The DNA Signature of the Dál gcais

Size: px
Start display at page:

Download "The DNA Signature of the Dál gcais"

Transcription

1 The DNA Signature of the Dál gcais We are merely the present-day custodians of our Ancestor s genes. 1 Dennis Wright 2014

2 My Paper Genealogy Researching for 40 years 2

3 My Paper Genealogy Researching for 40 years Brickwall in New Zealand 3

4 My Paper Genealogy Researching for 40 years Brickwall in New Zealand Bryan Sykes Seven Daughters of Eve 4

5 My Paper Genealogy Researching for 40 years Brickwall in New Zealand Bryan Sykes Seven Daughters of Eve Genetic testing sounded like a tool I could use 5

6 Introduction to Genetic Genealogy Wright surname project 6

7 Introduction to Genetic Genealogy Wright surname project Tested 12 markers with Family Tree DNA 7

8 Introduction to Genetic Genealogy Wright surname project Tested 12 markers with Family Tree DNA No matches 8

9 Introduction to Genetic Genealogy Wright surname project Tested 12 markers with Family Tree DNA No matches 12 Markers insufficient for meaningful matching 9

10 Further Genetic Testing 43 marker testing with DNA Heritage 10

11 Further Genetic Testing 43 marker testing with DNA Heritage R1b Haplotype 11

12 Further Genetic Testing 43 marker testing with DNA Heritage R1b Haplotype Common in Western Europe Spain to Ireland 12

13 Further Genetic Testing 43 marker testing with DNA Heritage R1b Haplotype Common in Western Europe Spain to Ireland AMH Atlantic Modal Haplotype 13

14 Further Genetic Testing 43 marker testing with DNA Heritage R1b Haplotype Common in Western Europe Spain to Ireland AMH Atlantic Modal Haplotype.... My values at DYS459=8,9 and My values at DYS464=13,13,15,16 14

15 DNA forum at Rootsweb 15

16 DNA forum at Rootsweb Questioned my DYS459 and DYS464 values 16

17 DNA forum at Rootsweb Questioned my DYS459 and DYS464 values Dr Ken Nordtvedt had seen these values before 17

18 DNA forum at Rootsweb Questioned my DYS459 and DYS464 values Dr Ken Nordtvedt had seen these values before Appeared to be Irish a third cluster 18

19 A Name for this Cluster Previously identified Irish clusters 19

20 A Name for this Cluster Previously identified Irish clusters NW Irish the Ui Néill South Irish Eóganacht? 20

21 A Name for this Cluster Previously identified Irish clusters NW Irish the Ui Néill South Irish Eóganacht? Irish Type III as a name for this third cluster 21

22 Irish Type III How common was this signature? 22

23 Irish Type III How common was this signature? Ysearch database 23

24 Irish Type III How common was this signature? Ysearch database 8 Irish Type III matches, of which 4 were Irish, then 50 with 17 Irish from Clare, Limerick and Tipperary, 3 English and 1 Scottish. 24

25 Irish Type III How common was this signature? Ysearch database 8 Irish Type III matches, of which 4 were Irish, then 50 with 17 Irish from Clare, Limerick and Tipperary, 3 English and 1 Scottish. Names found O Brien, Casey, Crow 25

26 Irish Type III website Set up in December

27 Irish Type III website Set up in December 2006 By June haplotypes in database 27

28 Origins of Irish Type III? O Brien was a commonly found name together with variants Bryan and Bryant as were Hogan, Kennedy, Casey and Crow. 28

29 Surnames seen in current database O Brien 50 (O )Bryan(t) 42 Casey 33 Crow(e) 29 Kennedy 29 Hogan 28 McCraw McGra(w)(th) 26 (O )Mahony Maloney 20 Kelly 19 Butler 15 Hart(igan) 14 Carey 13 O Neill Neal 13 Lynch 12 McNamara 11 Cain(e) Kane Keane 11 29

30 Origins of Irish Type III? O Brien was a commonly found name together with variants Bryan and Bryant as were Hogan, Kennedy, Casey and Crow Study the Irish Pedigrees Dalcassian surnames 30

31 Origins of Irish Type III? O Brien was a commonly found name together with variants Bryan and Bryant as were Hogan, Kennedy, Casey and Crow Study the Irish Pedigrees Dalcassian 85% from Ireland 70% from Clare, Limerick, Tipperary and Cork when county known 31

32 Origins of Irish Type III? O Brien was a commonly found name together with variants Bryan and Bryant as were Hogan, Kennedy, Casey and Crow Study the Irish Pedigrees Dalcassian 85% from Ireland 70% from Clare, Limerick, Tipperary and Cork when county known The O Brien, Lord Inchiquin is Irish Type III 32

33 33 Origins of the Dál gcais

34 non-dalcassian surnames Why do non-dalcassian names carry this signature? 34

35 non-dalcassian surnames Why do non-dalcassian names carry this signature? Not all are NPEs 35

36 non-dalcassian surnames Why do non-dalcassian names carry this signature? Not all are NPEs Allegiance to the leader 36

37 non-dalcassian surnames Why do non-dalcassian names carry this signature? Not all are NPEs Allegiance to the leader Adoptions 37

38 non-dalcassian surnames Why do non-dalcassian names carry this signature? Not all are NPEs Allegiance to the leader Adoptions Taking wife s name on Property Inheritance 38

39 non-dalcassian surnames Why do non-dalcassian names carry this signature? Not all are NPEs Allegiance to the leader Adoptions Taking wife s name on Property Inheritance My personal explanation 39

40 non-dalcassian surnames Why do non-dalcassian names carry this signature? Not all are NPEs Allegiance to the leader Adoptions Taking wife s name on Property Inheritance My personal explanation John O Brien, convict John Wright, blacksmith 40

41 Age of the Irish Type III cluster Initial mutation rate calculations 1,000 years old 41

42 Age of the Irish Type III cluster Initial mutation rate calculations 1,000 years old Anatole Klyosov calculated Irish Type III as 1175 ±135 years old so originated AD 42

43 Age of the Irish Type III cluster Initial mutation rate calculations 1,000 years old Anatole Klyosov calculated Irish Type III as 1175 ±135 years old so originated AD Could be Centuries older? 43

44 Significant Irish Type III Markers As well as DYS459 and DYS464 several other markers differ from the AMH 44

45 45 The DNA Signature of Dál gcais

46 McEvoy, Simms and Bradley paper Genetic Investigation of the Patrilineal Kinship Structure of Early Medieval Ireland 2008 Am J Phys Anthropol Aug;136(4):

47 McEvoy, Simms and Bradley paper Genetic Investigation of the Patrilineal Kinship Structure of Early Medieval Ireland 2008 The data used consisted of only 17 markers 47

48 McEvoy, Simms and Bradley paper Genetic Investigation of the Patrilineal Kinship Structure of Early Medieval Ireland 2008 The data used consisted of only 17 markers Definitive Irish Type III markers DYS459 and DYS464 were not used 48

49 Journal of Genetic Genealogy A Set of Distinctive Markers Defines a Y-STR Signature for Gaelic Dalcassian Families 49

50 Journal of Genetic Genealogy A Set of Distinctive Markers Defines a Y-STR Signature for Gaelic Dalcassian Families Dál gcais signature known since

51 FTDNA Walk the Y Extended SNP test over 100,000 bases in

52 FTDNA Walk the Y Extended SNP test over 100,000 bases in Irish Type III men contributed $75 each to have a member tested 52

53 FTDNA Walk the Y Extended SNP test over 100,000 bases in Irish Type III men contributed $75 each to have a member tested Kevin O Brien selected as he:- Matched the Irish Type III modal at 25 markers Was an O'Brien, the principal family of the Dalcassians Could demonstrate his pedigree originated in Co. Clare, Ireland Had tested 76 markers 53

54 New SNP found L226 At position , Thomas Krahn found Kevin O Brien to be derived T rather than ancestral C He named this SNP, L226 54

55 Was L226 Definitive for Irish Type III? L226 available to order October

56 Was L226 Definitive for Irish Type III? L226 available to order October 2009 Three possibilities:- L226 is a 'private' marker found only in Kevin O'Brien and his immediate family (perhaps back years). L226 is a defining marker for the Irish Type III cluster and appears in no other clusters. (so perhaps 800-1,200 years old) L226 is downstream of L21 but occurs more generally, across several clusters. (Perhaps 1,500-3,000 years old) 56

57 Was L226 Definitive for Irish Type III? L226 available to order October 2009 Those with Irish Type III signature all L226+ Those non-irish Type III all L226-57

58 L226 is Definitive for Dál gcais L226 available to order October 2009 Those with Irish Type III signature all L226+ Those non-irish Type III all L226- L226 is shown to be defining for the Dál gcais 58

59 R-L226 Project started at FTDNA In Dec 2009 the R-L226 project was started L226_Project/default.aspx Or Google R-L226 FTDNA 59

60 R-L226 Project started at FTDNA In Dec 2009 the R-L226 project was started L226_Project/default.aspx Or Google R-L226 FTDNA 200 members in

61 R-L226 Project started at FTDNA In Dec 2009 the R-L226 project was started L226_Project/default.aspx Or Google R-L226 FTDNA 200 members in 2014 Results separated into STR clusters/branches 61

62 Number of Dál gcais haplotypes 940 distinct haplotypes in the database 740 viewable in public database TRMarkersResults2007.xlsx The balance are, Sorenson, Ancestry and Surname projects without FTDNA Kit Numbers 62

63 Next Generation Sequencing, NGS FTDNA launches Big-Y in November

64 Next Generation Sequencing, NGS FTDNA launches Big-Y in November 2013 Searches 12 million bases on the Y 64

65 Next Generation Sequencing, NGS FTDNA launches Big-Y in November 2013 Searches 12 million bases on the Y Checks 36,564 known SNPs 65

66 Next Generation Sequencing, NGS FTDNA launches Big-Y in November 2013 Searches 12 million bases on the Y Checks 36,564 known SNPs Finds new or novel SNPs 66

67 Next Generation Sequencing, NGS FTDNA launches Big-Y in November 2013 Searches 12 million bases on the Y Checks 36,564 known SNPs Finds new or novel SNPs Six Irish Type III men signed up for testing 67

68 Big-Y Results 20 SNPs parallel to L226 68

69 Big-Y Results 20 SNPs parallel to L226 Are they before or after the emergence of L226? 69

70 Big-Y Results 20 SNPs parallel to L226 Are they before or after the emergence of L226? Two new Branching SNPs FGS5628 and DC1 70

71 Big-Y Results 20 SNPs parallel to L226 Are they before or after the emergence of L226? Two new Branching SNPs FGS5628 and DC1 FGC5628 an early branch as five of the six +ve 71

72 Big-Y Results 20 SNPs parallel to L226 Are they before or after the emergence of L226? Two new Branching SNPs FGS5628 and DC1 FGC5628 an early branch as five of the six +ve DC1 a later branch with two of the five DC1+ 72

73 Big-Y Results 20 SNPs parallel to L226 Are they before or after the emergence of L226? Two new Branching SNPs FGS5628 and DC1 FGC5628 an early branch as five of the six +ve DC1 a later branch with two of the five DC1+ 5 to 29 Private SNPs 73

74 Big-Y Results 20 SNPs parallel to L226 Are they before or after the emergence of L226? Two new Branching SNPs FGS5628 and DC1 FGC5628 an early branch as five of the six +ve DC1 a later branch with two of the five DC1+ 5 to 29 Private SNPs Some may be found to be further branches 74

75 Position of L226 Under L21 there is a chain to L226 L21 > DF13 > Z253 > Z2534 > L226 75

76 Time of separation from Z2534 Average 15.7 Private SNPs from L226 in our 6 men 76

77 Time of separation from Z2534 Average 15.7 Private SNPs from L226 in our 6 men 1175 years to MRCA / 15.7 SNPs is 74.8years/SNP 77

78 Time of separation from Z2534 Average 15.7 Private SNPs from L226 in our 6 men 1175 years to MRCA / 15.7 SNPs is 74.8years/SNP 21 SNPs parallel to L226 x 74.8 is 1,570 years 78

79 Time of separation from Z2534 Average 15.7 Private SNPs from L226 in our 6 men 1175 years to MRCA / 15.7 SNPs is 74.8years/SNP 21 SNPs parallel to L226 x 74.8 is 1,570 years MRCA for Dál gcais lived AD so Dál gcais branched from Z2534, 1, BC 79

80 Time of separation from Z2534 Average 15.7 Private SNPs from L226 in our 6 men 1175 years to MRCA / 15.7 SNPs is 74.8years/SNP 21 SNPs parallel to L226 x 74.8 is 1,570 years MRCA for Dál gcais lived AD so Dál gcais branched from Z2534, 1, BC This may well explain the distinctive STR signature of the Dál gcais 80

81 The Year of Brian Bóruma The most famous Dalcassian Brian Boru Brian Bóruma mac Cennétig

82 The Year of Brian Bóruma The most famous Dalcassian Brian Boru Brian Bóruma mac Cennétig Battle of Clontarf 23 April

83 Brian Boru Millennium Many re-enactments in 2014 Born at Killaloe Ruled Ireland from palace at Kincora, Killaloe Anointed King of Ireland at Rock of Cashel Killed at Clontarf, Dublin 23 April 1014 Buried at Armagh 83

84 The DNA Signature of the Dál gcais Dál gcais DNA lives on in thousands of men throughout the world 84

85 The DNA Signature of the Dál gcais Dál gcais DNA lives on in thousands of men throughout the world I am truly proud to be part of this significant clan 85

86 Thank You We are merely the present-day custodians of our Ancestor s genes 86

Chart 2 Group A, 37-Marker Level Entire R1b-M222 Group Generations to Include MRCA at 99% Probability

Chart 2 Group A, 37-Marker Level Entire R1b-M222 Group Generations to Include MRCA at 99% Probability Chart 2 Group A, 37-Marker Level Entire R1b-M222 Group Generations to Include MRCA at 99% Probability 18 Irish R1b-M222 Section Overview The members of this group demonstrate a wide web of linkage over

More information

What Can I Learn From DNA Testing?

What Can I Learn From DNA Testing? What Can I Learn From DNA Testing? From where did my ancestors migrate? What is my DNA Signature? Was my ancestor a Jewish Cohanim Priest? Was my great great grandmother really an Indian Princes? I was

More information

Subgroup A2: Reilly-McGovern Cluster

Subgroup A2: Reilly-McGovern Cluster Subgroup A2: Reilly-McGovern Cluster Charts 15 & 16 below shows the names and origins for the members of this cluster, except for the Faughnans, who are placed with the A2 Various Lineages for economy

More information

Y-DNA Genetic Testing

Y-DNA Genetic Testing Y-DNA Genetic Testing 50 2/24/14 Y-DNA Genetic Testing Y-DNA flows from fathers to sons intact SNPs define Y-DNA haplogroups Haplogroups (clans) migrated together Timeframe between mutations is 2,000 to

More information

Meek DNA Project Group B Ancestral Signature

Meek DNA Project Group B Ancestral Signature Meek DNA Project Group B Ancestral Signature The purpose of this paper is to explore the method and logic used by the author in establishing the Y-DNA ancestral signature for The Meek DNA Project Group

More information

Halley Family. Mystery? Mystery? Can you solve a. Can you help solve a

Halley Family. Mystery? Mystery? Can you solve a. Can you help solve a Can you solve a Can you help solve a Halley Halley Family Family Mystery? Mystery? Who was the great grandfather of John Bennett Halley? He lived in Maryland around 1797 and might have been born there.

More information

Using Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM

Using Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM Using Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.

More information

TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter

TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter 1-1: DNA: WHERE DO I START? Definition Genetic genealogy is the application of genetics to traditional genealogy. Genetic genealogy uses genealogical

More information

DNA Testing What you need to know first

DNA Testing What you need to know first DNA Testing What you need to know first This article is like the Cliff Notes version of several genetic genealogy classes. It is a basic general primer. The general areas include Project support DNA test

More information

The Meek Family of Allegheny Co., PA Meek Group A Introduction

The Meek Family of Allegheny Co., PA Meek Group A Introduction Meek Group A Introduction In the 1770's a significant number of families named Meek(s) lived in S. W. Pennsylvania and they can be identified in the records of Westmoreland, Allegheny and Washington Counties.

More information

Kenneth Nordtvedt. Many genetic genealogists eventually employ a time-tomost-recent-common-ancestor

Kenneth Nordtvedt. Many genetic genealogists eventually employ a time-tomost-recent-common-ancestor Kenneth Nordtvedt Many genetic genealogists eventually employ a time-tomost-recent-common-ancestor (TMRCA) tool to estimate how far back in time the common ancestor existed for two Y-STR haplotypes obtained

More information

CLAN DONNACHAIDH DNA NEWS No 1

CLAN DONNACHAIDH DNA NEWS No 1 CLAN DONNACHAIDH DNA NEWS No Introduction Greetings to everyone who has taken part. This is the first of an occasional publication, which will be published when there is something to say or time to write

More information

Every human cell (except red blood cells and sperm and eggs) has an. identical set of 23 pairs of chromosomes which carry all the hereditary

Every human cell (except red blood cells and sperm and eggs) has an. identical set of 23 pairs of chromosomes which carry all the hereditary Introduction to Genetic Genealogy Every human cell (except red blood cells and sperm and eggs) has an identical set of 23 pairs of chromosomes which carry all the hereditary information that is passed

More information

DNA TESTING. This is the testing regime for FamilyTreeDNA. Other SNP tests were ordered from Yseq.

DNA TESTING. This is the testing regime for FamilyTreeDNA. Other SNP tests were ordered from Yseq. DNA & GENEALOGY DNA TESTING This is the testing regime for FamilyTreeDNA. Other SNP tests were ordered from Yseq. Product Date Batch Family Finder 30-May-14 Completed 569 05-Aug-14 Batched 569 05-Jul-14

More information

The Meek Family of Allegheny Co., PA Meek Group A Introduction

The Meek Family of Allegheny Co., PA Meek Group A Introduction Meek Group A Introduction In the 1770's a significant number of families named Meek(s) lived in S. W. Pennsylvania and they can be identified in the records of Westmoreland, Allegheny and Washington Counties.

More information

Genetic Genealogy Journey DNA Projects by Debbie Parker Wayne, CG SM, CGL SM

Genetic Genealogy Journey DNA Projects by Debbie Parker Wayne, CG SM, CGL SM Genetic Genealogy Journey DNA Projects by Debbie Parker Wayne, CG SM, CGL SM Genealogy can be a solitary pursuit. Genealogists sometimes collaborate to work on common lines, but lone researchers can perform

More information

Meek/Meeks Families of Virginia Meek Group F Introduction

Meek/Meeks Families of Virginia Meek Group F Introduction Meek Group F Introduction The Meek/Meeks DNA Project 1 has established Y-DNA signatures 2 for a significant number of early American ancestors based on tests of living descendants. This allows for a determination

More information

Clan Donnachaidh DNA report extracts from newsletters in 2006

Clan Donnachaidh DNA report extracts from newsletters in 2006 Clan Donnachaidh DNA report extracts from newsletters in 00 The Clan Donnachaidh DNA project was set up in December 00. It now has 7 participants representing the most numerous clan surnames Robertson,

More information

Recent Results from the Jackson Brigade DNA Project

Recent Results from the Jackson Brigade DNA Project Recent Results from the Jackson Brigade DNA Project Dr. Daniel C. Hyde Professor Emeritus of Computer Science Bucknell University Lewisburg, PA Presented at Jackson Brigade Reunion, Horner, WV on August

More information

DNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding

DNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding DNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding by Dr. Ing. Robert L. Baber 2014 July 26 Rights reserved, see the copyright notice at http://gengen.rlbaber.de

More information

Report on the VAN_TUYL Surname Project Y-STR Results 3/11/2013 Rory Van Tuyl

Report on the VAN_TUYL Surname Project Y-STR Results 3/11/2013 Rory Van Tuyl Report on the VAN_TUYL Surname Project Y-STR Results 3/11/2013 Rory Van Tuyl Abstract: Recent data for two descendants of Ott van Tuyl has been added to the project, bringing the total number of Gameren

More information

Larkin DNA Project 2014 Y-DNA Update

Larkin DNA Project 2014 Y-DNA Update Larkin DNA Project 2014 Y-DNA Update Brad Larkin Updated: July 12, 2014 Copyright 2014 Bradley T Larkin Topics Introduction to Genetic Genealogy Origin & Distribution of Larkin Surname Larkin DNA Project

More information

The Genetic Structure of a Highland Clan. Bryan Sykes and Jayne Nicholson

The Genetic Structure of a Highland Clan. Bryan Sykes and Jayne Nicholson The Genetic Structure of a Highland Clan Bryan Sykes and Jayne Nicholson University of Oxford Weatherall Institute of Molecular Medicine Oxford OX3 9DS Keywords: Y-chromosome, surnames, Scottish clans

More information

Pinpointing the BLAIR Paternal Ancestral Genetic Homeland. A Scottish Case Study

Pinpointing the BLAIR Paternal Ancestral Genetic Homeland. A Scottish Case Study Pinpointing the BLAIR Paternal Ancestral Genetic Homeland A Scottish Case Study Dr Tyrone Bowes Updated 6 th June 2015 Introduction A simple painless commercial ancestral Y chromosome DNA test will potentially

More information

The modern surname Kennedy showed up for the first time in the first part of the 10th Century, 930 A.D. We will explain how this came to pass.

The modern surname Kennedy showed up for the first time in the first part of the 10th Century, 930 A.D. We will explain how this came to pass. Patricia Kennedy, stated that her son Michael (Hutchence) was of Irish, English and Spanish descendants. The moment I was given the knowledge about Patricia s maiden name a little bell started ringing

More information

William E. Howard III

William E. Howard III William E. Howard III Part 1 of this two-part series of articles presented a new correlation method for analyzing Y-STR haplotypes (Howard, 2009). The method reduces pairs of haplotypes to a single number

More information

Case Study Pinpointing the Grace English Paternal Ancestral Genetic Homeland

Case Study Pinpointing the Grace English Paternal Ancestral Genetic Homeland Case Study Pinpointing the Grace English Paternal Ancestral Genetic Homeland Dr Tyrone Bowes 12 th June 2017 INTRODUCTION A simple painless commercial ancestral Y chromosome DNA test will potentially provide

More information

DNA and Ancestry. An Update on New Tests. Steve Louis. Jewish Genealogical Society of Washington State. January 13, 2014

DNA and Ancestry. An Update on New Tests. Steve Louis. Jewish Genealogical Society of Washington State. January 13, 2014 DNA and Ancestry An Update on New Tests Steve Louis Jewish Genealogical Society of Washington State January 13, 2014 DISCLAIMER This document was prepared as a result of independent work and opinions of

More information

Origins: Coffey/Keogh Families By Fred Coffey. ONLINE:

Origins: Coffey/Keogh Families By Fred Coffey. ONLINE: Origins: Coffey/Keogh Families By Fred Coffey ONLINE: http://www.coffey.ws/familytree/dna/origins-coffeykeoghfamilies.pdf My name is Coffey, and I m very interested in working out the origins of my family.

More information

Genealogical Research

Genealogical Research DNA, Ancestry, and Your Genealogical Research Walter Steets Houston Genealogical Forum DNA Interest Group March 2, 2019 1 Today s Agenda Brief review of basic genetics and terms used in genetic genealogy

More information

! FTDNA! Ancestry. ! 23andMe. ! Medical Considera,ons. ! Iden,fying family medical history. ! Communica,ng with the medical community

! FTDNA! Ancestry. ! 23andMe. ! Medical Considera,ons. ! Iden,fying family medical history. ! Communica,ng with the medical community by JEFF CARPENTER! Brief Defini,ons about YDNA, XDNA, mtdna, atdna (Covered in Part 1)! Benefits of Tes,ng DNA! Examples of DNA TESTING! FTDNA! Ancestry! 3andMe Jeff Carpenter, 016 jeffcarpenter1939@gmal.com!

More information

Larkin DNA Project 2016 Y-DNA Update

Larkin DNA Project 2016 Y-DNA Update Larkin DNA Project 2016 Y-DNA Update Brad Larkin Updated: April 10, 2016 Copyright 2016 Bradley T Larkin Topics News for 2016 Introduction to Genetic Genealogy Origin & Distribution of Larkin Surname Larkin

More information

Family Tree DNA Genetic Genealogy Started Here

Family Tree DNA Genetic Genealogy Started Here Family Tree DNA Genetic Genealogy Started Here With 253,000 samples in our DNA database (the largest of its kind in the world) your genealogical search could become even easier Why Bennett Greenspan founded

More information

The Kaighins of Scaresdale, Kirk German, Isle of Man

The Kaighins of Scaresdale, Kirk German, Isle of Man The Kaighins of Scaresdale, Kirk German, Isle of Man Greg Kaighin May 16, 2015 Background After twelve years of research, the parents of John Kaighin (Family 7600) 1 of Kirk German, Isle of Man have finally

More information

Summary & Conclusion. Critique of Grace an English Origenes Y-DNA Case Study of 24 th September 2017 by Dr. Tyrone Bowes

Summary & Conclusion. Critique of Grace an English Origenes Y-DNA Case Study of 24 th September 2017 by Dr. Tyrone Bowes Summary & Conclusion A report was commissioned from Dr. Tyrone Bowes ( author ), through his commercial English Origenes website, by Mark Grace ( commissioner ) in May 2017. The report cost 370. The purpose

More information

An O-F3288 Y DNA Discovery for Patrilineal Descendants of James Revell (Accomack) By Marie A. Rundquist, DNA Project Administrator November 2018

An O-F3288 Y DNA Discovery for Patrilineal Descendants of James Revell (Accomack) By Marie A. Rundquist, DNA Project Administrator November 2018 Project Scope Rundquist O-F3288 White Paper 11/2018 An O-F3288 Y DNA Discovery for Patrilineal Descendants of James Revell (Accomack) By Marie A. Rundquist, DNA Project Administrator November 2018 The

More information

Pizza and Who do you think you are?

Pizza and Who do you think you are? Pizza and Who do you think you are? an overview of one of the newest and possibly more helpful developments in researching genealogy and family history that of using DNA for research What is DNA? Part

More information

The Structure of DNA Let s take a closer look at how this looks under a microscope.

The Structure of DNA Let s take a closer look at how this looks under a microscope. DNA Basics Adapted from a MyHeritage Blog and the International Society of Genetic Genealogy (ISOGG) Wiki by Earl Cory MyHeritage has started a series to explain DNA, how it works and answer the most common

More information

Eller DNA Project. Status Report for Nashville EFA Conference----July 25, Tom Eller, DNA Project Administrator

Eller DNA Project. Status Report for Nashville EFA Conference----July 25, Tom Eller, DNA Project Administrator Eller DNA Project Status Report for Nashville EFA Conference----July 25, 2009 Tom Eller, DNA Project Administrator Eller DNA Project This presentation used material from Family Tree DNA and from World

More information

MEET YOUR VOLUNTEER PRATER PROJECT ADMINISTRATORS

MEET YOUR VOLUNTEER PRATER PROJECT ADMINISTRATORS Prater* Project NEWSLETTER i Vol I, No 1 Click on graphic above to view the latest Prater Project Results Tables using the drop-down menus MEET YOUR VOLUNTEER PRATER PROJECT ADMINISTRATORS Laverne Piatt

More information

Welcome to this issue of Facts & Genes, the only publication devoted to Genetic Genealogy.

Welcome to this issue of Facts & Genes, the only publication devoted to Genetic Genealogy. Facts & Genes from Family Tree DNA ================================== March 3, 2004 Volume 3, Issue 2 In This Issue ============= Editor's Corner In the News: Family Tree DNA Announcements Haplogroups:

More information

Your mtdna Full Sequence Results

Your mtdna Full Sequence Results Congratulations! You are one of the first to have your entire mitochondrial DNA (DNA) sequenced! Testing the full sequence has already become the standard practice used by researchers studying the DNA,

More information

The FERGUS(S)ON DNA project was organized in August of Currently there are about 450 participants whose y-chromosome has been analyzed.

The FERGUS(S)ON DNA project was organized in August of Currently there are about 450 participants whose y-chromosome has been analyzed. FERGUS(S)ON DNA Project by Colin R. Ferguson, PhD (First Published in The Bee Line, Clan Fergusson Society of North America, Issue No. 94, Spring 2006 and perpetually revised since then) The FERGUS(S)ON

More information

BETTER TOGETHER: MAKING YOUR CASE WITH DOCUMENTS AND DNA BCG-sponsored Webinar (https://bcgcertification.org) Patricia Lee Hobbs, CG

BETTER TOGETHER: MAKING YOUR CASE WITH DOCUMENTS AND DNA BCG-sponsored Webinar (https://bcgcertification.org) Patricia Lee Hobbs, CG BETTER TOGETHER: MAKING YOUR CASE WITH DOCUMENTS AND DNA BCG-sponsored Webinar (https://bcgcertification.org) Patricia Lee Hobbs, CG LIMITATIONS & BENEFITS OF DNA TESTING DNA test results do not solve

More information

A STUDY OF ANDREAS KILIAN S ANCESTRIAL Y-DNA

A STUDY OF ANDREAS KILIAN S ANCESTRIAL Y-DNA 1 A STUDY OF ANDREAS KILIAN S ANCESTRIAL Y-DNA Be Silent Were the Bible Is Silent For someone who believes the Bible is the inspired Word of God, how can I believe in DNA and the dates given in this paper?

More information

Putting the genes into genealogy

Putting the genes into genealogy Putting the genes into genealogy DNA testing can help find lost branches of your family tree. Susan C Meates describes how DNA surname projects work DNA testing for genealogy has been available since 2000,

More information

23 March I will try and summarize the Y-DNA male line test results for both of you and the other members of the Stubbs DNA Project:

23 March I will try and summarize the Y-DNA male line test results for both of you and the other members of the Stubbs DNA Project: 23 March 2019 Hello Irving and Rodney, I would like to share with you my thoughts regarding the recent DNA testing both of you in the Big Y program. I am therefore including both of you in this message.

More information

Autosomal-DNA. How does the nature of Jewish genealogy make autosomal DNA research more challenging?

Autosomal-DNA. How does the nature of Jewish genealogy make autosomal DNA research more challenging? Autosomal-DNA How does the nature of Jewish genealogy make autosomal DNA research more challenging? Using Family Finder results for genealogy is more challenging for individuals of Jewish ancestry because

More information

When I started my genealogy

When I started my genealogy Beyond the paper records When I started my genealogy research a few years after my father died in 1989, the only information I had on my paternal grandfather was his name, Richard Frederick Meates, and

More information

Mitochondrial DNA (mtdna) JGSGO June 5, 2018

Mitochondrial DNA (mtdna) JGSGO June 5, 2018 Mitochondrial DNA (mtdna) JGSGO June 5, 2018 MtDNA - outline What is it? What do you do with it? How do you maximize its value? 2 3 mtdna a double-stranded, circular DNA that is stored in mitochondria

More information

Walter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018

Walter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018 DNA, Ancestry, and Your Genealogical Research- Segments and centimorgans Walter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018 1 Today s agenda Brief review of previous DIG session

More information

DNA: UNLOCKING THE CODE

DNA: UNLOCKING THE CODE DNA: UNLOCKING THE CODE Connecting Cousins for Genetic Genealogy Bryant McAllister, PhD Associate Professor of Biology University of Iowa bryant-mcallister@uiowa.edu Iowa Genealogical Society April 9,

More information

Towards improvements in y-dna Surname Project Administration

Towards improvements in y-dna Surname Project Administration Journal of Genetic Genealogy, 6(1), 2010 Towards improvements in y-dna Surname Project Administration James M. Irvine Abstract This paper surveys a sample of 12 y-dna surname projects, selected to reflect

More information

Tracking Your Roots With DNA

Tracking Your Roots With DNA Tracking Your Roots With DNA Genetic Genealogy Lisa R Franklin RN,BSN 31 Oct 2013/27 Jun 2014 Andalusia, Alabama Why DNA test? Determine if two people are related Determine if two people descend from the

More information

[CLIENT] SmithDNA1701 DE January 2017

[CLIENT] SmithDNA1701 DE January 2017 [CLIENT] SmithDNA1701 DE1704205 11 January 2017 DNA Discovery Plan GOAL Create a research plan to determine how the client s DNA results relate to his family tree as currently constructed. The client s

More information

Understanding DNA in Genealogy. Peter Biggins, BY3164 Darien Library, Darien, CT November 18, 2017

Understanding DNA in Genealogy. Peter Biggins, BY3164 Darien Library, Darien, CT November 18, 2017 Understanding DNA in Genealogy Peter Biggins, BY3164 Darien Library, Darien, CT November 18, 2017 1953: Watson 25, Crick 37, Franklin 33 My BY3164 SNP 1953 paper published on the structure of DNA 1962

More information

Genealogy Basics: How to Find RC Irish Vitals in the National Library of Ireland ( Web Site

Genealogy Basics: How to Find RC Irish Vitals in the National Library of Ireland (  Web Site Genealogy Basics: How to Find RC Irish Vitals in the National Library of Ireland (www.nli.ie) Web Site BACKGROUND: Joe Petrie On July 8, 2015, the National Library of Ireland released for browsing nearly

More information

THE BASICS OF DNA TESTING. By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library

THE BASICS OF DNA TESTING. By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library THE BASICS OF DNA TESTING By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library TYPES OF TESTS Mitochondrial DNA (mtdna/mdna) Y-DNA Autosomal DNA (atdna/audna) MITOCHONDRIAL DNA Found

More information

The Paternity of Seymour Savage ( )

The Paternity of Seymour Savage ( ) The Paternity of Seymour Savage (1868 1937) Charles Savage Jr., John T Ferguson, Colin R Ferguson Address for correspondence: Colin R. Ferguson, 12658 Princeton Drive, Auburn, CA 95603, USA Abstract: This

More information

Big Y-700 White Paper

Big Y-700 White Paper Big Y-700 White Paper Powering discovery in the field of paternal ancestry Authors: Caleb Davis, Michael Sager, Göran Runfeldt, Elliott Greenspan, Arjan Bormans, Bennett Greenspan, and Connie Bormans Last

More information

Using a Y-DNA Surname Project to Dig Deeper Into Your Genealogy: A Case Study

Using a Y-DNA Surname Project to Dig Deeper Into Your Genealogy: A Case Study Using a Y-DNA Surname Project to Dig Deeper Into Your Genealogy: A Case Study Allan H. Westreich, Ph.D. Address for correspondence: Allan H. Westreich, Ph.D., 250 Route 28, Suite 206, Bridgewater, NJ 08807,

More information

Tracing Your Scottish Ancestors: A Guide To Ancestry Research In The Scottish Record Office (Mercat Press) By National Archives of Scotland;Cecil

Tracing Your Scottish Ancestors: A Guide To Ancestry Research In The Scottish Record Office (Mercat Press) By National Archives of Scotland;Cecil Tracing Your Scottish Ancestors: A Guide To Ancestry Research In The Scottish Record Office (Mercat Press) By National Archives of Scotland;Cecil Sinclair If you are looking for a ebook Tracing Your Scottish

More information

DNA CHARLOTTE COUNTY GENEALOGICAL SOCIETY - MARCH 30, 2013 WALL STREET JOURNAL ARTICLE

DNA CHARLOTTE COUNTY GENEALOGICAL SOCIETY - MARCH 30, 2013 WALL STREET JOURNAL ARTICLE DNA CHARLOTTE COUNTY GENEALOGICAL SOCIETY - MARCH 30, 2013 WALL STREET JOURNAL ARTICLE NATIONAL GEOGRAPHIC GENOGRAPHIC PROJECT ABOUT NEWS RESULTS BUY THE KIT RESOURCES Geno 2.0 - Genographic Project

More information

Ancestral Origins of Baltic N-Z ver /

Ancestral Origins of Baltic N-Z ver / Copyright G. Dunkel Ancestral Origins of Baltic N-Z16981+ ver. 1.3. /4.10.2016 This small-scale study provides a new perspective to look at N-Z16981+ Balts SNP results. First of all, it must be noted,

More information

The DNA Case for Bethuel Riggs

The DNA Case for Bethuel Riggs The DNA Case for Bethuel Riggs The following was originally intended as an appendix to Alvy Ray Smith, Edwardian Riggses of America I: Elder Bethuel Riggs (1757 1835) of Morris County, New Jersey, and

More information

Using Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM

Using Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM Using Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.

More information

John Doe Knight Premium Male DNA Ancestry Report

John Doe Knight Premium Male DNA Ancestry Report John Doe Knight Premium Male DNA Ancestry Report Kxxxx- 8xxxxxx A sample of the Y-chromosome DNA was extracted, amplified and genotyped by DNA Diagnostics Center. Chromosomes are the double-helix genetic

More information

FREQUENTLY ASKED QUESTIONS ABOUT THE OWSTON/OUSTON DNA PROJECT

FREQUENTLY ASKED QUESTIONS ABOUT THE OWSTON/OUSTON DNA PROJECT FREQUENTLY ASKED QUESTIONS ABOUT THE OWSTON/OUSTON DNA PROJECT 1. What has been discovered thus far and what may be discovered with testing? The Owston/Ouston DNA project grew out of the combined genealogical

More information

DNA Opening Doors for Today s s Genealogist

DNA Opening Doors for Today s s Genealogist DNA Opening Doors for Today s s Genealogist Presented to JGSI Sunday, March 30, 2008 Presented by Alvin Holtzman Genetic Genealogy Discussion Points What is DNA How can it help genealogists What to expect

More information

DNA Testing. February 16, 2018

DNA Testing. February 16, 2018 DNA Testing February 16, 2018 What Is DNA? Double helix ladder structure where the rungs are molecules called nucleotides or bases. DNA contains only four of these nucleotides A, G, C, T The sequence that

More information

Walter Steets Houston Genealogical Forum DNA Interest Group November 18, 2017

Walter Steets Houston Genealogical Forum DNA Interest Group November 18, 2017 DNA, Ancestry, and Your Genealogical Research Session 2 Walter Steets Houston Genealogical Forum DNA Interest Group November 18, 2017 1 Today s agenda Brief review of previous DIG session Degrees of Separation

More information

An Introduction. Your DNA. and Your Family Tree. (Mitochondrial DNA) Presentation by: 4/8/17 Page 1 of 10

An Introduction. Your DNA. and Your Family Tree. (Mitochondrial DNA) Presentation by: 4/8/17 Page 1 of 10 An Introduction Your DNA and Your Family Tree (Mitochondrial DNA) Presentation by: FredCoffey@aol.com 4/8/17 Page 1 of 10 Coffey Surname, y-dna Project We're now ready to move on and look at the type of

More information

Genetic Genealogy. Rules and Tools. Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter

Genetic Genealogy. Rules and Tools. Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter Genetic Genealogy Rules and Tools Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter I am NOT this guy! 2 Genealogy s Newest Tool Genealogy research: Study of Family History Identifies

More information

Arthur Carden (Member 2773) 16 February 2009

Arthur Carden (Member 2773) 16 February 2009 THE CARDEN DNA PROJECT In September 2008 we held a Carden Gathering near Brighton, England, on the tenth anniversary of the first major Carden Gathering, which took place in Cheshire in September 1998.

More information

Getting the Most of Your DNA Test. Friends of Irish Research Richard Reid

Getting the Most of Your DNA Test. Friends of Irish Research Richard Reid Getting the Most of Your DNA Test Friends of Irish Research Richard Reid So You Have Been Tested! The results are back and now is time to explore and see if any of your brick walls can be broken down.

More information

Getting the Most Out of Your DNA Matches

Getting the Most Out of Your DNA Matches Helen V. Smith PG Dip Public Health, BMedLabSci, ADCLT, Dip. Fam. Hist. PLCGS 46 Kraft Road, Pallara, Qld, 4110 Email: HVSresearch@DragonGenealogy.com Website: www.dragongenealogy.com Blog: http://www.dragongenealogy.com/blog/

More information

Brian Boru s family and their background in Co. Clare

Brian Boru s family and their background in Co. Clare Brian Boru Lecture Series Brian Boru s family and their background in Co. Clare Dr. Catherine Swift Mary Immaculate College Early kingdoms of Co. Clare Scholars use later administrative units (diocesan

More information

Iden%fying Personal Genomes by Surname Inference

Iden%fying Personal Genomes by Surname Inference Iden%fying Personal Genomes by Surname Inference Gymrek M, McGuire AL, Golan D, Halperin E, Erlich Y. Science. 2013 Jan 18;339(6117):321-4. doi: 10.1126/science.1229566. Journal Club Kairi Raime 04.02.2013

More information

DNA Haplogroups Report

DNA Haplogroups Report DNA Haplogroups Report for Matthew Mayberry Generated and printed on Sep 25 2011, 01:59 pm X This is a mtdna Haplogroup Report This is a mtdna Subclade Report Search criteria used in this report: HVR-1

More information

Web Sites that have appeared in the Whatcom Genealogical Society Newsletters February 2014 June 2017

Web Sites that have appeared in the Whatcom Genealogical Society Newsletters February 2014 June 2017 Web Sites that have appeared in the Whatcom Genealogical Society Newsletters February 2014 June 2017 http://familysearchwiki.com -- Get genealogical research advice, or learn where to find record collections

More information

How To Uncover Your Genealogy

How To Uncover Your Genealogy Page 1 of 1 Contents Why You Need To Explore Your Past... 9 Genealogy And History... 11 Research And Effort Methods... 13 Creating A Family Tree... 15 Hiring A Professional... 17 Family Tree Software...

More information

Genetic Investigation of the Patrilineal Kinship Structure of Early Medieval Ireland

Genetic Investigation of the Patrilineal Kinship Structure of Early Medieval Ireland AMERICAN JOURNAL OF PHYSICAL ANTHROPOLOGY 000:000 000 (2008) Genetic Investigation of the Patrilineal Kinship Structure of Early Medieval Ireland Brian McEvoy, 1 Katharine Simms, 2 and Daniel G. Bradley

More information

Appendix III - Analysis of Non-Paternal Events

Appendix III - Analysis of Non-Paternal Events Appendix III - Analysis of Non-Paternal Events Summary One of the challenges that genetic genealogy researchers face when carrying out Y-DNA testing on groups of men within a family surname study is to

More information

DNA Solu)ons for Brick Walls And Adop)on

DNA Solu)ons for Brick Walls And Adop)on DNA Solu)ons for Brick Walls And Adop)on "I have not failed. I've just found ten thousand ways that won't work." Thomas Edison Wise Woman Gene+c Genealogy Comments Listen Carefully! 1. DNA is not the be

More information

DNA for Genealogy Librarians. Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District

DNA for Genealogy Librarians. Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District DNA for Genealogy Librarians Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District What does DNA do? It replicates itself. It codes for the production

More information

Steve Harding, *Turi King and *Mark Jobling Universities of Nottingham & *Leicester, UK

Steve Harding, *Turi King and *Mark Jobling Universities of Nottingham & *Leicester, UK Viking DNA Steve Harding, *Turi King and *Mark Jobling Universities of Nottingham & *Leicester, UK Viking DNA in Northern England Project Part 1 - Wirral and West Lancashire (2002-2007) Part 2 - North

More information

Ernie Ebayley s Adventure in DNA-Land. A Resource for Beginning Your Own Adventure into Genealogical Genetics

Ernie Ebayley s Adventure in DNA-Land. A Resource for Beginning Your Own Adventure into Genealogical Genetics Ernie Ebayley s Adventure in DNA-Land A Resource for Beginning Your Own Adventure into Genealogical Genetics 2006 C.E. Smith Museum of Anthropology College of Arts, Letters, and Social Sciences (CLASS)

More information

How a DNA Project has produced discoveries in the Meates One- Name Study not possible with paper records alone

How a DNA Project has produced discoveries in the Meates One- Name Study not possible with paper records alone How a DNA Project has produced discoveries in the Meates One- Name Study not possible with paper records alone By Susan C. Meates ORE AND more one-namers are fascinated by the new genealogy of DNA testing

More information

Surnames Of Ireland By Edward MacLysaght

Surnames Of Ireland By Edward MacLysaght Surnames Of Ireland By Edward MacLysaght Irish Roots: Norman surnames - The Irish Times - The Norman arrival in Ireland in 1169 was just one end-point of their extraordinary expansion out of Flanders and

More information

An Introduction to Genetic Genealogy

An Introduction to Genetic Genealogy An Introduction to Genetic Genealogy David A. Pike dapike@math.mun.ca Presented To: Family History Society of Newfoundland and Labrador 24 January 2006 Slide 1 of 21 Overview Genetic Genealogy using genetic

More information

Common ancestors of all humans

Common ancestors of all humans Definitions Skip the methodology and jump down the page to the Conclusion Discussion CAs using Genetics CAs using Archaeology CAs using Mathematical models CAs using Computer simulations Recent news Mark

More information

Surname studies with genetics: a brief review including an outline of the Meates and Plant studies

Surname studies with genetics: a brief review including an outline of the Meates and Plant studies Page 1 of 22 John S Plant, 2009. DNA Section, Guild of One Name Studies Surname studies with genetics: a brief review including an outline of the Meates and Plant studies by Dr John S Plant including evidence

More information

Genetic Identity and

Genetic Identity and Genetic Identity and GACATGTAGCTCTTCACTTCACCCAGGTTGGGTTGTGTCAACAGGAAACATTGTAACATATCACTTGGATTAGCACCTAGG/TTAT/TTAT/TTA Community DTC Genetic Testing Workshop The National Academies' August 31 September 1,

More information

Y-chromosomes and the extent of patrilineal ancestry in Irish surnames

Y-chromosomes and the extent of patrilineal ancestry in Irish surnames Hum Genet (2006) 119: 212 219 DOI 10.1007/s00439-005-0131-8 ORIGINAL INVESTIGATION Brian McEvoy Æ Daniel G. Bradley Y-chromosomes and the extent of patrilineal ancestry in Irish surnames Received: 1 November

More information

DAR POLICY STATEMENT AND BACKGROUND Using DNA Evidence for DAR Applications

DAR POLICY STATEMENT AND BACKGROUND Using DNA Evidence for DAR Applications Effective January 1, 2014, DAR will begin accepting Y-DNA evidence in support of new member applications and supplemental applications as one element in a structured analysis. This analysis will use a

More information

WikiTree and One Name Studies

WikiTree and One Name Studies WikiTree and One Name Studies WikiTree Connects Collaboration on deep ancestors is between distant cousins who are serious about genealogical research and careful about sources. WikiTree Connects Because

More information

Using Mitochondrial DNA (mtdna) for Genealogy Debbie Parker Wayne, CG, CGL SM

Using Mitochondrial DNA (mtdna) for Genealogy Debbie Parker Wayne, CG, CGL SM Using Mitochondrial DNA (mtdna) for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical

More information

Robert Chisholm Project Administrator Bob Chisholm, Audrey Barney, Alice Fairhurst Co Administrators. May 2008

Robert Chisholm Project Administrator Bob Chisholm, Audrey Barney, Alice Fairhurst Co Administrators. May 2008 Robert Chisholm Project Administrator Bob Chisholm, Audrey Barney, Alice Fairhurst Co Administrators May 2008 Project membership: Total number = 61 members, (8 mtdna, 53 y-dna) Y-dna project: Total =53members

More information

Find JCD Project Date: Identification-DNA Process Updated:

Find JCD Project Date: Identification-DNA Process Updated: New Look Investigations Created by: Jack Friess Find JCD Project Date: 04-20-2018 Identification-DNA Process Updated: 05-24-2018 Questions and Answers Identification-DNA (ID-DNA) is a scientific process

More information

MCMLS Genealogy Programs August December 2018

MCMLS Genealogy Programs August December 2018 MCMLS Genealogy Programs August December 2018 The Genealogy Department at the Central Library in Conroe is pleased to announce the following workshops and presentations in the Genealogy & Local History

More information