Y-DNA Genetic Testing
|
|
|
- Gwen Chandler
- 6 years ago
- Views:
Transcription
1 Y-DNA Genetic Testing 50 2/24/14
2 Y-DNA Genetic Testing Y-DNA flows from fathers to sons intact SNPs define Y-DNA haplogroups Haplogroups (clans) migrated together Timeframe between mutations is 2,000 to 10,000 years SNPs not very useful for genealogical research 51 2/24/14
3 Path of Y-chromosome DNA 52 2/24/14
4 Y-DNA Differences From mtdna Tests Surnames track with Y-DNA inheritance Y-DNA has another mutation pattern (STRs) Short Tandem Repeats (STRs) are more recent events Timeframe between mutations average 175 years STRs can be very useful for genealogical research 53 2/24/14
5 Short Tandem Repeats (STRs) 54 2/24/14
6 Short Tandem Repeats (STRs) GCC GCC - GCC 55 2/24/14
7 STR Mutations Father Son 3 repeats 5 repeats Father s result reported as: DYS 392 = 3 Son s result reported as: DYS 392 = 5 Marker DYS /24/14
8 Source: National Genealogical Society: Genetic Genealogy The Basics 57 2/24/14
9 Standard Y-DNA Testing Initial Y-DNA tests used 12 STR markers STR pattern is an individual s haplotype Standard tests today use 33 or 37 markers Specific haplotypes are associated with SNP haplogroups Normally haplotypes can predict haplogroups w/o SNP testing 58 2/24/14
10 Standard Y-DNA Testing Source: FamilyTreeDNA Y-DNA Results 59 2/24/14
11 Y-DNA STR Test Results Source: FamilyTreeDNA Y-DNA Results 60 2/24/14
12 Using STR Marker Data 1. Download your data 2. Understand the results 3. Consider joining a DNA Project Surname Project Haplogroup/Haplotype Project Location / Clan Project 61 2/24/14
13 The Smith Surname Group 62 2/24/14
14 DNA Basics Source: FamilyTreeDNA.com 63 2/24/14
15 The Smith Surname Group 64 2/24/14
16 Analysis of Smith Surname STR Data These 7 men have the same haplotype and likely share a recent common ancestor DYS 390 ranges from repeats. C has one more than A & may not share a recent common ancestors Individual F differs by 3 markers from the main haplotype. Likely no recent common ancestor although still haplogroup R1b1. Individual H differs by 5 markers and is a different haplogroup. Definitely no recent common ancestor with any R1b1 members. 65 2/24/14
17 Y-DNA: More markers yields better resolution Family Tree DNA Tests: 12 markers 25 markers 37 markers 67 markers 111 markers Ancestry DNA Tests: 33 markers 46 markers Source: FamilyTreeDNA & Andestry DNA Y-DNA test offerings 66 2/24/14
18 Y-DNA Matches Austin Line (I2b1 / I-M223) (12 Markers) Source: FamilyTreeDNA Y-DNA Results 67 2/24/14
19 Y-DNA Matches Austin Line (I2b1) (37 Markers) Source: FamilyTreeDNA Y-DNA Results 68 2/24/14
20 Y-DNA Matches Austin Line (I2b1) (37 Markers) Source: FamilyTreeDNA Y-DNA Results 69 2/24/14
21 Y-DNA Matches McGuire Line (R1b1) (12 Markers) Source: FamilyTreeDNA Y-DNA Results 70 2/24/14
22 Y-DNA Matches McGuire Line (R1b1) (37 Markers) Source: FamilyTreeDNA Y-DNA Results 71 2/24/14
23 Y-DNA Matches Giroux Line (R1b1) (12 Markers) Source: FamilyTreeDNA Y-DNA Results 72 2/24/14
24 Y-DNA Matches Giroux Line (R1b1) (37 Markers) Source: FamilyTreeDNA Y-DNA Results 73 2/24/14
25 Y-DNA Matches What do you do when you don t have a Haplogroup? The strange case of one VT-FCGS Member 74 2/24/14
26 Y-DNA STR Test Results Each testing company has it s own database of customer DNA results AncestryDNA customers FamilyTreeDNA customers Other companies 75 2/24/14
27 Y-DNA STR Test Results You can search for those common ancestors in a bigger pond!! 76 2/24/14
28 Typical Y-DNA Applications Application Surname Research Relatedness Family Elimination Name Changes & Variations Rare Names Objective Find connections for all people named BRADLEY Are 2 men named ROY related? Narrow down which ADAMS family to investigate Are men named FURST, FIRST & FOERST related? Are Polish & East German KRANSICH families related? Uncertain Paternity Verify Genealogy Research Famous Roots Crossing The Pond Resolve adoption, illegitimacy & other questions Validate traditional written genealogy analysis Prove we re descended from Thomas CHITTENDEN Prove our O REILLY family came from County Mayo 77 2/24/14
29 Warren Lynn Austin, Jr. Born: 1 Feb 1883 Buffalo, NY Buffalo Providence 78 2/24/14
30 Evidence Uncovered In Buffalo, NY Record 1: Baptism of Warren L. Austin, 6 Jun 1884, Riverside M. E. Church, Buffalo Parents: Warren & Edith Austin Birthdate: 1 Feb /24/14
31 Warren L. AUSTIN Warren D. AUSTIN Edith AUSTIN?? 80 2/24/14
32 Evidence Uncovered In Buffalo, NY Record 1: Baptism of Warren L. Austin, 6 Jun 1884, Riverside M. E. Church, Buffalo Parents: Warren & Edith Austin Birthdate: 1 Feb 1883 Record 2: Death card for Warren D. Austin 24 Feb 1884 Austin, Warren D., 24 Feb 1884 Age 28 years, 10 months, 8 days Only son of Zina. 81 2/24/14
33 Warren Lynn Austin, Jr. Born: 1 Feb 1883 Buffalo, NY F: Warren D. Austin dies 1884 in Buffalo M: Edith Lynn AUSTIN dies 1900 in Providence Buffalo Providence 82 2/24/14
34 Warren s Connection to Austin Ancestry U.S. Census: Zina Austin 2 men living in NY and both were right ages Various facts ruled out the family of 2 nd Zina Austin leaving Zina in Saratoga County Zina & Martha had a son, Warren born in 1855 in Day, NY ( 28 yrs, 10 mos, 8 days ) 1860 & 1870 Federal Censuses had Warren with Zina & Martha (Conger) Zina & Martha Austin living in Buffalo (near Warren & Edith Austin) Zina Austin from Day, NY, listed in Some Descendants of Richard Austin - documented ancestry back to 1500 s in England 83 2/24/14
35 Warren s Connection to Austin Ancestry Concerns: No birth certificate for Warren L. Austin No marriage certificate for Warren D. & Edith No other documentation connecting Warren D. & Zina Austin 84 2/24/14
36 Warren s Connection to Austin Ancestry Concerns: No birth certificate for Warren L. Austin No marriage certificate for Warren D. & Edith No other documentation connecting Warren D. & Zina Austin Obtain DNA sample from one of Warren L. Austin s sons (my uncle) Submit to FamilyTreeDNA: tested 17 Apr 2013 results 14 May /24/14
37 Y-DNA Research Validation DNA testing: clearly define the problem you re trying to solve. DNA Question: was Warren descended from Richard Austin b. 1598? Yes?? Then I had an ancestry back to 1500 s in England No?? Back to question who was Warren D. Austin? 86 2/24/14
38 Surname Projects Analyze Haplogroup Data for Relatedness Day, NY Richard (1598) MA Robert (1635) RI John (1647) CT Thomas (1767) MD John (1692) VA William (1750) NC 87 2/24/14
39 Y-DNA Surname Projects 88 2/24/14
40 Y-DNA Surname Projects 89 2/24/14
41 Austin Surname Project Tracks Over 30 American Lines 90 2/24/14
42 Austin Surname Project Tracks Over 30 American Lines Possible Outcomes 1. No matches to any Austin line 2. Match to a different Austin line than Richard 3. Exact match to Richard Austin s haplotype 91 2/24/14
43 Over 250 Austin men have submitted y-dna test results. 92 2/24/14
44 93 2/24/14
45 94 2/24/14
46 Comparisons Straight Maternal & Paternal Ancestry Limited to Only 2 Lines 95 2/24/14
47 Deep Ancestry Straight Maternal & Paternal Ancestry 96 2/24/14
48 Comparisons Autosomal DNA Testing Finds More Relationships Limitation Is 4 to 6 Generations 97 2/24/14
49 Comparisons Which DNA Testing Company Do I Use? 98 2/24/14
50 Comparisons Genetic Genealogy Testing Companies Critical Attributes Expertise Experience Size of existing DNA databases Proven track record Support Cost 99 2/24/14
51 Comparisons Genetic Genealogy Testing Companies My Top Picks 100 2/24/14
52 Comparisons DNA Testing Companies Y-DNA mt-dna at-dna* Medical 23andMe N Y Y?** AncestryDNA Y Y Y N FamilyTreeDNA Y Y Y N * All 3 companies use the Illumina chip for autosomal testing ** FDA currently has hold on 23andMe medical testing 101 2/24/14
53 Comparisons Genetic Genealogy Testing Companies 23andMe AncestryDNA FamilyTreeDNA mt-dna HVR 1 & 2 - $179 $59 Full mt-dna - - $199 Y-DNA 12 Markers - $59 33 Markers - $ Markers - $ Markers - $ Markers - $ Markers - $359 at-dna 682K SNPs $99 709K SNPs $99 976K SNPs $99 (Prices are from company websites as of 21 Feb 2014) 102 2/24/14
54 Conclusions How to Save Money on DNA Tests Join a Surname Project or Haplogroup / Location Project first. Look for promotions at conferences (like this one!!) Remember DNA Day Ancestry.com gives discounts to members Watch company websites for random offers Don t over-test (eg STR markers at the start) 103 2/24/14
55 Comparisons DNA Tests & Test Kits FamilyTreeDNA 104 2/24/14
56 Comparisons DNA Tests & Test Kits AncestryDNA & 23andMe 105 2/24/14
57 Turn-Around Time for DNA Tests Receiving kits 2 weeks 1,2 Completion time Y-DNA 3-4 weeks 1 mt-dna 6-8 weeks 1 Autosomal DNA 3-4 weeks weeks 1 1 FamilyTreeDNA 2 Ancestry DNA 106 2/24/14
58 Conclusions Advice and Warnings Migration Maps & Ethnicity Percentages are speculative Some results provide too many matches (common haplotype) Some results provide too few matches (rare DNA or too few testers) Using these tools requires more work than advertised - sending in the kit is the easy part The key is having a good hypothesis to evaluate Be prepared for NPEs or don t test 107 2/24/14
59 Upcoming Classes 108 2/24/14
60 Tuesday Genealogy Study Groups (6:30 8:00 PM) Interest Group English & Scottish New York Research Irish Genetic Genealogy Week of the Month 1 st Tuesday 2 nd Tuesday 3 rd Tuesday 4 th Tuesday 109 2/24/14
61 Introduction 110 2/24/14
62 Conclusions Genetic Genealogy At Our Library 4 th Tuesday is DNA Night DNA Forums for discussions, questions and answers A focus on French-Canadian genetic patterns & diseases We re Here To Help 111 2/24/14
63 Thank You! Any Questions?? 112 2/24/14
64 113 2/24/14
65 114 2/24/14
66 DNA Basics Y-DNA Haplogroup Migration Source: FamilyTreeDNA.com 115 2/24/14
67 116 2/24/14
68 Source: /24/14
69 The Spread of Haplogroup F Source: Wikimedia Commons ( /24/14
70 Haplogroup R s Dispersion Source: Wikimedia Commons ( /24/14
THE BASICS OF DNA TESTING. By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library
THE BASICS OF DNA TESTING By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library TYPES OF TESTS Mitochondrial DNA (mtdna/mdna) Y-DNA Autosomal DNA (atdna/audna) MITOCHONDRIAL DNA Found
DNA Testing What you need to know first
DNA Testing What you need to know first This article is like the Cliff Notes version of several genetic genealogy classes. It is a basic general primer. The general areas include Project support DNA test
TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter
TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter 1-1: DNA: WHERE DO I START? Definition Genetic genealogy is the application of genetics to traditional genealogy. Genetic genealogy uses genealogical
Recent Results from the Jackson Brigade DNA Project
Recent Results from the Jackson Brigade DNA Project Dr. Daniel C. Hyde Professor Emeritus of Computer Science Bucknell University Lewisburg, PA Presented at Jackson Brigade Reunion, Horner, WV on August
Autosomal-DNA. How does the nature of Jewish genealogy make autosomal DNA research more challenging?
Autosomal-DNA How does the nature of Jewish genealogy make autosomal DNA research more challenging? Using Family Finder results for genealogy is more challenging for individuals of Jewish ancestry because
Pizza and Who do you think you are?
Pizza and Who do you think you are? an overview of one of the newest and possibly more helpful developments in researching genealogy and family history that of using DNA for research What is DNA? Part
Computer - aided Genealogy. Rob Drew
Computer - aided Genealogy Rob Drew Topics Building your family tree Off-line tools for your laptop or desktop at home. What s a gedcom file? Building an on-line tree. Research websites Where to get help
Genetic Genealogy. Using DNA to research your maternal & paternal lines. Ed McGuire. Vermont Genealogy Library 2/24/14
Genetic Genealogy Using DNA to research your maternal & paternal lines Ed McGuire 2/24/14 Introduction Soprano Family Tree 2 2/24/14 Introduction 3 2/24/14 Introduction 4 2/24/14 Introduction Contradictory
Using Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM
Using Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.
Meek DNA Project Group B Ancestral Signature
Meek DNA Project Group B Ancestral Signature The purpose of this paper is to explore the method and logic used by the author in establishing the Y-DNA ancestral signature for The Meek DNA Project Group
DNA Basics. OLLI: Genealogy 101 October 1, ~ Monique E. Rivera ~
DNA Basics OLLI: Genealogy 101 October 1, 2018 ~ Monique E. Rivera ~ WHAT IS DNA? DNA (deoxyribonucleic acid) is found in every living cell everywhere. It is a long chemical chain that tells our cells
! FTDNA! Ancestry. ! 23andMe. ! Medical Considera,ons. ! Iden,fying family medical history. ! Communica,ng with the medical community
by JEFF CARPENTER! Brief Defini,ons about YDNA, XDNA, mtdna, atdna (Covered in Part 1)! Benefits of Tes,ng DNA! Examples of DNA TESTING! FTDNA! Ancestry! 3andMe Jeff Carpenter, 016 jeffcarpenter1939@gmal.com!
Halley Family. Mystery? Mystery? Can you solve a. Can you help solve a
Can you solve a Can you help solve a Halley Halley Family Family Mystery? Mystery? Who was the great grandfather of John Bennett Halley? He lived in Maryland around 1797 and might have been born there.
What Can I Learn From DNA Testing?
What Can I Learn From DNA Testing? From where did my ancestors migrate? What is my DNA Signature? Was my ancestor a Jewish Cohanim Priest? Was my great great grandmother really an Indian Princes? I was
The Meek Family of Allegheny Co., PA Meek Group A Introduction
Meek Group A Introduction In the 1770's a significant number of families named Meek(s) lived in S. W. Pennsylvania and they can be identified in the records of Westmoreland, Allegheny and Washington Counties.
IN THIS ISSUE: February From the Administrator Questions/News...1. George Varner of Missouri Direct Line...2
IN THIS ISSUE: From the Administrator..... 1 Questions/News.......1 George Varner of Missouri Direct Line...2 Do the Newtons & Varners Really Both have Riggs DNA?...2 2016 Newton/Varner Reunion. 5 February
DNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016
DNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016 1 What we will cover How testing helps genealogy What is DNA? How do you select from the three testing companies?
DNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding
DNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding by Dr. Ing. Robert L. Baber 2014 July 26 Rights reserved, see the copyright notice at http://gengen.rlbaber.de
Autosomal DNA. What is autosomal DNA? X-DNA
ANGIE BUSH AND PAUL WOODBURY info@thednadetectives.com November 1, 2014 Autosomal DNA What is autosomal DNA? Autosomal DNA consists of all nuclear DNA except for the X and Y sex chromosomes. There are
Before India: Exploring Your Ancestry With DNA By David G. Mahal
Before India: Exploring Your Ancestry With DNA By David G. Mahal You then receive an email notifying you that your results are ready to explore on utilize your DNA results for family history by Ancestry.com
DNA Opening Doors for Today s s Genealogist
DNA Opening Doors for Today s s Genealogist Presented to JGSI Sunday, March 30, 2008 Presented by Alvin Holtzman Genetic Genealogy Discussion Points What is DNA How can it help genealogists What to expect
DNA TESTING. This is the testing regime for FamilyTreeDNA. Other SNP tests were ordered from Yseq.
DNA & GENEALOGY DNA TESTING This is the testing regime for FamilyTreeDNA. Other SNP tests were ordered from Yseq. Product Date Batch Family Finder 30-May-14 Completed 569 05-Aug-14 Batched 569 05-Jul-14
An O-F3288 Y DNA Discovery for Patrilineal Descendants of James Revell (Accomack) By Marie A. Rundquist, DNA Project Administrator November 2018
Project Scope Rundquist O-F3288 White Paper 11/2018 An O-F3288 Y DNA Discovery for Patrilineal Descendants of James Revell (Accomack) By Marie A. Rundquist, DNA Project Administrator November 2018 The
Every human cell (except red blood cells and sperm and eggs) has an. identical set of 23 pairs of chromosomes which carry all the hereditary
Introduction to Genetic Genealogy Every human cell (except red blood cells and sperm and eggs) has an identical set of 23 pairs of chromosomes which carry all the hereditary information that is passed
The Meek Family of Allegheny Co., PA Meek Group A Introduction
Meek Group A Introduction In the 1770's a significant number of families named Meek(s) lived in S. W. Pennsylvania and they can be identified in the records of Westmoreland, Allegheny and Washington Counties.
Meek/Meeks Families of Virginia Meek Group F Introduction
Meek Group F Introduction The Meek/Meeks DNA Project 1 has established Y-DNA signatures 2 for a significant number of early American ancestors based on tests of living descendants. This allows for a determination
DNA: UNLOCKING THE CODE
DNA: UNLOCKING THE CODE Connecting Cousins for Genetic Genealogy Bryant McAllister, PhD Associate Professor of Biology University of Iowa bryant-mcallister@uiowa.edu Iowa Genealogical Society April 9,
Getting the Most Out of Your DNA Matches
Helen V. Smith PG Dip Public Health, BMedLabSci, ADCLT, Dip. Fam. Hist. PLCGS 46 Kraft Road, Pallara, Qld, 4110 Email: HVSresearch@DragonGenealogy.com Website: www.dragongenealogy.com Blog: http://www.dragongenealogy.com/blog/
BETTER TOGETHER: MAKING YOUR CASE WITH DOCUMENTS AND DNA BCG-sponsored Webinar (https://bcgcertification.org) Patricia Lee Hobbs, CG
BETTER TOGETHER: MAKING YOUR CASE WITH DOCUMENTS AND DNA BCG-sponsored Webinar (https://bcgcertification.org) Patricia Lee Hobbs, CG LIMITATIONS & BENEFITS OF DNA TESTING DNA test results do not solve
Genetic Genealogy Journey DNA Projects by Debbie Parker Wayne, CG SM, CGL SM
Genetic Genealogy Journey DNA Projects by Debbie Parker Wayne, CG SM, CGL SM Genealogy can be a solitary pursuit. Genealogists sometimes collaborate to work on common lines, but lone researchers can perform
Your Family 101 Beginning Genealogical Research
Your Family 101 Beginning Genealogical Research What Will We Cover Today? Session 1: Getting Started Session 2: Your Resources Session 3: Common Mistakes and Pitfalls Session 4: DNA Testing and Medical
Mitochondrial DNA (mtdna) JGSGO June 5, 2018
Mitochondrial DNA (mtdna) JGSGO June 5, 2018 MtDNA - outline What is it? What do you do with it? How do you maximize its value? 2 3 mtdna a double-stranded, circular DNA that is stored in mitochondria
Genetic Genealogy. Rules and Tools. Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter
Genetic Genealogy Rules and Tools Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter I am NOT this guy! 2 Genealogy s Newest Tool Genealogy research: Study of Family History Identifies
An Introduction to Genetic Genealogy
An Introduction to Genetic Genealogy David A. Pike dapike@math.mun.ca Presented To: Family History Society of Newfoundland and Labrador 24 January 2006 Slide 1 of 21 Overview Genetic Genealogy using genetic
Getting the Most of Your DNA Test. Friends of Irish Research Richard Reid
Getting the Most of Your DNA Test Friends of Irish Research Richard Reid So You Have Been Tested! The results are back and now is time to explore and see if any of your brick walls can be broken down.
DNA Testing. February 16, 2018
DNA Testing February 16, 2018 What Is DNA? Double helix ladder structure where the rungs are molecules called nucleotides or bases. DNA contains only four of these nucleotides A, G, C, T The sequence that
An Introduction. Your DNA. and Your Family Tree. (Mitochondrial DNA) Presentation by: 4/8/17 Page 1 of 10
An Introduction Your DNA and Your Family Tree (Mitochondrial DNA) Presentation by: FredCoffey@aol.com 4/8/17 Page 1 of 10 Coffey Surname, y-dna Project We're now ready to move on and look at the type of
Genealogical Research
DNA, Ancestry, and Your Genealogical Research Walter Steets Houston Genealogical Forum DNA Interest Group March 2, 2019 1 Today s Agenda Brief review of basic genetics and terms used in genetic genealogy
DAR POLICY STATEMENT AND BACKGROUND Using DNA Evidence for DAR Applications
Effective January 1, 2014, DAR will begin accepting Y-DNA evidence in support of new member applications and supplemental applications as one element in a structured analysis. This analysis will use a
GEDmatch Home Page The upper left corner of your home page has Information about you and links to lots of helpful information. Check them out!
USING GEDMATCH Created March 2015 GEDmatch is a free, non-profit site that accepts raw autosomal data files from Ancestry, FTDNA, and 23andme. As such, it provides a large autosomal database that spans
Using X-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM
Using X-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.
Eller DNA Project. Status Report for Nashville EFA Conference----July 25, Tom Eller, DNA Project Administrator
Eller DNA Project Status Report for Nashville EFA Conference----July 25, 2009 Tom Eller, DNA Project Administrator Eller DNA Project This presentation used material from Family Tree DNA and from World
DNA for Genealogy Librarians. Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District
DNA for Genealogy Librarians Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District What does DNA do? It replicates itself. It codes for the production
DNA and Ancestry. An Update on New Tests. Steve Louis. Jewish Genealogical Society of Washington State. January 13, 2014
DNA and Ancestry An Update on New Tests Steve Louis Jewish Genealogical Society of Washington State January 13, 2014 DISCLAIMER This document was prepared as a result of independent work and opinions of
Welcome to this issue of Facts & Genes, the only publication devoted to Genetic Genealogy.
Facts & Genes from Family Tree DNA ================================== March 3, 2004 Volume 3, Issue 2 In This Issue ============= Editor's Corner In the News: Family Tree DNA Announcements Haplogroups:
Using Mitochondrial DNA (mtdna) for Genealogy Debbie Parker Wayne, CG, CGL SM
Using Mitochondrial DNA (mtdna) for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical
Genealogy Report of Alejandro Lorenzetti Tarabelli
Genealogy Report of Alejandro Lorenzetti Tarabelli My name is Donald Martin Mattos Lorenzetti, Mattos is my paternal surname, and Lorenzetti my maternal surname. For years my maternal family and I have
DNA Haplogroups Report
DNA Haplogroups Report for Matthew Mayberry Generated and printed on Sep 25 2011, 01:59 pm X This is a mtdna Haplogroup Report This is a mtdna Subclade Report Search criteria used in this report: HVR-1
DOWNLOAD OR READ : NEW ENGLAND ANCESTRY OF GROVER CLEVELAND PRESIDENT OF THE UNITED STATES OF AMERICA PDF EBOOK EPUB MOBI
DOWNLOAD OR READ : NEW ENGLAND ANCESTRY OF GROVER CLEVELAND PRESIDENT OF THE UNITED STATES OF AMERICA PDF EBOOK EPUB MOBI Page 1 Page 2 new england ancestry of grover cleveland president of the united
Your mtdna Full Sequence Results
Congratulations! You are one of the first to have your entire mitochondrial DNA (DNA) sequenced! Testing the full sequence has already become the standard practice used by researchers studying the DNA,
Tracing Your Roots. Virginia Shepherd Department of Teaching and Learning Vanderbilt University. January 19, 2018
Tracing Your Roots Virginia Shepherd Department of Teaching and Learning Vanderbilt University January 19, 2018 Getting Started If you have no idea where to start I hope to help you begin that journey
Walter Steets Houston Genealogical Forum DNA Interest Group April 7, 2018
Ancestry DNA and GEDmatch Walter Steets Houston Genealogical Forum DNA Interest Group April 7, 2018 Today s agenda Recent News about DNA Testing DNA Cautions: DNA Data Used for Forensic Purposes New Technology:
Introduction to Autosomal DNA Tools
GENETIC GENEALOGY JOURNEY Debbie Parker Wayne, CG, CGL Introduction to Autosomal DNA Tools Just as in the old joke about a new genealogist walking into the library and asking for the book that covers my
Learn what to do with results of autosomal DNA testing from AncestryDNA. Tools: AncestryDNA results; ancestry.com, gedmatch.com and familytreedna.
First Look : AncestryDNA When You First Get Your AncestryDNA Results Objective: Learn what to do with results of autosomal DNA testing from AncestryDNA. Tools: AncestryDNA results; ancestry.com, gedmatch.com
Report on the VAN_TUYL Surname Project Y-STR Results 3/11/2013 Rory Van Tuyl
Report on the VAN_TUYL Surname Project Y-STR Results 3/11/2013 Rory Van Tuyl Abstract: Recent data for two descendants of Ott van Tuyl has been added to the project, bringing the total number of Gameren
First Results: Intro to FamilyTreeDNA s Family Finder. Learn what to do with results of autosomal DNA testing with FamilyTreeDNA (FTDNA).
First Results: Family Tree DNA When You First Get Your FamilyTreeDNA (FTDNA) Results Objective: Learn what to do with results of autosomal DNA testing with FamilyTreeDNA (FTDNA). Tools: familytreedna.com
[CLIENT] SmithDNA1701 DE January 2017
![[CLIENT] SmithDNA1701 DE January 2017](/thumbs/93/113058427.jpg "[CLIENT] SmithDNA1701 DE January 2017")
[CLIENT] SmithDNA1701 DE1704205 11 January 2017 DNA Discovery Plan GOAL Create a research plan to determine how the client s DNA results relate to his family tree as currently constructed. The client s
Approaching and Connecting with Your DNA Matches
Approaching and Connecting with Your DNA Matches Shannon Stewart Christmas, MCP throughthetreesblog@gmail.com Understand DNA Tests The four types of DNA and the relevant test companies Segment triangulation
Presentation for BCG Webinar, April 2016
Finding Your Early 1800 s US Ancestors Online Presentation for BCG Webinar, April 2016 James M. Baker, PhD, CG jimb@starstream.net Data Type Comments Online Sources 1. US 1850 census lists everyone and
Walter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018
DNA, Ancestry, and Your Genealogical Research- Segments and centimorgans Walter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018 1 Today s agenda Brief review of previous DIG session
Family Tree DNA Genetic Genealogy Started Here
Family Tree DNA Genetic Genealogy Started Here With 253,000 samples in our DNA database (the largest of its kind in the world) your genealogical search could become even easier Why Bennett Greenspan founded
Learn what to do with results of autosomal DNA testing from AncestryDNA.
When You First Get Your AncestryDNA Results Objective: Learn what to do with results of autosomal DNA testing from AncestryDNA. Tools: AncestryDNA results; ancestry.com, genesis.gedmatch.com and familytreedna.com
Kenneth Nordtvedt. Many genetic genealogists eventually employ a time-tomost-recent-common-ancestor
Kenneth Nordtvedt Many genetic genealogists eventually employ a time-tomost-recent-common-ancestor (TMRCA) tool to estimate how far back in time the common ancestor existed for two Y-STR haplotypes obtained
Clan Galbraith Association Application for or Renewal of Membership
Clan Galbraith Association Application for or Renewal of Membership ELIGIBILITY FOR MEMBERSHIP: Membership in the Clan Galbraith Association is open to any person related by blood or marriage to the Galbraith
CAGGNI s DNA Special Interest Group
CAGGNI s DNA Special Interest Group 10 Jan 2015 Al & Michelle Wilson Agenda Survey Basics in Fan Charts Recombination Exercise Triangulation Overview Survey 1. Have you taken (or sponsored) a DNA test?
The DNA Signature of the Dál gcais
The DNA Signature of the Dál gcais We are merely the present-day custodians of our Ancestor s genes. 1 Dennis Wright 2014 My Paper Genealogy Researching for 40 years 2 My Paper Genealogy Researching for
Big Y-700 White Paper
Big Y-700 White Paper Powering discovery in the field of paternal ancestry Authors: Caleb Davis, Michael Sager, Göran Runfeldt, Elliott Greenspan, Arjan Bormans, Bennett Greenspan, and Connie Bormans Last
The Kaighins of Scaresdale, Kirk German, Isle of Man
The Kaighins of Scaresdale, Kirk German, Isle of Man Greg Kaighin May 16, 2015 Background After twelve years of research, the parents of John Kaighin (Family 7600) 1 of Kirk German, Isle of Man have finally
Ewing Surname Y-DNA Project Article 8
Ewing Surname Y-DNA Project Article 8 This is the eighth in a series of articles about the Ewing Surname Y-DNA Project. The previous seven articles have appeared in the last seven issues of the Journal
DNA Solu)ons for Brick Walls And Adop)on
DNA Solu)ons for Brick Walls And Adop)on "I have not failed. I've just found ten thousand ways that won't work." Thomas Edison Wise Woman Gene+c Genealogy Comments Listen Carefully! 1. DNA is not the be
Genetic Genealogy Journey Why Is My Cousin Not on my DNA Match List? Debbie Parker Wayne, CG SM, CGL SM
Genetic Genealogy Journey Why Is My Cousin Not on my DNA Match List? Debbie Parker Wayne, CG SM, CGL SM The CSI television shows have conditioned us to expect exact DNA matches and lead us to think DNA
Your Family Tree Online: How To Trace Your Ancestry From Your Own Computer By Graeme Davis READ ONLINE
Your Family Tree Online: How To Trace Your Ancestry From Your Own Computer By Graeme Davis READ ONLINE Family History Wiki; Ancestry Academy; More; Publish; Download expert advice for tackling your research
Using Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM
Using Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.
FREQUENTLY ASKED QUESTIONS ABOUT THE OWSTON/OUSTON DNA PROJECT
FREQUENTLY ASKED QUESTIONS ABOUT THE OWSTON/OUSTON DNA PROJECT 1. What has been discovered thus far and what may be discovered with testing? The Owston/Ouston DNA project grew out of the combined genealogical
Tools: 23andMe.com website and test results; DNAAdoption handouts.
When You First Get Your 23andMe Results Objective: Learn what to do with results of atdna testing with 23andMe. Tools: 23andMe.com website and test results; DNAAdoption handouts. Exercises: Practice Exercises
Appendix III - Analysis of Non-Paternal Events
Appendix III - Analysis of Non-Paternal Events Summary One of the challenges that genetic genealogy researchers face when carrying out Y-DNA testing on groups of men within a family surname study is to
The DNA Case for Bethuel Riggs
The DNA Case for Bethuel Riggs The following was originally intended as an appendix to Alvy Ray Smith, Edwardian Riggses of America I: Elder Bethuel Riggs (1757 1835) of Morris County, New Jersey, and
DNA, A Genealogy Tool. The Search for an Expert Genealogist, Photos & Clues
DNA, A Genealogy Tool The Search for an Expert Genealogist, Photos & Clues mydanishancestors.com *Slide Show shared in this class & more web-sites under Toolbar/DNA *One doesn t have to have Danish ancestors
The Structure of DNA Let s take a closer look at how this looks under a microscope.
DNA Basics Adapted from a MyHeritage Blog and the International Society of Genetic Genealogy (ISOGG) Wiki by Earl Cory MyHeritage has started a series to explain DNA, how it works and answer the most common
A Day Out With Your DNA
A Day Out With Your DNA Diahan Southard www.yourdnaguide.com Your testing company has evaluated around 800,000 locations on your DNA to help them determine your origins and your genetic cousins. While
[CLIENT] Dean1412 R March Research Highlights
![[CLIENT] Dean1412 R March Research Highlights](/thumbs/87/96071363.jpg "[CLIENT] Dean1412 R March Research Highlights")
[CLIENT] Dean1412 R14121 12 March 2015 Research Highlights GOALS Review DNA test results to determine if they provide any evidence for the parents of Charles Noble Dean or provide direction for future
Tracking Your Roots With DNA
Tracking Your Roots With DNA Genetic Genealogy Lisa R Franklin RN,BSN 31 Oct 2013/27 Jun 2014 Andalusia, Alabama Why DNA test? Determine if two people are related Determine if two people descend from the
Contributed by "Kathy Hallett"
National Geographic: The Genographic Project Name Background The National Geographic Society is undertaking the ambitious process of tracking human migration using genetic technology. By using the latest
Walter Steets Houston Genealogical Forum DNA Interest Group May 5, 2018
GEDmatch: The Golden State Killer Tier 1 Tools Walter Steets Houston Genealogical Forum DNA Interest Group May 5, 2018 1 Today s agenda Walter s Take on DNA Developments Growth in Number of DNA Testers
company does improve its ethnicity estimates, your profile will automatically be updated, too. You won't have to retake the test to get the new
Ancestry dna kit The Y-DNA test is more limited than the ones from Family Tree DNA Does not offer a less expensive 'autosomal DNA-only' test Can't connect with other matches Can't upload raw data from
When I started my genealogy
Beyond the paper records When I started my genealogy research a few years after my father died in 1989, the only information I had on my paternal grandfather was his name, Richard Frederick Meates, and
Finding a Male Hodge(s) Descendant for Y-Chromosome DNA Testing. Prepared by Jan Alpert
Finding a Male Hodge(s) Descendant for Y-Chromosome DNA Testing Prepared by Jan Alpert Why Test Male Y-Chromosome DNA All males carry the Y-Chromosome of their fathers As a result the same DNA markers
Genealogy Report of Alejandro Lorenzetti Tarabelli
Genealogy Report of Alejandro Lorenzetti Tarabelli My name is Donald Martin Mattos Lorenzetti, Mattos is my paternal surname, and Lorenzetti my maternal surname. For years my maternal family and I have
Métis Genealogical Centre of Canada Central Processing Office for Canadian Métis Council-IT
1 Official genealogical centre of the Canadian Métis Council Intertribal For research to begin please forward the following information: Copy of Photo I.D. Long Form Birth Certificate or Baptismal Record
Advanced Autosomal DNA Techniques used in Genetic Genealogy
Advanced Autosomal DNA Techniques used in Genetic Genealogy Tim Janzen, MD E-mail: tjanzen@comcast.net Summary of Chromosome Mapping Technique The following are specific instructions on how to map your
Putting the genes into genealogy
Putting the genes into genealogy DNA testing can help find lost branches of your family tree. Susan C Meates describes how DNA surname projects work DNA testing for genealogy has been available since 2000,
Genetic Identity and
Genetic Identity and GACATGTAGCTCTTCACTTCACCCAGGTTGGGTTGTGTCAACAGGAAACATTGTAACATATCACTTGGATTAGCACCTAGG/TTAT/TTAT/TTA Community DTC Genetic Testing Workshop The National Academies' August 31 September 1,
For research to begin please forward the following information:
Official genealogical centre of the Canadian Métis Council For research to begin please forward the following information: Copy of Photo I.D. Long Form Birth Certificate or Baptismal Record of client with
Walter Steets Houston Genealogical Forum DNA Interest Group January 27, 2018
Using Ancestry DNA and Third-Party Tools to Research Your Shared DNA Segments Walter Steets Houston Genealogical Forum DNA Interest Group January 27, 2018 1 Today s agenda Brief review of previous DIG
Make payable to MGCC for genealogy ONLY
Official genealogical centre of the Canadian Métis Council Intertribal For research to begin please forward the following information: Copy of Photo I.D. Long Form Birth Certificate or Baptismal Record
Origins: Coffey/Keogh Families By Fred Coffey. ONLINE:
Origins: Coffey/Keogh Families By Fred Coffey ONLINE: http://www.coffey.ws/familytree/dna/origins-coffeykeoghfamilies.pdf My name is Coffey, and I m very interested in working out the origins of my family.
13 Reasons You Can t Break Down Your Brick Wall and Find the Family History Information You Need. 5 April 2018
13 Reasons You Can t Break Down Your Brick Wall and Find the Family History Information You Need 5 April 2018 1. You re Searching Too Specifically You re looking for an ancestor by their name as you know
Oscar Ewing and His DNA Odyssey Jane Gilbert ( , hokiejane at yahoo dot com)
62 Journal of Clan Ewing Vol. 13, No. 4 (November 2007) Oscar Ewing and His DNA Odyssey Jane Gilbert (+1 410.569.9913, hokiejane at yahoo dot com) For me, researching my family history is like putting
WINSLOW HERITAGE SOCIETY ~~~~~~~~~~~~~~~~~~
Newsletter, Vol. 2, No. 1 March, 2015 WINSLOW HERITAGE SOCIETY ~~~~~~~~~~~~~~~~~~ In Vol. 1, No. 1 of the Winslow Heritage Society Newsletter, Kathy Myers, Society Governor, a descendant of Kenelm Winslow,
Techniques on how to use websites for Cherokee Research, Part 1 & 2
Techniques on how to use websites for Cherokee Research, Part 1 & 2 April 8, 2014 Gene Norris, Genealogist Cherokee National Historical Society, Inc. Tahlequah, Cherokee Nation www.ancestry.com Although