TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter

Transcription

1 TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter 1-1: DNA: WHERE DO I START? Definition Genetic genealogy is the application of genetics to traditional genealogy. Genetic genealogy uses genealogical DNA testing to determine the level and type of the genetic relationship between individuals. DNA tests can be used by genealogists to: Link specific individuals - Test to see whether you and another person may be cousins who descend from a common ancestor Prove or disprove the ancestry of people sharing the same last name (or NOT) - Test to see if males carrying the same surname are related to each other Map the genetic origins of large population groups - Test to see what geographical origins or ancestry you have Human Cells Human Body contains trillion cells and is the Blueprint for functioning & physical traits Humans are 99.9% genetically identical. All variations come from.1% difference DNA is contained in the chromosomes in the nucleus of the cell and the mitochondria outside the cell Chromosomes DNA is in the Chromosomes Carries genetic data in strings called Genes Humans have 23 pairs of Chromosomes 22 pairs called Autosomes 1 pair of Sex Chromosomes XX in Females XY in Males Each Chromosomal Pair includes one inherited from Father & one from Mother DNA Base Pairs form a spiral staircase called a Double Helix composed of 2 DNA bases, (A, C, T, or G) There are 4 Types of DNA Y-DNA (the Y-chromosome) Passed down ONLY from father to son Defines PATERNAL LINE mtdna (the mitochondrial genome) Passed from mother to child (both male & female) Defines MATERNAL LINE Autosomal DNA (the non-sex chromosomes) Randomly inherited from BOTH mother and father X-DNA (the X-chromosome) Unique Inheritance pattern, different for males and females Patterns of DNA Inheritance Each type of DNA behaves differently and has a different inheritance pattern. Y-DNA mtdna atdna X-DNA

2 There are 4 Types of Genetic Tests, one for each type of DNA Each test functions discretely and tells you different things. Each one has its advantages and disadvantages. Y- Chromosome DNA (Nucleus) Mitochondrial (outside Nucleus) Autosomal Chromosomes (Nucleus) X Chromosome DNA (Nucleus) Choosing the right Test This depends on your objectives and what you want to know. Y-DNA The Y-DNA test follows a direct paternal line. A Y-DNA test can tell you about your father s line for many generations but does not reveal information about any of your other ancestors. Y-DNA is most useful to prove a connection or not to a certain ancestor. It is easier to use because it corresponds to surname inheritance. It helps to distinguish between branches or origins of common surnames such as Smith or Baker. A Y-DNA test will reveal the deep ancestry or roots of your paternal line. The major drawback to Y-DNA is that only males have this chromosome. A woman must find a close male relative take the test for her, such as her brother, father, paternal uncle, or paternal cousin. Her son cannot take the test for her because he got his Y-chromosome from his father. mtdna Mitochondrial DNA is inherited only from your mother, which comes from her mother. So, it only helps to trace one line. It can prove a common ancestor with someone else, but only in a direct maternal line. Because it does not recombine, it can remain the same for many generations. mtdna mutates very slowly so it traces the maternal line back to ancient origins, 10,000 years or more. That provides deep ancestry of the maternal line to very specific regions. It is less useful in finding living relatives. Autosomal DNA Autosomal DNA (atdna) is the other 22 chromosomes that are not gender determinants. The autosomal DNA test is the most popular and offered by all the companies. Autosomal DNA is inherited from both parents and represents many of your ancestors. Therefore, it helps identify a wide range of ancestors and living relatives. It also provides estimated ethnicities or regions of your ancestors, and the admixture. In your genome. A disadvantage of atdna is that it recombines at every generation and the atdna from some ancestors is eliminated after several generations. The results of atdna test becomes less useful identifying more distant relatives such as 5 th and 6 th cousins. X-DNA Tests The X chromosome does not require a separate test. Results are included in the Autosomal test. It helps to identify ancestors along specific lines who contributed X-DNA to you. DNA Testing Companies There is not a BEST testing company. There is a better company for different purposes or goals. Each company has strengths and weaknesses. Testing options have increased over time. 23andMe 23andMe is the only company that has health-related DNA testing. Advantages Only site to offer health and wellness reports Has a large database of more than one million results Includes a chromosome browser for comparing results

3 Offers Ethnicity, Admixture and Neanderthal ancestry Disadvantages Very limited genealogical community compared to other sites Limited ability to contact matches Does not allow upload of raw data from other sites Health and wellness test is not part of the basic fee, it costs extra 23andMe assigns Y-DNA and Mitochondrial Haplogroups by detecting certain genetic variants unique to each haplogroup. The test chip includes hundreds of single nucleotide polymorphisms (SNPs). In contrast, many other genetic ancestry services analyze short tandem repeats (STRs), a different type of genetic variation. Ancestry DNA AncestryDNA is a good choice when it comes to genealogical DNA testing. They have the most extensive database of DNA results for comparison and other features for genealogists. Advantages Database of seven million DNA results for comparison An active genealogical community Can link your DNA results to your online family tree Stores your results indefinitely Disadvantages No longer offers separate mtdna or Y-DNA tests Members can opt out of sharing their DNA results more difficult to find and contact matches Connection with matches through anonymous and message boards Requires an ongoing subscription for online family tree functionality Does not allow raw data uploads from other sites Limited DNA analysis tools No access to shared segment data Family Tree DNA (FTDNA) Supports serious genetic genealogists. FTDNA allows upload of raw data from other companies. Advantages FTDNA is the only company to offer comprehensive Y-DNA & mtdna tests FTDNA atdna test is called Family Finder Stores results for a minimum of 25 years Site has a very strong genealogical community and various DNA projects Allows direct contact with matches Allows upload of raw data from tests at other companies Has many analysis tools like a Chromosome Browser and In Common With features Disadvantages Has a smaller database Does not offer health-related testing MyHeritage DNA MyHeritage recently started offering DNA testing. Services are similar to Ancestry DNA. Advantages Largest database of global customers (95 million) Link your DNA results to your online family tree Contact matches for free Allows free upload of raw data from other sites Quickly implementing analysis tools Subscription services allow access to records and family trees Covers 42 ethnic regions Disadvantages Smaller (but growing) database. Currently 1.1 mil. Testing Strategies (Autosomal results only)

4 Define your goals, then pick a company. Utilize a Test & Transfer Strategy. Test and Transfer: Test at one company and transfer results to FTDNA, MyH.eritage and GEDmatch. Test at All companies: Fish in all available ponds for maximum potential 2-1: UNDERSTANDING THE BASICS Terms to Know: Haplogroups Y-DNA and mtdna testing provides a Haplogroup designation for paternal and maternal deep ancestral origins. A haplogroup is a genetic group of people who share a common ancestor on patrilineal or matrilineal line atdna testing provides your ethnicity and admixture based on more recent ancestry. Y-DNA & mtdna Haplogroups are different Haplogroups assigned letters of alphabet Subgroups add number and letter combinations Y Haplogroup Example: R1b1 Mt Haplogroup Example: H5a1 Haplogroups defined by SNPs (mutations) All descendants will carry that mutation Main branch has sub-branches or subclades Y-DNA Haplogroups (Paternal Line) Classified by the letters SNP mutation divides Branch Each Haplogroup has Subclades mtdna Haplogroups (Maternal Line) Classified by the letters A to Z Named in order of discovery Recombination: A key concept in DNA An Important property of DNA is it can replicate, or make copies of itself As DNA is copied from generation to generation, a small number of typo mistakes (mutations) occur. One DNA base is erroneously replaced by another (C replaced by T) These changes are called single nucleotide polymorphisms abbreviated as SNP s Y Chromosome The Y chromosome is the sex-determining chromosome in humans Y-chromosome has about 59 million base pairs Y does not have matching chromosome so it escapes recombination every generation Y-DNA is passed down through the male line with only random mutational events Locations on the chromosome are identified by DYS labels, i.e. DYS 393 Y-DNA Tests Y-DNA Test in use longest, the best track record Uses 2 types of markers: STRs and SNPs Short Tandem Repeat Single Nucleotide Polymorphism Only males inherit the Y chromosome, so this test can only be used to trace the direct paternal line It can also be of great genealogical value since the Y-DNA traditionally follows the same inheritance pattern as surnames Test Concept There are two categories of Y-DNA tests. Short Tandem Repeats (STRs) The first is a short tandem repeat (STR) test. The STR test categorizes sections of the DNA according to how often a certain genetic pattern repeats. Paternal line DNA testing uses STR markers Base pairs repeat (genetic stutter)

5 DYS 393 = 13 (Marker DYS 393 has value of 12) Sequence (bases in order TATT) is repeated 12X ACTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTGT Current Y-DNA tests offer 12 to 111 Markers Adding markers increases precision, providing a greater degree of probability 37 markers are recommended level Single Nucleotide Polymorphisms (SNPs) The second is a single-nucleotide polymorphism (SNP) test. It works the same way as in autosomal DNA testing, but it only tests about 30,000 SNPs instead of 700,000. Additional SNP testing is required to reveal Terminal SNP (branch). New SNPs are being continually discovered. What You Get The STR test produces a summary of your haplotype. This can be compared to someone else s results to determine how far back your most recent common ancestor lived. A STR test is often used to determine how closely two people with the same surname are related or if they are related at all. The SNP test is more detailed, and among other things assigns you to a haplogroup. Both Y-chromosome tests can help you locate relatives. The Y-chromosome changes slowly so you may be related many generations back. The Y-chromosome is only passed down through males and the test reveals only the direct paternal line. The only company to offer individual Y-DNA testing is Family Tree DNA. 23andMe provide limited Y-DNA testing with their autosomal DNA test. Mitochondrial DNA (mtdna) Non-Nuclear DNA (outside cell nucleus) Mitochondria are passed down solely from mother to all children (female and male) Does not recombine so is inherited intact Fathers do not pass on mtdna to children mtdna mutates very slowly so is passed down virtually unchanged for thousands of years mtdna is a circular structure divided into three regions Coding region [ ] slow changing, contains genes Two Hyper Variable Regions HVR1 [ ] HVR2 [ ] faster changing Total of 16,569 locations in mitochondrial DNA Mitochondrial DNA contains 37 genes Mitochondrial Tests Test Concept mtdna testing disregards the DNA in the nucleus and examines the DNA in the mitochondria. It examines only the 16,569 genetic base pairs, instead of the 3.2 billion base pairs found in chromosomal DNA. mtdna may be identical to that of very distant direct maternal ancestors Both men and women can take this test HVR1 & HVR2 tests provide base haplogroup Full mtdna sequence test provides full haplogroup designation automatically Unlike Y, no additional SNP test required to fully determine mtdna haplogroup What You Get mtdna provides precise ancestry results, but only for the maternal line. It does not provide information about other ancestors. mtdna test will provide your maternal haplogroup. This means that your haplogroup can identify where your maternal line originated. It could also help you locate distant relatives, but some of them could be very distant. mtdna can remain nearly identical for many generations. Even with a perfect match, you may be a distant cousin to your match.

6 The only company to offer individual mtdna testing is Family Tree DNA. 23andMe provide limited mtdna testing with their autosomal DNA test. The pattern of inheritance for mitochondrial DNA and the Y chromosome provides information about your maternal and paternal lines but this combination makes up less than 1% of all your DNA, and only represent a small fraction of one s ancestry. Autosomal Chromosomes DNA in Chromosomes 1-22 (Autosomes) atdna divides every generation by about half 50% from each parent ~25% from each grandparent % is variable Farther back, % is difficult to predict atdna undergoes recombination each generation Usefulness quickly dissipates after 5-6 generations Some distant ancestor atdna is lost Autosomal (atdna) Tests Both males and females inherit autosomal DNA Both males and females can take atdna test Both males and females can COMPARE results The more atdna shared, the closer the relationship atdna can be used to: Find Unknown Cousins Identify DNA of specific Ancestors Map family DNA (parental contributions) Reveal geographical origins of ancestors Determine Admixture (Ethnic Percentages) Autosomal DNA Tests What is an autosomal DNA test? Autosomal DNA tests examine single-nucleotide polymorphisms (SNPs). Genealogical autosomal DNA tests examine about 700,000 SNPs to determine how close a relationship is to a match. Half of the atdna comes from a father and half from a mother. This means that about 1/4th of atdna comes from each of our grandparents and 1/8th from each great-grandparent. Less DNA is inherited from each ancestor the farther back in time, which impedes proof of the relationship. So autosomal DNA tests are only useful for about five or six generations. The test is useful to link with relatives that are third or fourth cousins but becomes increasingly difficult with more distant relatives. What You Get The main use of autosomal DNA testing is to determine how closely related you are to someone else. This test is useful if little is known about family history, origins, or living relatives. Relatives who are identified as matches by the test are researching the same family lines and will share research and information. Autosomal DNA provides an estimate of ethnicity or the regions where ancestors lived within the last couple hundred years. Testing companies divide the world into various regions to provide an estimate of the percentage of ancestry that comes from each area. This can provide additional clues on where to be searching for more of your family history. Every company offers autosomal DNA tests. X-Chromosome DNA X Chromosome traceable to more ancestors than the mtdna

7 X Chromosome includes DNA from mother's PATERNAL ancestral lines, unlike the mtdna that only traces through her direct maternal ancestral line X Chromosome Tests X-DNA usually included with atdna results Usually X-DNA is not useful by itself Used with other DNA tests Used to support theory Helps focus on likely ancestral line, excludes others Ignored for lack of analysis tools FTDNA has an X-DNA filter tool for matching 3-1: MY RESULTS ARE IN WHAT S NEXT? Y-DNA Analysis Y-DNA STR Comparison This is an example of results received on a Y-DNA test for STRs DYS is the abbreviation for DNA Y-Chromosome Segment. It is the Location on the Y-Chromosome Allele Value is the number of Short Tandem Repeats at that Location on the Y-Chromosome Matches & Genetic Distance (GD) To determine relationships, look for Matches & Calculate Genetic Distance Genetic Distance: # of differences between 2 sets of Y-STR Man #1 and Man #2 match exactly: Genetic Distance = 0 Man #1 and Man #3 differ by 1 at 3 locations: GD = 3 Relationship Estimate Individuals must compare same number of markers (25, 37, 67, 111) Compare STR values based on same # marker test Assume example come from 25 marker tests Man #1 and Man #2 with GD of 0 are Related Man #1 and Man #3 with GD of 3 are Probably Not Related Y-DNA SNP Results Used for Patrilineal Deep Ancestry Each subclade has its own SNP (mutation) First mutation split Haplogroup A into A and B Each mutation divided tree into finer branches Defined by Terminal SNPs New SNP Research is revealing thousands of new SNPs Y-DNA Tree has finer granularity of how branches evolved (more subclades) In past SNPS represented mutations that happened thousands of years ago (deep ancestry) New SNPS in the past years Currently 25,000 SNPs, could reach 250,000 More geographic granularity

8 Possible Family SNPs Y Haplogroup Nomenclature Dramatic increase in SNPs Old Y nomenclature became cumbersome Move to Haplogroup and Terminal SNP 2007 = R1b1c = R1b1b2a1b6b 2009 = R1b1b2a1a2f = R1b1b2a1a2f = R1b1a2a1a1b4b 2012 = R1b1a2a1a1b3a1a1 Now: R-M222 R-M222 = Family names associated with this cluster were almost entirely Irish or Scottish. Differences of STRs & SNPs STRs determine matches within recent times Past 500 years STR changes happen often Can differ between father and son SNPs define Haplogroups Ancient Origins - thousands of years SNP changes happen infrequently SNPs inherited from same ancestor Everyone sharing a particular Y-SNP is related Advantages: Surname inheritance pattern provides powerful technique Reveals ancient origins and genetic relationships Can identify NPEs ( non-paternal events ) Another tool for paternal brick walls Limitations: Can identify NPEs SAME haplotype in close paternal relations Must test a male Lines daughter out Mitochondrial DNA Analysis Testing the Full Mitochondrial Sequence improves matching in genealogical relevant timeframe Match HVR1 = 50% chance common maternal ancestor in last 52 generations (1,300 years) Match HVR1 & HVR2 = 50% chance common maternal ancestor in last 28 generations (700 years) Match Full Sequence = 50% chance common maternal ancestor in last 5 generations (125 years) Results are reported in mtdna References Cambridge Reference Sequence (CRS) Compare to mtdna European Haplogroup H2a2a Differences reported revised Cambridge Reference Sequence (rcrs) Corrected 11 errors in sequencing Reconstructed Sapiens Reference Sequence (RSRS) Represents ancestral genome of Mitochondrial Eve mtdna rcrs Display mtdna Test Shortcomings

9 Female ancestors are difficult to trace because of traditional surname change with marriage Only exact mtdna matches are relevant for genealogical purposes Because mtdna mutations are very rare, the match may not be in a genealogical time frame mtdna Analysis Tips: Complete maternal line as far back as possible Join a mtdna project Upload mtdna results to other databases MitoSearch.org & mtdnacommunity.org Review Privacy policies Contact matches to share information Closest matches first Advanced analysis of FMS Medically-relevant information in coding region Autosomal DNA Analysis atdna is measured in shared centimorgans (cms) & SNPs Matching segment: DNA from common ancestor More DNA shared, closer ancestor is in time Example: Known 2nd cousins share on average cms Shared DNA can represent various relationships Can be aunt, uncle, niece, nephew or third cousin 1X Number vs. Length of segments All small: Distant & multiple relationships Single long: identifiable common ancestor atdna Matching atdna Strategies Concentrate on longest matches Matches under 10 cm could be false positives Contact closest matches Compare Family Trees Common ancestor? Shared surnames Similar locations Strategize Brick Wall solutions Test oldest family members first Test known cousins Map segments from Father & Mother Ethnicity Estimates from Autosomal DNA Breakdown of Ethnicity based on Ancestry Informative Markers (AIMs) Polymorphisms have different frequencies between people from different regions AIMs can estimate ancestor geographical origins and Ethnic percentages mtdna & Y-DNA give maternal or paternal origin atdna provides Admixture (Composite of all of you) Ethnicity is Nearly impossible to predict Cannot represent entire ancestors ethnicity Some DNA inheritance is lost forever Test companies estimate Ethnicity differently

10 Different reference populations, matching thresholds, algorithms Revisions based on new discoveries and/or faulty previous assumptions X Chromosome DNA Analysis Looks at markers on X-chromosome(s) Males have one X from Mother Females have 2 Xs, one from each Parent X-Chromosome has about 155 million base pairs X chromosome & mtdna tests are different Creates unique inheritance pattern Men inherit Mother s mtdna but do not pass Men inherit X-DNA, pass to daughter but not son X-DNA includes Mother s Paternal lines X-DNA has potential for tracing more ancestors X-DNA Inheritance X Chromosome traceable to more ancestors than mtdna X Chromosome includes DNA from mother's PATERNAL ancestral lines, unlike the mtdna that only traces through her direct maternal ancestral line Recombines like atdna X Chromosome Tests X-DNA usually included with atdna results X-DNA Matches are shown with atdna results Helps focus on likely ancestral line, excludes others Large matching in atdna segments indicate close relationship Dealing with Matches Why your Match may not respond Your Match Only Wanted the Ethnicity Estimate Your Match doesn t know his Ancestry Your Match doesn t understand DNA results The Match doesn t think the relationship is possible Your Relationship Isn't Close Enough Your Match Didn't Get the Message Your Message Didn't Say Enough Your Match Is an Adoptee Techniques to increase responses Give Some Attention to Your Profile Use Your Database Page to Send Your Message Don t Ramble or bombard your match with questions Be Specific Don t Include Your Entire Family Tree Don t Take It Personally Don t Stalk Your Matches

11 Offer to Help Your DNA Match References International Society of Genetic Genealogy: