Genetic Identity and
|
|
- Frank Underwood
- 6 years ago
- Views:
Transcription
1 Genetic Identity and GACATGTAGCTCTTCACTTCACCCAGGTTGGGTTGTGTCAACAGGAAACATTGTAACATATCACTTGGATTAGCACCTAGG/TTAT/TTAT/TTA Community DTC Genetic Testing Workshop The National Academies' August 31 September 1,
2 The Sorenson Molecular Genealogy Foundation (SMGF) 2
3 The Mission of the SMGF To change the way that we think about each other, and hopefully the way we act towards each other, by showing that we are really one great human family James L. Sorenson By creating a comprehensive database of the families of the world, using correlated genealogical and genetic information And providing the tools needed to reconstruct genealogies using DNA Make the data available to the public 3
4 SMGF Database DNA Samples 108,000 (informed consent) ~170 countries Extended Pedigrees 90,828 (11 gens average) 7.8 m names (2.6 m unique) mtdna sequences 76,766 D-loop 315 Complete Y haplotypes 39,264 STR (complete at 37 loci) X haplotypes 73,394 STR (complete at 13 loci, 3 linkage groups) Autosomal genotypes 78,568 STR (68.5 average) 300 SNP (Affymetrics 6.0) 4
5 GACATGTAGCTCTTCACTTCACCCAGGTTGGGTTGTGTCAACAGGAAACATTGTAACATATCACTTGGATTAGCACCTAGG/TTAT/TTAT/TTA Collection in Mongolia 5
6 Sample Collection Locations Tsengel,Bayan-Olgii 5% Tsagaanhairhan,Uvs 2% Tumurbulag,Khövsgöl 4% Tsetserleg,Khövsgöl Tudevtei,Zavkhan 2% Zavkhan,Uvs 2% Alag-Erdene,Khövsgöl Altai,Khovd 3% Bayandum,Dornod 4% Bayantumen,Dornod Bayantes,Zavkhan Binder,Khentii 3% Bulgan,Khovd 3% Tsagaan-Uur,Khövsgöl 4% Tes,Zavkhan 2% Songino,Zavkhan Sergelen,Dornod 3% Sagsai,Bayan-Ölgii 4% Naranbulag,Uvs Naran,Sukhbaatar Myangad,Khovd 3% Buyant,Khovd Chandmani-Öndör,Khövsgöl 2% Dadal,Khentii 2% Daringanga,Sukhbaatar 4% Dashbalbar,Dornod Delgereh,Dornogobi Erdeneburen,Khovd 4% Munkhkhairkhan,Khovd 3% Multi city 15% Moron,Khövsgöl Hulunbuir,Dornod Matad,Dornod Mongolia miscellaneous 4% Erenetsagaan,Sukhbaatar 5% Gurvanzagal,Dornod 4% 6
7 Informed Consent Description of Study Procedures Risks Linking genetic results to you Loss of confidentiality Benefits Payments Voluntary Participation/Withdrawal Confidentiality Use of data Funding 7
8 Issues Privacy vs. self-awareness Who owns genetic (and genealogical or any other 'personal' data)? Secondary participants Discrimination and effectiveness of GINA Social Networks based on DTC genetic testing results mt and Y 'haplogroups' Ethnicity 8
9 Genetic Systems and Genealogy Y chromosome Y chromosome (only males) mtdna (males and females) autosomal DNA (all individuals) mitochondrial DNA 9
10 Who (What) am I? 2009 Utah, USA 100% 1956 Virginia, USA 100% 1933 Utah, USA 100% 1900 Utah, USA 75% Leigh, Lancashire, England 25% 1800 USA 37.5% England 25% Denmark 12.5% Sweden 12.5% Switzerland 12.5% 10
11 11
12 Y Surname search 12
13 Y Search Result 13
14 Pedigree Result 14
15 Discovering Identity 15
16 Rediscovering Family 16
17 Discovering Community 17
18 Autosomal admixture 18
19 A Native American Group Samples from Bolivia Affymetrix 6.0 data 19
20 Filomena k=5 20
21 Filomena k=26 21
22 What does Race mean? 22
23 Collaborative Efforts 23
What Can I Learn From DNA Testing?
What Can I Learn From DNA Testing? From where did my ancestors migrate? What is my DNA Signature? Was my ancestor a Jewish Cohanim Priest? Was my great great grandmother really an Indian Princes? I was
More informationHalley Family. Mystery? Mystery? Can you solve a. Can you help solve a
Can you solve a Can you help solve a Halley Halley Family Family Mystery? Mystery? Who was the great grandfather of John Bennett Halley? He lived in Maryland around 1797 and might have been born there.
More informationMitochondrial DNA (mtdna) JGSGO June 5, 2018
Mitochondrial DNA (mtdna) JGSGO June 5, 2018 MtDNA - outline What is it? What do you do with it? How do you maximize its value? 2 3 mtdna a double-stranded, circular DNA that is stored in mitochondria
More informationDNA Opening Doors for Today s s Genealogist
DNA Opening Doors for Today s s Genealogist Presented to JGSI Sunday, March 30, 2008 Presented by Alvin Holtzman Genetic Genealogy Discussion Points What is DNA How can it help genealogists What to expect
More informationDNA Testing What you need to know first
DNA Testing What you need to know first This article is like the Cliff Notes version of several genetic genealogy classes. It is a basic general primer. The general areas include Project support DNA test
More informationTHE BASICS OF DNA TESTING. By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library
THE BASICS OF DNA TESTING By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library TYPES OF TESTS Mitochondrial DNA (mtdna/mdna) Y-DNA Autosomal DNA (atdna/audna) MITOCHONDRIAL DNA Found
More informationCAGGNI s DNA Special Interest Group
CAGGNI s DNA Special Interest Group 10 Jan 2015 Al & Michelle Wilson Agenda Survey Basics in Fan Charts Recombination Exercise Triangulation Overview Survey 1. Have you taken (or sponsored) a DNA test?
More informationGenetic Genealogy Journey DNA Projects by Debbie Parker Wayne, CG SM, CGL SM
Genetic Genealogy Journey DNA Projects by Debbie Parker Wayne, CG SM, CGL SM Genealogy can be a solitary pursuit. Genealogists sometimes collaborate to work on common lines, but lone researchers can perform
More informationGrowing the Family Tree: The Power of DNA in Reconstructing Family Relationships
Growing the Family Tree: The Power of DNA in Reconstructing Family Relationships Luke A. D. Hutchison Natalie M. Myres Scott R. Woodward Sorenson Molecular Genealogy Foundation (www.smgf.org) 2511 South
More informationTRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter
TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter 1-1: DNA: WHERE DO I START? Definition Genetic genealogy is the application of genetics to traditional genealogy. Genetic genealogy uses genealogical
More informationUsing Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM
Using Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.
More informationAutosomal-DNA. How does the nature of Jewish genealogy make autosomal DNA research more challenging?
Autosomal-DNA How does the nature of Jewish genealogy make autosomal DNA research more challenging? Using Family Finder results for genealogy is more challenging for individuals of Jewish ancestry because
More informationFrom Sticky Mucus to Probing our Past: Aspects and problems of the Biotechnological use of Macromolecules
From Sticky Mucus to Probing our Past: Aspects and problems of the Biotechnological use of Macromolecules DNA natures most important glycoconjugate DNA natures most important glycoconjugate High molecular
More informationICMP DNA REPORTS GUIDE
ICMP DNA REPORTS GUIDE Distribution: General Sarajevo, 16 th December 2010 GUIDE TO ICMP DNA REPORTS 1. Purpose of This Document 1. The International Commission on Missing Persons (ICMP) endeavors to secure
More information[CLIENT] SmithDNA1701 DE January 2017
[CLIENT] SmithDNA1701 DE1704205 11 January 2017 DNA Discovery Plan GOAL Create a research plan to determine how the client s DNA results relate to his family tree as currently constructed. The client s
More informationDNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding
DNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding by Dr. Ing. Robert L. Baber 2014 July 26 Rights reserved, see the copyright notice at http://gengen.rlbaber.de
More informationDNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016
DNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016 1 What we will cover How testing helps genealogy What is DNA? How do you select from the three testing companies?
More informationAutosomal DNA. What is autosomal DNA? X-DNA
ANGIE BUSH AND PAUL WOODBURY info@thednadetectives.com November 1, 2014 Autosomal DNA What is autosomal DNA? Autosomal DNA consists of all nuclear DNA except for the X and Y sex chromosomes. There are
More informationUsing Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM
Using Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.
More informationPizza and Who do you think you are?
Pizza and Who do you think you are? an overview of one of the newest and possibly more helpful developments in researching genealogy and family history that of using DNA for research What is DNA? Part
More informationDNA Basics. OLLI: Genealogy 101 October 1, ~ Monique E. Rivera ~
DNA Basics OLLI: Genealogy 101 October 1, 2018 ~ Monique E. Rivera ~ WHAT IS DNA? DNA (deoxyribonucleic acid) is found in every living cell everywhere. It is a long chemical chain that tells our cells
More informationUsing Mitochondrial DNA (mtdna) for Genealogy Debbie Parker Wayne, CG, CGL SM
Using Mitochondrial DNA (mtdna) for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical
More informationFamily Tree DNA Genetic Genealogy Started Here
Family Tree DNA Genetic Genealogy Started Here With 253,000 samples in our DNA database (the largest of its kind in the world) your genealogical search could become even easier Why Bennett Greenspan founded
More informationDNA Haplogroups Report
DNA Haplogroups Report for Matthew Mayberry Generated and printed on Sep 25 2011, 01:59 pm X This is a mtdna Haplogroup Report This is a mtdna Subclade Report Search criteria used in this report: HVR-1
More informationSteve Harding, *Turi King and *Mark Jobling Universities of Nottingham & *Leicester, UK
Viking DNA Steve Harding, *Turi King and *Mark Jobling Universities of Nottingham & *Leicester, UK Viking DNA in Northern England Project Part 1 - Wirral and West Lancashire (2002-2007) Part 2 - North
More informationY-DNA Genetic Testing
Y-DNA Genetic Testing 50 2/24/14 Y-DNA Genetic Testing Y-DNA flows from fathers to sons intact SNPs define Y-DNA haplogroups Haplogroups (clans) migrated together Timeframe between mutations is 2,000 to
More information! FTDNA! Ancestry. ! 23andMe. ! Medical Considera,ons. ! Iden,fying family medical history. ! Communica,ng with the medical community
by JEFF CARPENTER! Brief Defini,ons about YDNA, XDNA, mtdna, atdna (Covered in Part 1)! Benefits of Tes,ng DNA! Examples of DNA TESTING! FTDNA! Ancestry! 3andMe Jeff Carpenter, 016 jeffcarpenter1939@gmal.com!
More informationGenetic Genealogy. Rules and Tools. Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter
Genetic Genealogy Rules and Tools Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter I am NOT this guy! 2 Genealogy s Newest Tool Genealogy research: Study of Family History Identifies
More informationDNA and Ancestry. An Update on New Tests. Steve Louis. Jewish Genealogical Society of Washington State. January 13, 2014
DNA and Ancestry An Update on New Tests Steve Louis Jewish Genealogical Society of Washington State January 13, 2014 DISCLAIMER This document was prepared as a result of independent work and opinions of
More informationEller DNA Project. Status Report for Nashville EFA Conference----July 25, Tom Eller, DNA Project Administrator
Eller DNA Project Status Report for Nashville EFA Conference----July 25, 2009 Tom Eller, DNA Project Administrator Eller DNA Project This presentation used material from Family Tree DNA and from World
More informationWalter Steets Houston Genealogical Forum DNA Interest Group April 7, 2018
Ancestry DNA and GEDmatch Walter Steets Houston Genealogical Forum DNA Interest Group April 7, 2018 Today s agenda Recent News about DNA Testing DNA Cautions: DNA Data Used for Forensic Purposes New Technology:
More informationThe Structure of DNA Let s take a closer look at how this looks under a microscope.
DNA Basics Adapted from a MyHeritage Blog and the International Society of Genetic Genealogy (ISOGG) Wiki by Earl Cory MyHeritage has started a series to explain DNA, how it works and answer the most common
More informationA Day Out With Your DNA
A Day Out With Your DNA Diahan Southard www.yourdnaguide.com Your testing company has evaluated around 800,000 locations on your DNA to help them determine your origins and your genetic cousins. While
More informationPrimer on Human Pedigree Analysis:
Primer on Human Pedigree Analysis: Criteria for the selection and collection of appropriate Family Reference Samples John V. Planz. Ph.D. UNT Center for Human Identification Successful Missing Person ID
More informationEwing Surname Y-DNA Project Article 8
Ewing Surname Y-DNA Project Article 8 This is the eighth in a series of articles about the Ewing Surname Y-DNA Project. The previous seven articles have appeared in the last seven issues of the Journal
More informationIden%fying Personal Genomes by Surname Inference
Iden%fying Personal Genomes by Surname Inference Gymrek M, McGuire AL, Golan D, Halperin E, Erlich Y. Science. 2013 Jan 18;339(6117):321-4. doi: 10.1126/science.1229566. Journal Club Kairi Raime 04.02.2013
More informationAn O-F3288 Y DNA Discovery for Patrilineal Descendants of James Revell (Accomack) By Marie A. Rundquist, DNA Project Administrator November 2018
Project Scope Rundquist O-F3288 White Paper 11/2018 An O-F3288 Y DNA Discovery for Patrilineal Descendants of James Revell (Accomack) By Marie A. Rundquist, DNA Project Administrator November 2018 The
More informationAn Introduction to Genetic Genealogy
An Introduction to Genetic Genealogy David A. Pike dapike@math.mun.ca Presented To: Family History Society of Newfoundland and Labrador 24 January 2006 Slide 1 of 21 Overview Genetic Genealogy using genetic
More informationDNA Messages from our ancestors
Searching for Viking DNA Stephen Harding DNA Messages from our ancestors DNA is a text that changes slowly through time, and varies between individuals Analyse DNA from skeletons Real information about
More informationGetting the Most Out of Your DNA Matches
Helen V. Smith PG Dip Public Health, BMedLabSci, ADCLT, Dip. Fam. Hist. PLCGS 46 Kraft Road, Pallara, Qld, 4110 Email: HVSresearch@DragonGenealogy.com Website: www.dragongenealogy.com Blog: http://www.dragongenealogy.com/blog/
More informationDNA Testing. February 16, 2018
DNA Testing February 16, 2018 What Is DNA? Double helix ladder structure where the rungs are molecules called nucleotides or bases. DNA contains only four of these nucleotides A, G, C, T The sequence that
More informationEvery human cell (except red blood cells and sperm and eggs) has an. identical set of 23 pairs of chromosomes which carry all the hereditary
Introduction to Genetic Genealogy Every human cell (except red blood cells and sperm and eggs) has an identical set of 23 pairs of chromosomes which carry all the hereditary information that is passed
More informationUsing X-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM
Using X-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.
More informationDNA TESTING. This is the testing regime for FamilyTreeDNA. Other SNP tests were ordered from Yseq.
DNA & GENEALOGY DNA TESTING This is the testing regime for FamilyTreeDNA. Other SNP tests were ordered from Yseq. Product Date Batch Family Finder 30-May-14 Completed 569 05-Aug-14 Batched 569 05-Jul-14
More informationIN THIS ISSUE: February From the Administrator Questions/News...1. George Varner of Missouri Direct Line...2
IN THIS ISSUE: From the Administrator..... 1 Questions/News.......1 George Varner of Missouri Direct Line...2 Do the Newtons & Varners Really Both have Riggs DNA?...2 2016 Newton/Varner Reunion. 5 February
More informationDeveloping Conclusions About Different Modes of Inheritance
Pedigree Analysis Introduction A pedigree is a diagram of family relationships that uses symbols to represent people and lines to represent genetic relationships. These diagrams make it easier to visualize
More informationPutting the genes into genealogy
Putting the genes into genealogy DNA testing can help find lost branches of your family tree. Susan C Meates describes how DNA surname projects work DNA testing for genealogy has been available since 2000,
More informationYour mtdna Full Sequence Results
Congratulations! You are one of the first to have your entire mitochondrial DNA (DNA) sequenced! Testing the full sequence has already become the standard practice used by researchers studying the DNA,
More informationRecent Results from the Jackson Brigade DNA Project
Recent Results from the Jackson Brigade DNA Project Dr. Daniel C. Hyde Professor Emeritus of Computer Science Bucknell University Lewisburg, PA Presented at Jackson Brigade Reunion, Horner, WV on August
More informationBefore India: Exploring Your Ancestry With DNA By David G. Mahal
Before India: Exploring Your Ancestry With DNA By David G. Mahal You then receive an email notifying you that your results are ready to explore on utilize your DNA results for family history by Ancestry.com
More informationAn Introduction. Your DNA. and Your Family Tree. (Mitochondrial DNA) Presentation by: 4/8/17 Page 1 of 10
An Introduction Your DNA and Your Family Tree (Mitochondrial DNA) Presentation by: FredCoffey@aol.com 4/8/17 Page 1 of 10 Coffey Surname, y-dna Project We're now ready to move on and look at the type of
More informationWalter Steets Houston Genealogical Forum DNA Interest Group February 24, 2018
Using Ancestry DNA and Third-Party Tools to Research Your Shared DNA Segments Part 2 Walter Steets Houston Genealogical Forum DNA Interest Group February 24, 2018 1 Today s agenda Brief review of previous
More informationTools: 23andMe.com website and test results; DNAAdoption handouts.
When You First Get Your 23andMe Results Objective: Learn what to do with results of atdna testing with 23andMe. Tools: 23andMe.com website and test results; DNAAdoption handouts. Exercises: Practice Exercises
More informationGEDmatch Home Page The upper left corner of your home page has Information about you and links to lots of helpful information. Check them out!
USING GEDMATCH Created March 2015 GEDmatch is a free, non-profit site that accepts raw autosomal data files from Ancestry, FTDNA, and 23andme. As such, it provides a large autosomal database that spans
More informationMeek DNA Project Group B Ancestral Signature
Meek DNA Project Group B Ancestral Signature The purpose of this paper is to explore the method and logic used by the author in establishing the Y-DNA ancestral signature for The Meek DNA Project Group
More information(This fireside was presented with a powerpoint presentation. The speaker refers many times to images in the powerpoint.)
DNA meets PAF BYU Family History Fireside - Joseph Smith Building November 9, 2001 (This fireside was presented with a powerpoint presentation. The speaker refers many times to images in the powerpoint.)
More informationGenetic Genealogy. Using DNA to research your maternal & paternal lines. Ed McGuire. Vermont Genealogy Library 2/24/14
Genetic Genealogy Using DNA to research your maternal & paternal lines Ed McGuire 2/24/14 Introduction Soprano Family Tree 2 2/24/14 Introduction 3 2/24/14 Introduction 4 2/24/14 Introduction Contradictory
More informationLarge scale kinship:familial Searching and DVI. Seoul, ISFG workshop
Large scale kinship:familial Searching and DVI Seoul, ISFG workshop 29 August 2017 Large scale kinship Familial Searching: search for a relative of an unidentified offender whose profile is available in
More informationApproaching and Connecting with Your DNA Matches
Approaching and Connecting with Your DNA Matches Shannon Stewart Christmas, MCP throughthetreesblog@gmail.com Understand DNA Tests The four types of DNA and the relevant test companies Segment triangulation
More informationForensic Statistics and Graphical Models (1) Richard Gill Spring Semester 2015
Forensic Statistics and Graphical Models (1) Richard Gill Spring Semester 2015 http://www.math.leidenuniv.nl/~gill/teaching/graphical Forensic Statistics Distinguish criminal investigation and criminal
More informationGenealogical Research
DNA, Ancestry, and Your Genealogical Research Walter Steets Houston Genealogical Forum DNA Interest Group March 2, 2019 1 Today s Agenda Brief review of basic genetics and terms used in genetic genealogy
More informationDNA: UNLOCKING THE CODE
DNA: UNLOCKING THE CODE Connecting Cousins for Genetic Genealogy Bryant McAllister, PhD Associate Professor of Biology University of Iowa bryant-mcallister@uiowa.edu Iowa Genealogical Society April 9,
More informationChallenges in Genomic Privacy: An Analysis of. Surname Attacks in the Population of Britain 1
Challenges in Genomic Privacy: An Analysis of Surname Attacks in the Population of Britain 1 Sahel Shariati Samani*, Mark Elliot* and Andrew Brass** * School of Social Sciences University of Manchester,
More informationReport on the VAN_TUYL Surname Project Y-STR Results 3/11/2013 Rory Van Tuyl
Report on the VAN_TUYL Surname Project Y-STR Results 3/11/2013 Rory Van Tuyl Abstract: Recent data for two descendants of Ott van Tuyl has been added to the project, bringing the total number of Gameren
More informationYour Family 101 Beginning Genealogical Research
Your Family 101 Beginning Genealogical Research What Will We Cover Today? Session 1: Getting Started Session 2: Your Resources Session 3: Common Mistakes and Pitfalls Session 4: DNA Testing and Medical
More informationBig Y-700 White Paper
Big Y-700 White Paper Powering discovery in the field of paternal ancestry Authors: Caleb Davis, Michael Sager, Göran Runfeldt, Elliott Greenspan, Arjan Bormans, Bennett Greenspan, and Connie Bormans Last
More informationGenealogy: DNA And The Family Tree By James Mayflower READ ONLINE
Genealogy: DNA And The Family Tree By James Mayflower READ ONLINE CeCe Moore's "DNA Testing for Genealogy - Getting Started" series is a Family Tree DNA is currently the only commercial laboratory offering
More informationFirst Results: Intro to FamilyTreeDNA s Family Finder. Learn what to do with results of autosomal DNA testing with FamilyTreeDNA (FTDNA).
First Results: Family Tree DNA When You First Get Your FamilyTreeDNA (FTDNA) Results Objective: Learn what to do with results of autosomal DNA testing with FamilyTreeDNA (FTDNA). Tools: familytreedna.com
More informationWINSLOW HERITAGE SOCIETY ~~~~~~~~~~~~~~~~~~
Newsletter, Vol. 2, No. 1 March, 2015 WINSLOW HERITAGE SOCIETY ~~~~~~~~~~~~~~~~~~ In Vol. 1, No. 1 of the Winslow Heritage Society Newsletter, Kathy Myers, Society Governor, a descendant of Kenelm Winslow,
More informationDAR POLICY STATEMENT AND BACKGROUND Using DNA Evidence for DAR Applications
Effective January 1, 2014, DAR will begin accepting Y-DNA evidence in support of new member applications and supplemental applications as one element in a structured analysis. This analysis will use a
More informationLutz Roewer, Sascha Willuweit Dept. Forensic Genetics, Institute of Legal Medicine and Forensic Sciences Charité Universitätsmedizin Berlin, Germany
The new YHRD Lutz Roewer, Sascha Willuweit Dept. Forensic Genetics, Institute of Legal Medicine and Forensic Sciences Charité Universitätsmedizin Berlin, Germany 2000 2004 2008 2014 Aug 99 Jun 00 Jan 03
More informationComputer - aided Genealogy. Rob Drew
Computer - aided Genealogy Rob Drew Topics Building your family tree Off-line tools for your laptop or desktop at home. What s a gedcom file? Building an on-line tree. Research websites Where to get help
More informationGenetic Genealogy Resources
Genetic Genealogy Resources ISOGG International Society of Genetic Genealogists ISOGG was formed in 2003 by a group of surname administrators after the first International DNA Conference in Houston. Membership
More informationBIOL Evolution. Lecture 8
BIOL 432 - Evolution Lecture 8 Expected Genotype Frequencies in the Absence of Evolution are Determined by the Hardy-Weinberg Equation. Assumptions: 1) No mutation 2) Random mating 3) Infinite population
More informationWilliam E. Howard III
William E. Howard III This study presents a new correlation method for organizing Y-chromosome haplotypes and calculating the time to the most recent common ancestor (TMRCA). We suggest that the technique
More informationAFDAA 2012 WINTER MEETING Population Statistics Refresher Course - Lecture 3: Statistics of Kinship Analysis
AFDAA 2012 WINTER MEETING Population Statistics Refresher Course - Lecture 3: Statistics of Kinship Analysis Ranajit Chakraborty, PhD Center for Computational Genomics Institute of Applied Genetics Department
More informationMeek/Meeks Families of Virginia Meek Group F Introduction
Meek Group F Introduction The Meek/Meeks DNA Project 1 has established Y-DNA signatures 2 for a significant number of early American ancestors based on tests of living descendants. This allows for a determination
More informationUnderstanding DNA in Genealogy. Peter Biggins, BY3164 Darien Library, Darien, CT November 18, 2017
Understanding DNA in Genealogy Peter Biggins, BY3164 Darien Library, Darien, CT November 18, 2017 1953: Watson 25, Crick 37, Franklin 33 My BY3164 SNP 1953 paper published on the structure of DNA 1962
More informationDetecting Heterogeneity in Population Structure Across the Genome in Admixed Populations
Genetics: Early Online, published on July 20, 2016 as 10.1534/genetics.115.184184 GENETICS INVESTIGATION Detecting Heterogeneity in Population Structure Across the Genome in Admixed Populations Caitlin
More informationTwo-point linkage analysis using the LINKAGE/FASTLINK programs
1 Two-point linkage analysis using the LINKAGE/FASTLINK programs Copyrighted 2018 Maria Chahrour and Suzanne M. Leal These exercises will introduce the LINKAGE file format which is the standard format
More informationErnie Ebayley s Adventure in DNA-Land. A Resource for Beginning Your Own Adventure into Genealogical Genetics
Ernie Ebayley s Adventure in DNA-Land A Resource for Beginning Your Own Adventure into Genealogical Genetics 2006 C.E. Smith Museum of Anthropology College of Arts, Letters, and Social Sciences (CLASS)
More informationDNA for Genealogy Librarians. Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District
DNA for Genealogy Librarians Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District What does DNA do? It replicates itself. It codes for the production
More informationFREQUENTLY ASKED QUESTIONS ABOUT THE OWSTON/OUSTON DNA PROJECT
FREQUENTLY ASKED QUESTIONS ABOUT THE OWSTON/OUSTON DNA PROJECT 1. What has been discovered thus far and what may be discovered with testing? The Owston/Ouston DNA project grew out of the combined genealogical
More informationWalter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018
DNA, Ancestry, and Your Genealogical Research- Segments and centimorgans Walter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018 1 Today s agenda Brief review of previous DIG session
More informationFind JCD Project Date: Identification-DNA Process Updated:
New Look Investigations Created by: Jack Friess Find JCD Project Date: 04-20-2018 Identification-DNA Process Updated: 05-24-2018 Questions and Answers Identification-DNA (ID-DNA) is a scientific process
More informationUsing Pedigrees to interpret Mode of Inheritance
Using Pedigrees to interpret Mode of Inheritance Objectives Use a pedigree to interpret the mode of inheritance the given trait is with 90% accuracy. 11.2 Pedigrees (It s in your genes) Pedigree Charts
More informationSupplementary Materials for
www.sciencemag.org/cgi/content/full/339/6117/321/dc1 Supplementary Materials for Identifying Personal Genomes by Surname Inference Melissa Gymrek, Amy L. McGuire, David Golan, Eran Halperin, Yaniv Erlich*
More information1/8/2013. Free Online Training. Using DNA and CODIS to Resolve Missing and Unidentified Person Cases. Click Online Training
Free Online Training Using DNA and CODIS to Resolve Missing and Unidentified Person Cases B.J. Spamer NamUs Training and Analysis Division Office: 817-735-5473 Cell: 817-964-1879 Email: BJ.Spamer@unthsc.edu
More informationAcademic Path to a Genetic Genealogy Curriculum
International Journal of Humanities Social Sciences and Education (IJHSSE) Volume 5, Issue 10, October 2018, PP 34-42 ISSN 2349-0373 (Print) & ISSN 2349-0381 (Online) http://dx.doi.org/10.20431/2349-0381.0510004
More informationFree Online Training
Using DNA and CODIS to Resolve Missing and Unidentified Person Cases B.J. Spamer NamUs Training and Analysis Division Office: 817-735-5473 Cell: 817-964-1879 Email: BJ.Spamer@unthsc.edu Free Online Training
More informationcompany does improve its ethnicity estimates, your profile will automatically be updated, too. You won't have to retake the test to get the new
Ancestry dna kit The Y-DNA test is more limited than the ones from Family Tree DNA Does not offer a less expensive 'autosomal DNA-only' test Can't connect with other matches Can't upload raw data from
More informationForensic use of Y chromosome DNA: a general overview
DOI 10.1007/s00439-017-1776-9 REVIEW Forensic use of Y chromosome DNA: a general overview Manfred Kayser 1 Received: 5 February 2017 / Accepted: 8 March 2017 The Author(s) 2017. This article is an open
More informationNew Advances Reconstructing the Y Chromosome Haplotype of Napoléon the First Based on Three of his Living Descendants
Journal of Molecular Biology Research; Vol. 5, No. 1; 20 ISSN 125-430X E-ISSN 125-4318 Published by Canadian Center of Science and Education New Advances Reconstructing the Y Chromosome Haplotype of Napoléon
More informationWelcome to this issue of Facts & Genes, the only publication devoted to Genetic Genealogy.
Facts & Genes from Family Tree DNA ================================== March 3, 2004 Volume 3, Issue 2 In This Issue ============= Editor's Corner In the News: Family Tree DNA Announcements Haplogroups:
More informationPedigrees How do scientists trace hereditary diseases through a family history?
Why? Pedigrees How do scientists trace hereditary diseases through a family history? Imagine you want to learn about an inherited genetic trait present in your family. How would you find out the chances
More informationFigure S5 PCA of individuals run on the EAS array reporting Pacific Islander ethnicity, including those reporting another ethnicity.
Figure S1 PCA of European and West Asian subjects on the EUR array. A clear Ashkenazi cluster is observed. The largest cluster depicts the northwest southeast cline within Europe. A Those reporting a single
More informationGenetics. 7 th Grade Mrs. Boguslaw
Genetics 7 th Grade Mrs. Boguslaw Introduction and Background Genetics = the study of heredity During meiosis, gametes receive ½ of their parent s chromosomes During sexual reproduction, two gametes (male
More informationChart 2 Group A, 37-Marker Level Entire R1b-M222 Group Generations to Include MRCA at 99% Probability
Chart 2 Group A, 37-Marker Level Entire R1b-M222 Group Generations to Include MRCA at 99% Probability 18 Irish R1b-M222 Section Overview The members of this group demonstrate a wide web of linkage over
More informationThe DNA Case for Bethuel Riggs
The DNA Case for Bethuel Riggs The following was originally intended as an appendix to Alvy Ray Smith, Edwardian Riggses of America I: Elder Bethuel Riggs (1757 1835) of Morris County, New Jersey, and
More informationThe Meek Family of Allegheny Co., PA Meek Group A Introduction
Meek Group A Introduction In the 1770's a significant number of families named Meek(s) lived in S. W. Pennsylvania and they can be identified in the records of Westmoreland, Allegheny and Washington Counties.
More information