Primer on Human Pedigree Analysis:
|
|
- Barnard Bertram Berry
- 6 years ago
- Views:
Transcription
1 Primer on Human Pedigree Analysis: Criteria for the selection and collection of appropriate Family Reference Samples John V. Planz. Ph.D. UNT Center for Human Identification Successful Missing Person ID Missing persons identification is driven by the Family Reference Samples Law enforcement is primary point of contact for families Strategy for sample collection is critical How do you know who to collect Understanding genetics of relationship Level of relatedness First Order Second Order Tertiary 1
2 First Order Relative A direct descendant or predecessor of Missing Person SPOUSE - Not a Biological Relative but Critical to evaluation Second Order Relative A direct descendant or predecessor of a First Order Relative Tertiary Relatives Mostly, cousins descendants of Second Order Relatives 2
3 What genetic technologies are used Primary sorting- Lineage Specific Markers These markers are used to associate DNA obtained from a set of unidentified remains to reference individuals along Maternal and Paternal lines INSIST that mtdna is run on your samples when appropriate!! Maternal Lineages Mitochondrial DNA (mtdna) is transferred along the Maternal line Paternal Lineages Y Chromosome markers are transferred along the Paternal line 3
4 Autosomal Markers The DNA most folks talk about diffuses as you move away from the source Target for collection First Order Priority 1!! Both parents of Missing Person One parent and two or more Siblings One parent, Spouse and one or more children of Missing Person One parent and one sibling (might throw in an aunt or uncle too) Two or more siblings Both parents of Missing Person ab cd ac This is a slam dunk! One type from Mom and one from Dad must match the remains at every marker tested mtdna from Mom Y STR from Dad 4
5 One parent and Siblings ab cd bd ac ac One type from Mom must match the remains at every marker tested and so does mtdna A brother will share the Y STR type from Dad With Mom and the sibs we may possibly reconstruct what Dad might have been. One parent, spouse and children ab ab a/b ac de ce cd One type from Mom must match the remains at every marker tested and so does mtdna A son will share the father s Y STR type With Mom and the kids we may possibly reconstruct what Dad must have. One parent, one sibling and Uncle One type from Mom must match the remains at every marker tested and so does mtdna An Uncle will share the Y STR type from Dad Sister may share types with Missing Person and will identify one type from Dad Uncle may help here too maybe 5
6 What about siblings Siblings will share the mother s mtdna Brothers will share the fathers Y STR type Siblings generally share some autosomal markers but they don t have to! Enough siblings could reconstruct the parents IF they are Full Siblings! What about siblings who are not Reality some folks just don t know Test Brothers for shared Y STR type Test Siblings for shared mtdna type Known Half-siblings are helpful with the lineage specific markers but worthless with the autosomal markers So, what is needed Target First Order Relatives Need minimum of 2, better yet 3 family reference samples Represent both Maternal and Paternal Lineages Don t bother with distant relative except for a lineage specific markers Don t bother with direct samples i.e toothbrush, combs, underwear, etc 6
7 What s wrong with the direct samples Largely unreliable Must be proofed out with family reference samples Many result in DNA mixtures True Known samples: Guthrie Card, tissue biopsy, Military DNA repository sample card Identifications can be made if the right samples go into the database nothing happens if they don t! Now we will look at what you get back when an association is made for one of your cases and what it means. Each case is unique! Many scenarios can exist, and in each case the assumptions being made should be clearly stated. Lets look at a simple one: Scenario: Reference samples available from a mother and son of a missing person. Bones of a male are submitted as unidentified remains. 7
8 Reference Samples Unidentified Remains Metadata: Anthropology Sex Dental What can unite these cases Reference Samples = Unidentified Remains mtdna Reference Samples Unidentified Remains = Y STRs 8
9 Reference Samples P D Unidentified Remains B C Autosomal STRs Hypotheses: H o : The remains are from the missing person H a : The remains are unrelated to pedigree Hypotheses: H o : The remains are from the missing person H a : The remains are unrelated to pedigree These hypotheses allow for additional statistical understanding: we can calculate a probability associated with each hypothesis since the genetic markers are quantitative markers we won t bore you with the math When we look at these two hypotheses one may be more strongly supported than the other based on the data obtained in the case. All we really do at this point is compare the probabilities associated with each hypothesis and see which is favored. Or which scenario is more Likely. 9
10 For something like our example we might have the following conclusion: Given the genetic data and scenario proposed, it is approximately 10 times more likely to observe these results if the remains originated from the missing individual rather than the remains representing an individual unrelated to the pedigree examined. If we included the mtdna and Y STR data it would increase the likelihood substantially since in most cases these haplotypes have very small frequencies in the population. If we include all 13 STR markers we routinely test, the likelihood also increases substantially. But if we add another relative. quantum leaps at all levels For our example Pedigree M, C 1 10 Kinship Index M, S, C 1 20 M, S, C 1, C 2 40 M, S, C 1, C 2 20 The KI has a range of >0 to infinity So what is meaningful 10
11 So what is meaningful Comparison of UHR to a single sibling KI~0.8 Same UHR to both parents KI~385 Billion Same UHR to a direct blood sample ~ 43 Trillion Comparison of UHR to a mother & sibling KI~10K Same samples with mtdna KI~0 excluded! UHR to two siblings (13 STRs) KI~105 UHR to two siblings ( 6 STRs) KI~10,200 While the success and statistical relevance rests with how good a pedigree you have to compare to, the remains sample is still the limiting factor. We have good 2 lineage specific markers CODIS STRs have limited it statistical ti ti strength mtdna works extremely well on compromised samples insist that it is done!! Better markers are on the horizon When a lab sends out a report on a putative association, they put the ball in your court! Call them if you have questions Let them know if other relatives are available Let them know if an ID is rendered Let them know if a suspect is developed! They do care! 11
Non-Paternity: Implications and Resolution
Non-Paternity: Implications and Resolution Michelle Beckwith PTC Labs 2006 AABB HITA Meeting October 8, 2006 Considerations when identifying victims using relatives Identification requires knowledge of
More informationFree Online Training
Using DNA and CODIS to Resolve Missing and Unidentified Person Cases B.J. Spamer NamUs Training and Analysis Division Office: 817-735-5473 Cell: 817-964-1879 Email: BJ.Spamer@unthsc.edu Free Online Training
More informationPizza and Who do you think you are?
Pizza and Who do you think you are? an overview of one of the newest and possibly more helpful developments in researching genealogy and family history that of using DNA for research What is DNA? Part
More information1/8/2013. Free Online Training. Using DNA and CODIS to Resolve Missing and Unidentified Person Cases. Click Online Training
Free Online Training Using DNA and CODIS to Resolve Missing and Unidentified Person Cases B.J. Spamer NamUs Training and Analysis Division Office: 817-735-5473 Cell: 817-964-1879 Email: BJ.Spamer@unthsc.edu
More informationLarge scale kinship:familial Searching and DVI. Seoul, ISFG workshop
Large scale kinship:familial Searching and DVI Seoul, ISFG workshop 29 August 2017 Large scale kinship Familial Searching: search for a relative of an unidentified offender whose profile is available in
More informationDNA Testing What you need to know first
DNA Testing What you need to know first This article is like the Cliff Notes version of several genetic genealogy classes. It is a basic general primer. The general areas include Project support DNA test
More informationAFDAA 2012 WINTER MEETING Population Statistics Refresher Course - Lecture 3: Statistics of Kinship Analysis
AFDAA 2012 WINTER MEETING Population Statistics Refresher Course - Lecture 3: Statistics of Kinship Analysis Ranajit Chakraborty, PhD Center for Computational Genomics Institute of Applied Genetics Department
More informationPopstats Parentage Statistics Strength of Genetic Evidence In Parentage Testing
Popstats Parentage Statistics Strength of Genetic Evidence In Parentage Testing Arthur J. Eisenberg, Ph.D. Director DNA Identity Laboratory UNT-Health Science Center eisenber@hsc.unt.edu PATERNITY TESTING
More informationICMP DNA REPORTS GUIDE
ICMP DNA REPORTS GUIDE Distribution: General Sarajevo, 16 th December 2010 GUIDE TO ICMP DNA REPORTS 1. Purpose of This Document 1. The International Commission on Missing Persons (ICMP) endeavors to secure
More informationDNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding
DNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding by Dr. Ing. Robert L. Baber 2014 July 26 Rights reserved, see the copyright notice at http://gengen.rlbaber.de
More informationAutosomal-DNA. How does the nature of Jewish genealogy make autosomal DNA research more challenging?
Autosomal-DNA How does the nature of Jewish genealogy make autosomal DNA research more challenging? Using Family Finder results for genealogy is more challenging for individuals of Jewish ancestry because
More informationFind JCD Project Date: Identification-DNA Process Updated:
New Look Investigations Created by: Jack Friess Find JCD Project Date: 04-20-2018 Identification-DNA Process Updated: 05-24-2018 Questions and Answers Identification-DNA (ID-DNA) is a scientific process
More informationTHE BASICS OF DNA TESTING. By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library
THE BASICS OF DNA TESTING By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library TYPES OF TESTS Mitochondrial DNA (mtdna/mdna) Y-DNA Autosomal DNA (atdna/audna) MITOCHONDRIAL DNA Found
More information[CLIENT] SmithDNA1701 DE January 2017
[CLIENT] SmithDNA1701 DE1704205 11 January 2017 DNA Discovery Plan GOAL Create a research plan to determine how the client s DNA results relate to his family tree as currently constructed. The client s
More informationYour mtdna Full Sequence Results
Congratulations! You are one of the first to have your entire mitochondrial DNA (DNA) sequenced! Testing the full sequence has already become the standard practice used by researchers studying the DNA,
More informationDNA Opening Doors for Today s s Genealogist
DNA Opening Doors for Today s s Genealogist Presented to JGSI Sunday, March 30, 2008 Presented by Alvin Holtzman Genetic Genealogy Discussion Points What is DNA How can it help genealogists What to expect
More informationAutosomal DNA. What is autosomal DNA? X-DNA
ANGIE BUSH AND PAUL WOODBURY info@thednadetectives.com November 1, 2014 Autosomal DNA What is autosomal DNA? Autosomal DNA consists of all nuclear DNA except for the X and Y sex chromosomes. There are
More informationWhat Can I Learn From DNA Testing?
What Can I Learn From DNA Testing? From where did my ancestors migrate? What is my DNA Signature? Was my ancestor a Jewish Cohanim Priest? Was my great great grandmother really an Indian Princes? I was
More informationTRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter
TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter 1-1: DNA: WHERE DO I START? Definition Genetic genealogy is the application of genetics to traditional genealogy. Genetic genealogy uses genealogical
More informationDAR POLICY STATEMENT AND BACKGROUND Using DNA Evidence for DAR Applications
Effective January 1, 2014, DAR will begin accepting Y-DNA evidence in support of new member applications and supplemental applications as one element in a structured analysis. This analysis will use a
More information4. Kinship Paper Challenge
4. António Amorim (aamorim@ipatimup.pt) Nádia Pinto (npinto@ipatimup.pt) 4.1 Approach After a woman dies her child claims for a paternity test of the man who is supposed to be his father. The test is carried
More informationFAMILY HISTORY QUESTIONNAIRE
FAMILY HISTORY QUESTIONNAIRE This form helps us to evaluate if you might have a higher risk of cancer because of your family history. Please complete this form to the best of your ability. If you are unsure
More informationDNA Basics. OLLI: Genealogy 101 October 1, ~ Monique E. Rivera ~
DNA Basics OLLI: Genealogy 101 October 1, 2018 ~ Monique E. Rivera ~ WHAT IS DNA? DNA (deoxyribonucleic acid) is found in every living cell everywhere. It is a long chemical chain that tells our cells
More informationEwing Surname Y-DNA Project Article 8
Ewing Surname Y-DNA Project Article 8 This is the eighth in a series of articles about the Ewing Surname Y-DNA Project. The previous seven articles have appeared in the last seven issues of the Journal
More informationMethods of Parentage Analysis in Natural Populations
Methods of Parentage Analysis in Natural Populations Using molecular markers, estimates of genetic maternity or paternity can be achieved by excluding as parents all adults whose genotypes are incompatible
More informationhave to get on the phone or family members for the names of more distant relatives.
Ideas for Teachers: Give each student the family tree worksheet to fill out at home. Explain to them that each family is different and this worksheet is meant to help them plan their family tree. They
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1122655/dc1 Supporting Online Material for Finding Criminals Through DNA of Their Relatives Frederick R. Bieber,* Charles H. Brenner, David Lazer *Author for correspondence.
More informationGEDmatch Home Page The upper left corner of your home page has Information about you and links to lots of helpful information. Check them out!
USING GEDMATCH Created March 2015 GEDmatch is a free, non-profit site that accepts raw autosomal data files from Ancestry, FTDNA, and 23andme. As such, it provides a large autosomal database that spans
More informationCAGGNI s DNA Special Interest Group
CAGGNI s DNA Special Interest Group 10 Jan 2015 Al & Michelle Wilson Agenda Survey Basics in Fan Charts Recombination Exercise Triangulation Overview Survey 1. Have you taken (or sponsored) a DNA test?
More information1) Using the sightings data, determine who moved from one area to another and fill this data in on the data sheet.
Parentage and Geography 5. The Life of Lulu the Lioness: A Heroine s Story Name: Objective Using genotypes from many individuals, determine maternity, paternity, and relatedness among a group of lions.
More informationIntroduction to Autosomal DNA Tools
GENETIC GENEALOGY JOURNEY Debbie Parker Wayne, CG, CGL Introduction to Autosomal DNA Tools Just as in the old joke about a new genealogist walking into the library and asking for the book that covers my
More informationHalley Family. Mystery? Mystery? Can you solve a. Can you help solve a
Can you solve a Can you help solve a Halley Halley Family Family Mystery? Mystery? Who was the great grandfather of John Bennett Halley? He lived in Maryland around 1797 and might have been born there.
More informationDNA Testing. February 16, 2018
DNA Testing February 16, 2018 What Is DNA? Double helix ladder structure where the rungs are molecules called nucleotides or bases. DNA contains only four of these nucleotides A, G, C, T The sequence that
More informationA Day Out With Your DNA
A Day Out With Your DNA Diahan Southard www.yourdnaguide.com Your testing company has evaluated around 800,000 locations on your DNA to help them determine your origins and your genetic cousins. While
More informationUsing Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM
Using Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.
More informationDNA Parentage Test No Summary Report
Collaborative Testing Services, Inc FORENSIC TESTING PROGRAM DNA Parentage Test No. 165871 Summary Report This proficiency test was sent to 45 participants. Each participant received a sample pack consisting
More informationGenealogical Research
DNA, Ancestry, and Your Genealogical Research Walter Steets Houston Genealogical Forum DNA Interest Group March 2, 2019 1 Today s Agenda Brief review of basic genetics and terms used in genetic genealogy
More informationDetection of Misspecified Relationships in Inbred and Outbred Pedigrees
Detection of Misspecified Relationships in Inbred and Outbred Pedigrees Lei Sun 1, Mark Abney 1,2, Mary Sara McPeek 1,2 1 Department of Statistics, 2 Department of Human Genetics, University of Chicago,
More informationWalter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018
DNA, Ancestry, and Your Genealogical Research- Segments and centimorgans Walter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018 1 Today s agenda Brief review of previous DIG session
More informationDNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016
DNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016 1 What we will cover How testing helps genealogy What is DNA? How do you select from the three testing companies?
More informationYour Family 101 Beginning Genealogical Research
Your Family 101 Beginning Genealogical Research What Will We Cover Today? Session 1: Getting Started Session 2: Your Resources Session 3: Common Mistakes and Pitfalls Session 4: DNA Testing and Medical
More informationIN THIS ISSUE: February From the Administrator Questions/News...1. George Varner of Missouri Direct Line...2
IN THIS ISSUE: From the Administrator..... 1 Questions/News.......1 George Varner of Missouri Direct Line...2 Do the Newtons & Varners Really Both have Riggs DNA?...2 2016 Newton/Varner Reunion. 5 February
More informationPrincess Margaret Cancer Centre Familial Breast and Ovarian Cancer Clinic. Family History Questionnaire
Princess Margaret Cancer Centre Familial Breast and Ovarian Cancer Clinic Family History Questionnaire How to complete this questionnaire The information in this questionnaire will be used to determine
More informationAn Introduction. Your DNA. and Your Family Tree. (Mitochondrial DNA) Presentation by: 4/8/17 Page 1 of 10
An Introduction Your DNA and Your Family Tree (Mitochondrial DNA) Presentation by: FredCoffey@aol.com 4/8/17 Page 1 of 10 Coffey Surname, y-dna Project We're now ready to move on and look at the type of
More informationDNA Parentage Test No Summary Report
Collaborative Testing Services, Inc FORENSIC TESTING PROGRAM DNA Parentage Test No. 16-5870 Summary Report This proficiency test was sent to 27 participants. Each participant received a sample pack consisting
More informationGenesis and Genetics Matthew Price
Genesis and Genetics Matthew Price Apologetics and Creation Camp 16 June 2018 Karakariki Christian Camp, Waikato, NZ 1 What is Science? 2 What is Science? Hypothesis Theory Start with a hypothesis; a reasonable
More informationDNA and Ancestry. An Update on New Tests. Steve Louis. Jewish Genealogical Society of Washington State. January 13, 2014
DNA and Ancestry An Update on New Tests Steve Louis Jewish Genealogical Society of Washington State January 13, 2014 DISCLAIMER This document was prepared as a result of independent work and opinions of
More informationDNA PATERNITY TESTING YOUR QUESTIONS ANSWERED. Need some advice on testing? Call us free on:
DNA PATERNITY TESTING YOUR QUESTIONS ANSWERED Need some advice on testing? Call us free on: 0800 036 2522 Introduction Since 1987 Cellmark has conducted over half a million DNA relationship tests and is
More informationPedigree Charts. The family tree of genetics
Pedigree Charts The family tree of genetics Pedigree Charts I II III What is a Pedigree? A pedigree is a chart of the genetic history of family over several generations. Scientists or a genetic counselor
More informationUsing X-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM
Using X-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.
More informationDetermining Relatedness from a Pedigree Diagram
Kin structure & relatedness Francis L. W. Ratnieks Aims & Objectives Aims 1. To show how to determine regression relatedness among individuals using a pedigree diagram. Social Insects: C1139 2. To show
More informationChapter 2: Genes in Pedigrees
Chapter 2: Genes in Pedigrees Chapter 2-0 2.1 Pedigree definitions and terminology 2-1 2.2 Gene identity by descent (ibd) 2-5 2.3 ibd of more than 2 genes 2-14 2.4 Data on relatives 2-21 2.1.1 GRAPHICAL
More information! FTDNA! Ancestry. ! 23andMe. ! Medical Considera,ons. ! Iden,fying family medical history. ! Communica,ng with the medical community
by JEFF CARPENTER! Brief Defini,ons about YDNA, XDNA, mtdna, atdna (Covered in Part 1)! Benefits of Tes,ng DNA! Examples of DNA TESTING! FTDNA! Ancestry! 3andMe Jeff Carpenter, 016 jeffcarpenter1939@gmal.com!
More informationDNA: Statistical Guidelines
Frequency calculations for STR analysis When a probative association between an evidence profile and a reference profile is made, a frequency estimate is calculated to give weight to the association. Frequency
More informationY-DNA Genetic Testing
Y-DNA Genetic Testing 50 2/24/14 Y-DNA Genetic Testing Y-DNA flows from fathers to sons intact SNPs define Y-DNA haplogroups Haplogroups (clans) migrated together Timeframe between mutations is 2,000 to
More informationUsing Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM
Using Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.
More informationChromosome X haplotyping in deficiency paternity testing principles and case report
International Congress Series 1239 (2003) 815 820 Chromosome X haplotyping in deficiency paternity testing principles and case report R. Szibor a, *, I. Plate a, J. Edelmann b, S. Hering c, E. Kuhlisch
More informationGetting the Most Out of Your DNA Matches
Helen V. Smith PG Dip Public Health, BMedLabSci, ADCLT, Dip. Fam. Hist. PLCGS 46 Kraft Road, Pallara, Qld, 4110 Email: HVSresearch@DragonGenealogy.com Website: www.dragongenealogy.com Blog: http://www.dragongenealogy.com/blog/
More informationDNA for Genealogy Librarians. Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District
DNA for Genealogy Librarians Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District What does DNA do? It replicates itself. It codes for the production
More informationFinally, should you have any questions, queries or issues with regard to the service our company provides, us at
Dear Sir / Madam, To complete the enclosed registration form, please follow the procedure below: 1. Choose a sampler. To comply with current legislation, samples must be taken by a medically qualified
More informationNeed a little help with the lab?
Need a little help with the lab? Alleles are corresponding pairs of genes located on an individual s chromosomes. Together, alleles determine the genotype of an individual. The Genotype describes the specific
More informationLecture 1: Introduction to pedigree analysis
Lecture 1: Introduction to pedigree analysis Magnus Dehli Vigeland NORBIS course, 8 th 12 th of January 2018, Oslo Outline Part I: Brief introductions Pedigrees symbols and terminology Some common relationships
More informationFamily Tree DNA Genetic Genealogy Started Here
Family Tree DNA Genetic Genealogy Started Here With 253,000 samples in our DNA database (the largest of its kind in the world) your genealogical search could become even easier Why Bennett Greenspan founded
More informationStatistical Interpretation in Making DNA-based Identification of Mass Victims
Statistical Interretation in Making DNAbased Identification of Mass Victims KyoungJin Shin wan Young Lee Woo Ick Yang Eunho a Det. of Forensic Medicine Yonsei University College of Medicine Det. of Information
More informationManual for Familias 3
Manual for Familias 3 Daniel Kling 1 (daniellkling@gmailcom) Petter F Mostad 2 (mostad@chalmersse) ThoreEgeland 1,3 (thoreegeland@nmbuno) 1 Oslo University Hospital Department of Forensic Services Oslo,
More informationThe Snohomish Tribe of Indians Application for Enrollment
The Snohomish Tribe of Indians Application for Enrollment DATE APPLIED Enrollment # Enrollment For Office Use Only NAME (First, Middle, Last)* Maiden of Birth Current Mailing Address Copy of State Issued
More informationFinding a Male Hodge(s) Descendant for Y-Chromosome DNA Testing. Prepared by Jan Alpert
Finding a Male Hodge(s) Descendant for Y-Chromosome DNA Testing Prepared by Jan Alpert Why Test Male Y-Chromosome DNA All males carry the Y-Chromosome of their fathers As a result the same DNA markers
More informationGenetic Identity and
Genetic Identity and GACATGTAGCTCTTCACTTCACCCAGGTTGGGTTGTGTCAACAGGAAACATTGTAACATATCACTTGGATTAGCACCTAGG/TTAT/TTAT/TTA Community DTC Genetic Testing Workshop The National Academies' August 31 September 1,
More informationGenetic Genealogy. Rules and Tools. Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter
Genetic Genealogy Rules and Tools Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter I am NOT this guy! 2 Genealogy s Newest Tool Genealogy research: Study of Family History Identifies
More informationDNA: UNLOCKING THE CODE
DNA: UNLOCKING THE CODE Connecting Cousins for Genetic Genealogy Bryant McAllister, PhD Associate Professor of Biology University of Iowa bryant-mcallister@uiowa.edu Iowa Genealogical Society April 9,
More informationWINSLOW HERITAGE SOCIETY ~~~~~~~~~~~~~~~~~~
Newsletter, Vol. 2, No. 1 March, 2015 WINSLOW HERITAGE SOCIETY ~~~~~~~~~~~~~~~~~~ In Vol. 1, No. 1 of the Winslow Heritage Society Newsletter, Kathy Myers, Society Governor, a descendant of Kenelm Winslow,
More informationDNA Solu)ons for Brick Walls And Adop)on
DNA Solu)ons for Brick Walls And Adop)on "I have not failed. I've just found ten thousand ways that won't work." Thomas Edison Wise Woman Gene+c Genealogy Comments Listen Carefully! 1. DNA is not the be
More information50/50. Accreditations 4/13/2016 A B A B A B. Mother. Father. Child. Everything you ever wanted to know about DNA collections and MORE!
Everything you ever wanted to know about DNA collections and MORE! Presented by: Kim Levaggi Accreditations 1 50/50 Half of your DNA comes from your mother Half of your DNA comes from your father Mother
More information4/13/2016. Everything you ever wanted to know about DNA collections and MORE! Presented by: Kim Levaggi
Everything you ever wanted to know about DNA collections and MORE! Presented by: Kim Levaggi 1 Accreditations 1 2 50/50 Half of your DNA comes from your mother Half of your DNA comes from your father Mother
More informationAPPLICATION FOR ENROLLMENT
CTGR-9615 Grand Ronde Rd.; Grand Ronde OR 97347 1-800-422-0232 ext.2253 APPLICATION FOR ENROLLMENT Name: First Middle Last Maiden Gender Female. Male Date of Birth Social security Number Address: Mailing
More informationUniversity of Washington, TOPMed DCC July 2018
Module 12: Comput l Pipeline for WGS Relatedness Inference from Genetic Data Timothy Thornton (tathornt@uw.edu) & Stephanie Gogarten (sdmorris@uw.edu) University of Washington, TOPMed DCC July 2018 1 /
More informationDNA (DeoxyriboNucleic Acid)
Basics of DNA & Sales and Marketing Presented by: Kim Levaggi of Chromosomal Labs DNA (DeoxyriboNucleic Acid) DNA a very long molecule that is essentially the instruction manual to cells and organisms.
More informationInvestigations from last time. Inbreeding and neutral evolution Genes, alleles and heterozygosity
Investigations from last time. Heterozygous advantage: See what happens if you set initial allele frequency to or 0. What happens and why? Why are these scenario called unstable equilibria? Heterozygous
More informationBasics of DNA & Sales and Marketing
Basics of DNA & Sales and Marketing Presented by: Kim Levaggi of Chromosomal Labs 1 DNA (DeoxyriboNucleic Acid) DNA a very long molecule that is essentially the instruction manual to cells and organisms.
More informationBETTER TOGETHER: MAKING YOUR CASE WITH DOCUMENTS AND DNA BCG-sponsored Webinar (https://bcgcertification.org) Patricia Lee Hobbs, CG
BETTER TOGETHER: MAKING YOUR CASE WITH DOCUMENTS AND DNA BCG-sponsored Webinar (https://bcgcertification.org) Patricia Lee Hobbs, CG LIMITATIONS & BENEFITS OF DNA TESTING DNA test results do not solve
More informationDNA Parentage Test No Summary Report
Collaborative Testing Services, Inc FORENSIC TESTING PROGRAM DNA Parentage Test No. 175871 Summary Report This proficiency test was sent to 45 participants. Each participant received a sample pack consisting
More informationGenetic Research in Utah
Genetic Research in Utah Lisa Cannon Albright, PhD Professor, Program Leader Genetic Epidemiology Department of Internal Medicine University of Utah School of Medicine George E. Wahlen Department of Veterans
More informationAdvanced Autosomal DNA Techniques used in Genetic Genealogy
Advanced Autosomal DNA Techniques used in Genetic Genealogy Tim Janzen, MD E-mail: tjanzen@comcast.net Summary of Chromosome Mapping Technique The following are specific instructions on how to map your
More informationPedigree Reconstruction using Identity by Descent
Pedigree Reconstruction using Identity by Descent Bonnie Kirkpatrick Electrical Engineering and Computer Sciences University of California at Berkeley Technical Report No. UCB/EECS-2010-43 http://www.eecs.berkeley.edu/pubs/techrpts/2010/eecs-2010-43.html
More information(This fireside was presented with a powerpoint presentation. The speaker refers many times to images in the powerpoint.)
DNA meets PAF BYU Family History Fireside - Joseph Smith Building November 9, 2001 (This fireside was presented with a powerpoint presentation. The speaker refers many times to images in the powerpoint.)
More informationSteve Harding, *Turi King and *Mark Jobling Universities of Nottingham & *Leicester, UK
Viking DNA Steve Harding, *Turi King and *Mark Jobling Universities of Nottingham & *Leicester, UK Viking DNA in Northern England Project Part 1 - Wirral and West Lancashire (2002-2007) Part 2 - North
More informationAn Introduction to Genetic Genealogy
An Introduction to Genetic Genealogy David A. Pike dapike@math.mun.ca Presented To: Family History Society of Newfoundland and Labrador 24 January 2006 Slide 1 of 21 Overview Genetic Genealogy using genetic
More informationUse of DNA information in family research information for IOWFHS members
Use of DNA information in family research information for IOWFHS members What is DNA? Since the discovery of deoxyribonucleic acid (DNA) in the 1950s, we have come to understand more about its role as
More informationTwo-point linkage analysis using the LINKAGE/FASTLINK programs
1 Two-point linkage analysis using the LINKAGE/FASTLINK programs Copyrighted 2018 Maria Chahrour and Suzanne M. Leal These exercises will introduce the LINKAGE file format which is the standard format
More informationOn identification problems requiring linked autosomal markers
* Title Page (with authors & addresses) On identification problems requiring linked autosomal markers Thore Egeland a Nuala Sheehan b a Department of Medical Genetics, Ulleval University Hospital, 0407
More informationPedigrees How do scientists trace hereditary diseases through a family history?
Why? Pedigrees How do scientists trace hereditary diseases through a family history? Imagine you want to learn about an inherited genetic trait present in your family. How would you find out the chances
More informationStatistical methods in genetic relatedness and pedigree analysis
Statistical methods in genetic relatedness and pedigree analysis Oslo, January 2018 Magnus Dehli Vigeland and Thore Egeland Exercise set III: Coecients of pairwise relatedness Exercise III-1. Use Wright's
More informationGrowing the Family Tree: The Power of DNA in Reconstructing Family Relationships
Growing the Family Tree: The Power of DNA in Reconstructing Family Relationships Luke A. D. Hutchison Natalie M. Myres Scott R. Woodward Sorenson Molecular Genealogy Foundation (www.smgf.org) 2511 South
More informationThe Meek Family of Allegheny Co., PA Meek Group A Introduction
Meek Group A Introduction In the 1770's a significant number of families named Meek(s) lived in S. W. Pennsylvania and they can be identified in the records of Westmoreland, Allegheny and Washington Counties.
More informationThe Structure of DNA Let s take a closer look at how this looks under a microscope.
DNA Basics Adapted from a MyHeritage Blog and the International Society of Genetic Genealogy (ISOGG) Wiki by Earl Cory MyHeritage has started a series to explain DNA, how it works and answer the most common
More informationContributed by "Kathy Hallett"
National Geographic: The Genographic Project Name Background The National Geographic Society is undertaking the ambitious process of tracking human migration using genetic technology. By using the latest
More informationVisual Phasing of Chromosome 1
Visual Phasing of Chromosome 1 If you have the possibility to test three full siblings, then the next great thing you could do with your DNA, is to try out the Visual Phasing technique developed by Kathy
More informationNot To Be Quoted or Cited Without Permission of the Author 6/01/03 THE CONCEPT OF THE FAMILY: DEMOGRAPHIC AND GENEALOGICAL PERSPECTIVES
Not To Be Quoted or Cited Without Permission of the Author 6/01/03 THE CONCEPT OF THE FAMILY: DEMOGRAPHIC AND GENEALOGICAL PERSPECTIVES Charles B. Nam Research Associate, Center for Demography and Population
More informationHEREDITARY CANCER FAMILY HISTORY QUESTIONNAIRE
Packet received: Appointment: HEREDITARY CANCER FAMILY HISTORY QUESTIONNAIRE Please complete this questionnaire. While this can take some time, a review of your family history will allow us to provide
More informationGenetic Genealogy Journey Why Is My Cousin Not on my DNA Match List? Debbie Parker Wayne, CG SM, CGL SM
Genetic Genealogy Journey Why Is My Cousin Not on my DNA Match List? Debbie Parker Wayne, CG SM, CGL SM The CSI television shows have conditioned us to expect exact DNA matches and lead us to think DNA
More information