paternity test of the man who is supposed to be his father. The test is carried

More information

FAMILY HISTORY QUESTIONNAIRE

FAMILY HISTORY QUESTIONNAIRE FAMILY HISTORY QUESTIONNAIRE This form helps us to evaluate if you might have a higher risk of cancer because of your family history. Please complete this form to the best of your ability. If you are unsure

More information

DNA Basics. OLLI: Genealogy 101 October 1, ~ Monique E. Rivera ~

DNA Basics. OLLI: Genealogy 101 October 1, ~ Monique E. Rivera ~ DNA Basics OLLI: Genealogy 101 October 1, 2018 ~ Monique E. Rivera ~ WHAT IS DNA? DNA (deoxyribonucleic acid) is found in every living cell everywhere. It is a long chemical chain that tells our cells

More information

Ewing Surname Y-DNA Project Article 8

Ewing Surname Y-DNA Project Article 8 Ewing Surname Y-DNA Project Article 8 This is the eighth in a series of articles about the Ewing Surname Y-DNA Project. The previous seven articles have appeared in the last seven issues of the Journal

More information

Methods of Parentage Analysis in Natural Populations

Methods of Parentage Analysis in Natural Populations Methods of Parentage Analysis in Natural Populations Using molecular markers, estimates of genetic maternity or paternity can be achieved by excluding as parents all adults whose genotypes are incompatible

More information

have to get on the phone or family members for the names of more distant relatives.

have to get on the phone or  family members for the names of more distant relatives. Ideas for Teachers: Give each student the family tree worksheet to fill out at home. Explain to them that each family is different and this worksheet is meant to help them plan their family tree. They

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/1122655/dc1 Supporting Online Material for Finding Criminals Through DNA of Their Relatives Frederick R. Bieber,* Charles H. Brenner, David Lazer *Author for correspondence.

More information

GEDmatch Home Page The upper left corner of your home page has Information about you and links to lots of helpful information. Check them out!

GEDmatch Home Page The upper left corner of your home page has Information about you and links to lots of helpful information. Check them out! USING GEDMATCH Created March 2015 GEDmatch is a free, non-profit site that accepts raw autosomal data files from Ancestry, FTDNA, and 23andme. As such, it provides a large autosomal database that spans

More information

CAGGNI s DNA Special Interest Group

CAGGNI s DNA Special Interest Group CAGGNI s DNA Special Interest Group 10 Jan 2015 Al & Michelle Wilson Agenda Survey Basics in Fan Charts Recombination Exercise Triangulation Overview Survey 1. Have you taken (or sponsored) a DNA test?

More information

1) Using the sightings data, determine who moved from one area to another and fill this data in on the data sheet.

1) Using the sightings data, determine who moved from one area to another and fill this data in on the data sheet. Parentage and Geography 5. The Life of Lulu the Lioness: A Heroine s Story Name: Objective Using genotypes from many individuals, determine maternity, paternity, and relatedness among a group of lions.

More information

Introduction to Autosomal DNA Tools

Introduction to Autosomal DNA Tools GENETIC GENEALOGY JOURNEY Debbie Parker Wayne, CG, CGL Introduction to Autosomal DNA Tools Just as in the old joke about a new genealogist walking into the library and asking for the book that covers my

More information

Halley Family. Mystery? Mystery? Can you solve a. Can you help solve a

Halley Family. Mystery? Mystery? Can you solve a. Can you help solve a Can you solve a Can you help solve a Halley Halley Family Family Mystery? Mystery? Who was the great grandfather of John Bennett Halley? He lived in Maryland around 1797 and might have been born there.

More information

DNA Testing. February 16, 2018

DNA Testing. February 16, 2018 DNA Testing February 16, 2018 What Is DNA? Double helix ladder structure where the rungs are molecules called nucleotides or bases. DNA contains only four of these nucleotides A, G, C, T The sequence that

More information

A Day Out With Your DNA

A Day Out With Your DNA A Day Out With Your DNA Diahan Southard www.yourdnaguide.com Your testing company has evaluated around 800,000 locations on your DNA to help them determine your origins and your genetic cousins. While

More information

Using Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM

Using Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM Using Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.

More information

DNA Parentage Test No Summary Report

DNA Parentage Test No Summary Report Collaborative Testing Services, Inc FORENSIC TESTING PROGRAM DNA Parentage Test No. 165871 Summary Report This proficiency test was sent to 45 participants. Each participant received a sample pack consisting

More information

Genealogical Research

Genealogical Research DNA, Ancestry, and Your Genealogical Research Walter Steets Houston Genealogical Forum DNA Interest Group March 2, 2019 1 Today s Agenda Brief review of basic genetics and terms used in genetic genealogy

More information

Detection of Misspecified Relationships in Inbred and Outbred Pedigrees

Detection of Misspecified Relationships in Inbred and Outbred Pedigrees Detection of Misspecified Relationships in Inbred and Outbred Pedigrees Lei Sun 1, Mark Abney 1,2, Mary Sara McPeek 1,2 1 Department of Statistics, 2 Department of Human Genetics, University of Chicago,

More information

Walter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018

Walter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018 DNA, Ancestry, and Your Genealogical Research- Segments and centimorgans Walter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018 1 Today s agenda Brief review of previous DIG session

More information

DNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016

DNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016 DNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016 1 What we will cover How testing helps genealogy What is DNA? How do you select from the three testing companies?

More information

Your Family 101 Beginning Genealogical Research

Your Family 101 Beginning Genealogical Research Your Family 101 Beginning Genealogical Research What Will We Cover Today? Session 1: Getting Started Session 2: Your Resources Session 3: Common Mistakes and Pitfalls Session 4: DNA Testing and Medical

More information

IN THIS ISSUE: February From the Administrator Questions/News...1. George Varner of Missouri Direct Line...2

IN THIS ISSUE: February From the Administrator Questions/News...1. George Varner of Missouri Direct Line...2 IN THIS ISSUE: From the Administrator..... 1 Questions/News.......1 George Varner of Missouri Direct Line...2 Do the Newtons & Varners Really Both have Riggs DNA?...2 2016 Newton/Varner Reunion. 5 February

More information

Princess Margaret Cancer Centre Familial Breast and Ovarian Cancer Clinic. Family History Questionnaire

Princess Margaret Cancer Centre Familial Breast and Ovarian Cancer Clinic. Family History Questionnaire Princess Margaret Cancer Centre Familial Breast and Ovarian Cancer Clinic Family History Questionnaire How to complete this questionnaire The information in this questionnaire will be used to determine

More information

An Introduction. Your DNA. and Your Family Tree. (Mitochondrial DNA) Presentation by: 4/8/17 Page 1 of 10

An Introduction. Your DNA. and Your Family Tree. (Mitochondrial DNA) Presentation by: 4/8/17 Page 1 of 10 An Introduction Your DNA and Your Family Tree (Mitochondrial DNA) Presentation by: FredCoffey@aol.com 4/8/17 Page 1 of 10 Coffey Surname, y-dna Project We're now ready to move on and look at the type of

More information

DNA Parentage Test No Summary Report

DNA Parentage Test No Summary Report Collaborative Testing Services, Inc FORENSIC TESTING PROGRAM DNA Parentage Test No. 16-5870 Summary Report This proficiency test was sent to 27 participants. Each participant received a sample pack consisting

More information

Genesis and Genetics Matthew Price

Genesis and Genetics Matthew Price Genesis and Genetics Matthew Price Apologetics and Creation Camp 16 June 2018 Karakariki Christian Camp, Waikato, NZ 1 What is Science? 2 What is Science? Hypothesis Theory Start with a hypothesis; a reasonable

More information

DNA and Ancestry. An Update on New Tests. Steve Louis. Jewish Genealogical Society of Washington State. January 13, 2014

DNA and Ancestry. An Update on New Tests. Steve Louis. Jewish Genealogical Society of Washington State. January 13, 2014 DNA and Ancestry An Update on New Tests Steve Louis Jewish Genealogical Society of Washington State January 13, 2014 DISCLAIMER This document was prepared as a result of independent work and opinions of

More information

DNA PATERNITY TESTING YOUR QUESTIONS ANSWERED. Need some advice on testing? Call us free on:

DNA PATERNITY TESTING YOUR QUESTIONS ANSWERED. Need some advice on testing? Call us free on: DNA PATERNITY TESTING YOUR QUESTIONS ANSWERED Need some advice on testing? Call us free on: 0800 036 2522 Introduction Since 1987 Cellmark has conducted over half a million DNA relationship tests and is

More information

Pedigree Charts. The family tree of genetics

Pedigree Charts. The family tree of genetics Pedigree Charts The family tree of genetics Pedigree Charts I II III What is a Pedigree? A pedigree is a chart of the genetic history of family over several generations. Scientists or a genetic counselor

More information

Using X-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM

Using X-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM Using X-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.

More information

Determining Relatedness from a Pedigree Diagram

Determining Relatedness from a Pedigree Diagram Kin structure & relatedness Francis L. W. Ratnieks Aims & Objectives Aims 1. To show how to determine regression relatedness among individuals using a pedigree diagram. Social Insects: C1139 2. To show

More information

Chapter 2: Genes in Pedigrees

Chapter 2: Genes in Pedigrees Chapter 2: Genes in Pedigrees Chapter 2-0 2.1 Pedigree definitions and terminology 2-1 2.2 Gene identity by descent (ibd) 2-5 2.3 ibd of more than 2 genes 2-14 2.4 Data on relatives 2-21 2.1.1 GRAPHICAL

More information

! FTDNA! Ancestry. ! 23andMe. ! Medical Considera,ons. ! Iden,fying family medical history. ! Communica,ng with the medical community

! FTDNA! Ancestry. ! 23andMe. ! Medical Considera,ons. ! Iden,fying family medical history. ! Communica,ng with the medical community by JEFF CARPENTER! Brief Defini,ons about YDNA, XDNA, mtdna, atdna (Covered in Part 1)! Benefits of Tes,ng DNA! Examples of DNA TESTING! FTDNA! Ancestry! 3andMe Jeff Carpenter, 016 jeffcarpenter1939@gmal.com!

More information

DNA: Statistical Guidelines

DNA: Statistical Guidelines Frequency calculations for STR analysis When a probative association between an evidence profile and a reference profile is made, a frequency estimate is calculated to give weight to the association. Frequency

More information

Y-DNA Genetic Testing

Y-DNA Genetic Testing Y-DNA Genetic Testing 50 2/24/14 Y-DNA Genetic Testing Y-DNA flows from fathers to sons intact SNPs define Y-DNA haplogroups Haplogroups (clans) migrated together Timeframe between mutations is 2,000 to

More information

Using Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM

Using Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM Using Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.

More information

Chromosome X haplotyping in deficiency paternity testing principles and case report

Chromosome X haplotyping in deficiency paternity testing principles and case report International Congress Series 1239 (2003) 815 820 Chromosome X haplotyping in deficiency paternity testing principles and case report R. Szibor a, *, I. Plate a, J. Edelmann b, S. Hering c, E. Kuhlisch

More information

Getting the Most Out of Your DNA Matches

Getting the Most Out of Your DNA Matches Helen V. Smith PG Dip Public Health, BMedLabSci, ADCLT, Dip. Fam. Hist. PLCGS 46 Kraft Road, Pallara, Qld, 4110 Email: HVSresearch@DragonGenealogy.com Website: www.dragongenealogy.com Blog: http://www.dragongenealogy.com/blog/

More information

DNA for Genealogy Librarians. Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District

DNA for Genealogy Librarians. Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District DNA for Genealogy Librarians Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District What does DNA do? It replicates itself. It codes for the production

More information

Finally, should you have any questions, queries or issues with regard to the service our company provides, us at

Finally, should you have any questions, queries or issues with regard to the service our company provides,  us at Dear Sir / Madam, To complete the enclosed registration form, please follow the procedure below: 1. Choose a sampler. To comply with current legislation, samples must be taken by a medically qualified

More information

Need a little help with the lab?

Need a little help with the lab? Need a little help with the lab? Alleles are corresponding pairs of genes located on an individual s chromosomes. Together, alleles determine the genotype of an individual. The Genotype describes the specific

More information

Lecture 1: Introduction to pedigree analysis

Lecture 1: Introduction to pedigree analysis Lecture 1: Introduction to pedigree analysis Magnus Dehli Vigeland NORBIS course, 8 th 12 th of January 2018, Oslo Outline Part I: Brief introductions Pedigrees symbols and terminology Some common relationships

More information

Family Tree DNA Genetic Genealogy Started Here

Family Tree DNA Genetic Genealogy Started Here Family Tree DNA Genetic Genealogy Started Here With 253,000 samples in our DNA database (the largest of its kind in the world) your genealogical search could become even easier Why Bennett Greenspan founded

More information

Statistical Interpretation in Making DNA-based Identification of Mass Victims

Statistical Interpretation in Making DNA-based Identification of Mass Victims Statistical Interretation in Making DNAbased Identification of Mass Victims KyoungJin Shin wan Young Lee Woo Ick Yang Eunho a Det. of Forensic Medicine Yonsei University College of Medicine Det. of Information

More information

Manual for Familias 3

Manual for Familias 3 Manual for Familias 3 Daniel Kling 1 (daniellkling@gmailcom) Petter F Mostad 2 (mostad@chalmersse) ThoreEgeland 1,3 (thoreegeland@nmbuno) 1 Oslo University Hospital Department of Forensic Services Oslo,

More information

The Snohomish Tribe of Indians Application for Enrollment

The Snohomish Tribe of Indians Application for Enrollment The Snohomish Tribe of Indians Application for Enrollment DATE APPLIED Enrollment # Enrollment For Office Use Only NAME (First, Middle, Last)* Maiden of Birth Current Mailing Address Copy of State Issued

More information

Finding a Male Hodge(s) Descendant for Y-Chromosome DNA Testing. Prepared by Jan Alpert

Finding a Male Hodge(s) Descendant for Y-Chromosome DNA Testing. Prepared by Jan Alpert Finding a Male Hodge(s) Descendant for Y-Chromosome DNA Testing Prepared by Jan Alpert Why Test Male Y-Chromosome DNA All males carry the Y-Chromosome of their fathers As a result the same DNA markers

More information

Genetic Identity and

Genetic Identity and Genetic Identity and GACATGTAGCTCTTCACTTCACCCAGGTTGGGTTGTGTCAACAGGAAACATTGTAACATATCACTTGGATTAGCACCTAGG/TTAT/TTAT/TTA Community DTC Genetic Testing Workshop The National Academies' August 31 September 1,

More information

Genetic Genealogy. Rules and Tools. Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter

Genetic Genealogy. Rules and Tools. Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter Genetic Genealogy Rules and Tools Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter I am NOT this guy! 2 Genealogy s Newest Tool Genealogy research: Study of Family History Identifies

More information

DNA: UNLOCKING THE CODE

DNA: UNLOCKING THE CODE DNA: UNLOCKING THE CODE Connecting Cousins for Genetic Genealogy Bryant McAllister, PhD Associate Professor of Biology University of Iowa bryant-mcallister@uiowa.edu Iowa Genealogical Society April 9,

More information

WINSLOW HERITAGE SOCIETY ~~~~~~~~~~~~~~~~~~

WINSLOW HERITAGE SOCIETY ~~~~~~~~~~~~~~~~~~ Newsletter, Vol. 2, No. 1 March, 2015 WINSLOW HERITAGE SOCIETY ~~~~~~~~~~~~~~~~~~ In Vol. 1, No. 1 of the Winslow Heritage Society Newsletter, Kathy Myers, Society Governor, a descendant of Kenelm Winslow,

More information

DNA Solu)ons for Brick Walls And Adop)on

DNA Solu)ons for Brick Walls And Adop)on DNA Solu)ons for Brick Walls And Adop)on "I have not failed. I've just found ten thousand ways that won't work." Thomas Edison Wise Woman Gene+c Genealogy Comments Listen Carefully! 1. DNA is not the be

More information

50/50. Accreditations 4/13/2016 A B A B A B. Mother. Father. Child. Everything you ever wanted to know about DNA collections and MORE!

50/50. Accreditations 4/13/2016 A B A B A B. Mother. Father. Child. Everything you ever wanted to know about DNA collections and MORE! Everything you ever wanted to know about DNA collections and MORE! Presented by: Kim Levaggi Accreditations 1 50/50 Half of your DNA comes from your mother Half of your DNA comes from your father Mother

More information

4/13/2016. Everything you ever wanted to know about DNA collections and MORE! Presented by: Kim Levaggi

4/13/2016. Everything you ever wanted to know about DNA collections and MORE! Presented by: Kim Levaggi Everything you ever wanted to know about DNA collections and MORE! Presented by: Kim Levaggi 1 Accreditations 1 2 50/50 Half of your DNA comes from your mother Half of your DNA comes from your father Mother

More information

APPLICATION FOR ENROLLMENT

APPLICATION FOR ENROLLMENT CTGR-9615 Grand Ronde Rd.; Grand Ronde OR 97347 1-800-422-0232 ext.2253 APPLICATION FOR ENROLLMENT Name: First Middle Last Maiden Gender Female. Male Date of Birth Social security Number Address: Mailing

More information

University of Washington, TOPMed DCC July 2018

University of Washington, TOPMed DCC July 2018 Module 12: Comput l Pipeline for WGS Relatedness Inference from Genetic Data Timothy Thornton (tathornt@uw.edu) & Stephanie Gogarten (sdmorris@uw.edu) University of Washington, TOPMed DCC July 2018 1 /

More information

DNA (DeoxyriboNucleic Acid)

DNA (DeoxyriboNucleic Acid) Basics of DNA & Sales and Marketing Presented by: Kim Levaggi of Chromosomal Labs DNA (DeoxyriboNucleic Acid) DNA a very long molecule that is essentially the instruction manual to cells and organisms.

More information

Investigations from last time. Inbreeding and neutral evolution Genes, alleles and heterozygosity

Investigations from last time. Inbreeding and neutral evolution Genes, alleles and heterozygosity Investigations from last time. Heterozygous advantage: See what happens if you set initial allele frequency to or 0. What happens and why? Why are these scenario called unstable equilibria? Heterozygous

More information

Basics of DNA & Sales and Marketing

Basics of DNA & Sales and Marketing Basics of DNA & Sales and Marketing Presented by: Kim Levaggi of Chromosomal Labs 1 DNA (DeoxyriboNucleic Acid) DNA a very long molecule that is essentially the instruction manual to cells and organisms.

More information

BETTER TOGETHER: MAKING YOUR CASE WITH DOCUMENTS AND DNA BCG-sponsored Webinar (https://bcgcertification.org) Patricia Lee Hobbs, CG

BETTER TOGETHER: MAKING YOUR CASE WITH DOCUMENTS AND DNA BCG-sponsored Webinar (https://bcgcertification.org) Patricia Lee Hobbs, CG BETTER TOGETHER: MAKING YOUR CASE WITH DOCUMENTS AND DNA BCG-sponsored Webinar (https://bcgcertification.org) Patricia Lee Hobbs, CG LIMITATIONS & BENEFITS OF DNA TESTING DNA test results do not solve

More information

DNA Parentage Test No Summary Report

DNA Parentage Test No Summary Report Collaborative Testing Services, Inc FORENSIC TESTING PROGRAM DNA Parentage Test No. 175871 Summary Report This proficiency test was sent to 45 participants. Each participant received a sample pack consisting

More information

Genetic Research in Utah

Genetic Research in Utah Genetic Research in Utah Lisa Cannon Albright, PhD Professor, Program Leader Genetic Epidemiology Department of Internal Medicine University of Utah School of Medicine George E. Wahlen Department of Veterans

More information

Advanced Autosomal DNA Techniques used in Genetic Genealogy

Advanced Autosomal DNA Techniques used in Genetic Genealogy Advanced Autosomal DNA Techniques used in Genetic Genealogy Tim Janzen, MD E-mail: tjanzen@comcast.net Summary of Chromosome Mapping Technique The following are specific instructions on how to map your

More information

Pedigree Reconstruction using Identity by Descent

Pedigree Reconstruction using Identity by Descent Pedigree Reconstruction using Identity by Descent Bonnie Kirkpatrick Electrical Engineering and Computer Sciences University of California at Berkeley Technical Report No. UCB/EECS-2010-43 http://www.eecs.berkeley.edu/pubs/techrpts/2010/eecs-2010-43.html

More information

(This fireside was presented with a powerpoint presentation. The speaker refers many times to images in the powerpoint.)

(This fireside was presented with a powerpoint presentation. The speaker refers many times to images in the powerpoint.) DNA meets PAF BYU Family History Fireside - Joseph Smith Building November 9, 2001 (This fireside was presented with a powerpoint presentation. The speaker refers many times to images in the powerpoint.)

More information

Steve Harding, *Turi King and *Mark Jobling Universities of Nottingham & *Leicester, UK

Steve Harding, *Turi King and *Mark Jobling Universities of Nottingham & *Leicester, UK Viking DNA Steve Harding, *Turi King and *Mark Jobling Universities of Nottingham & *Leicester, UK Viking DNA in Northern England Project Part 1 - Wirral and West Lancashire (2002-2007) Part 2 - North

More information

An Introduction to Genetic Genealogy

An Introduction to Genetic Genealogy An Introduction to Genetic Genealogy David A. Pike dapike@math.mun.ca Presented To: Family History Society of Newfoundland and Labrador 24 January 2006 Slide 1 of 21 Overview Genetic Genealogy using genetic

More information

Use of DNA information in family research information for IOWFHS members

Use of DNA information in family research information for IOWFHS members Use of DNA information in family research information for IOWFHS members What is DNA? Since the discovery of deoxyribonucleic acid (DNA) in the 1950s, we have come to understand more about its role as

More information

Two-point linkage analysis using the LINKAGE/FASTLINK programs

Two-point linkage analysis using the LINKAGE/FASTLINK programs 1 Two-point linkage analysis using the LINKAGE/FASTLINK programs Copyrighted 2018 Maria Chahrour and Suzanne M. Leal These exercises will introduce the LINKAGE file format which is the standard format

More information

On identification problems requiring linked autosomal markers

On identification problems requiring linked autosomal markers * Title Page (with authors & addresses) On identification problems requiring linked autosomal markers Thore Egeland a Nuala Sheehan b a Department of Medical Genetics, Ulleval University Hospital, 0407

More information

Pedigrees How do scientists trace hereditary diseases through a family history?

Pedigrees How do scientists trace hereditary diseases through a family history? Why? Pedigrees How do scientists trace hereditary diseases through a family history? Imagine you want to learn about an inherited genetic trait present in your family. How would you find out the chances

More information

Statistical methods in genetic relatedness and pedigree analysis

Statistical methods in genetic relatedness and pedigree analysis Statistical methods in genetic relatedness and pedigree analysis Oslo, January 2018 Magnus Dehli Vigeland and Thore Egeland Exercise set III: Coecients of pairwise relatedness Exercise III-1. Use Wright's

More information

Growing the Family Tree: The Power of DNA in Reconstructing Family Relationships

Growing the Family Tree: The Power of DNA in Reconstructing Family Relationships Growing the Family Tree: The Power of DNA in Reconstructing Family Relationships Luke A. D. Hutchison Natalie M. Myres Scott R. Woodward Sorenson Molecular Genealogy Foundation (www.smgf.org) 2511 South

More information

The Meek Family of Allegheny Co., PA Meek Group A Introduction

The Meek Family of Allegheny Co., PA Meek Group A Introduction Meek Group A Introduction In the 1770's a significant number of families named Meek(s) lived in S. W. Pennsylvania and they can be identified in the records of Westmoreland, Allegheny and Washington Counties.

More information

The Structure of DNA Let s take a closer look at how this looks under a microscope.

The Structure of DNA Let s take a closer look at how this looks under a microscope. DNA Basics Adapted from a MyHeritage Blog and the International Society of Genetic Genealogy (ISOGG) Wiki by Earl Cory MyHeritage has started a series to explain DNA, how it works and answer the most common

More information

Contributed by "Kathy Hallett"

Contributed by Kathy Hallett National Geographic: The Genographic Project Name Background The National Geographic Society is undertaking the ambitious process of tracking human migration using genetic technology. By using the latest

More information

Visual Phasing of Chromosome 1

Visual Phasing of Chromosome 1 Visual Phasing of Chromosome 1 If you have the possibility to test three full siblings, then the next great thing you could do with your DNA, is to try out the Visual Phasing technique developed by Kathy

More information

Not To Be Quoted or Cited Without Permission of the Author 6/01/03 THE CONCEPT OF THE FAMILY: DEMOGRAPHIC AND GENEALOGICAL PERSPECTIVES

Not To Be Quoted or Cited Without Permission of the Author 6/01/03 THE CONCEPT OF THE FAMILY: DEMOGRAPHIC AND GENEALOGICAL PERSPECTIVES Not To Be Quoted or Cited Without Permission of the Author 6/01/03 THE CONCEPT OF THE FAMILY: DEMOGRAPHIC AND GENEALOGICAL PERSPECTIVES Charles B. Nam Research Associate, Center for Demography and Population

More information

HEREDITARY CANCER FAMILY HISTORY QUESTIONNAIRE

HEREDITARY CANCER FAMILY HISTORY QUESTIONNAIRE Packet received: Appointment: HEREDITARY CANCER FAMILY HISTORY QUESTIONNAIRE Please complete this questionnaire. While this can take some time, a review of your family history will allow us to provide

More information

Genetic Genealogy Journey Why Is My Cousin Not on my DNA Match List? Debbie Parker Wayne, CG SM, CGL SM

Genetic Genealogy Journey Why Is My Cousin Not on my DNA Match List? Debbie Parker Wayne, CG SM, CGL SM Genetic Genealogy Journey Why Is My Cousin Not on my DNA Match List? Debbie Parker Wayne, CG SM, CGL SM The CSI television shows have conditioned us to expect exact DNA matches and lead us to think DNA

More information