Autosomal-DNA. How does the nature of Jewish genealogy make autosomal DNA research more challenging?
|
|
- Tabitha Elaine Hardy
- 5 years ago
- Views:
Transcription
1 Autosomal-DNA How does the nature of Jewish genealogy make autosomal DNA research more challenging? Using Family Finder results for genealogy is more challenging for individuals of Jewish ancestry because of a lack of genealogical records, surname changes, and frequent intermarriage. The lack of genealogical records means that finding the connection with even a third cousin may not be possible. It is important then to focus on those matches who come from the timeframe of available records. Name changes are, as always, one of the biggest challenges of Jewish genealogy. Here is an example from Max Blankfeld, from Family Tree DNA. The following is an example from Max Blankfeld of Family Tree DNA: I have one match predicted as 4th cousin with the last name Rubio typical Hispanic name (I also had his first and middle Hispanic names). My first reaction was why do I have this name here? Well, I checked his record, and there s a note there: his ancestral name was Rubizewsky. after checking JewishGen I saw two Rubizewsky records from a very small town in Belarus with the name Pinsk. And guess where my mother is from? Yes, you guessed it right: Pinsk! As a result of frequent intermarriage, a Family Finder cousin match may show a total value of centimorgans composed from the combination of different lines. That is, they are a more distant cousin who is related in multiple ways. Max Blankfeld gives the following personal example. I had a case of a person that matched with my nephew (my brother s son) as a 2nd cousin, and with me as a 4th cousin. If we were talking about matching with just one line, he should be 3rd, and I 4th. Because he may be adding blocks of DNA from his maternal line (unrelated to me) to the relationship with that person. Those blocks, adding up to the my main block with him, elevates by one generation his matching to that person.
2 Beginning on April 21, 2011, we have modified our Family Finder matching algorithm to address this. The changes affect the match list for Ashkenazi Jews. The outcome is calculated Family Finder relationships that more accurately reflect relationships to other Ashkenazi Jews. Do I have Jewish ancestry based on my Family Finder and myorigins results? Judaism is a religion and not an attribute definable by a DNA mutation, but we can give you hints about having Jewish ancestry by comparing your Family Finder results to those of known Jewish ancestry in our database. myorigins results may also provide clues to recent Jewish ancestry in the last five generations. The first clue to your having recent Eastern European Jewish ancestry is the number of matches you have in the Family Finder database. Due to endogamous marriage patterns, there is a high level of inter-relatedness in Eastern European Jews. If you have recent Jewish ancestry, you will then have a high number of Jewish cousins on your matches page, likely in the 1000s of matches. The second clue to your having recent Jewish Ancestry comes from the myorigins ethnic percentages results. Most people with Jewish genetic ancestry will see Ashkenazi Jewish ancestry here. However, if you show only a small amount of Jewish genetic matching, it is not proof of recent Jewish ancestry. This is because the genetic match may be from much more distant genetic admixture that became fixed in your recent ancestors population. Please note that we are only able to assist with Ashkenazi Jewish ancestry at this time. What are the challenges of Jewish genealogy? Jewish genealogy includes many challenges that mean more frequent and problematic road blocks for the Jewish genealogist than for the non- Jewish genealogist.
3 The following are some of these challenges: Surnames that pass from father to son were not adopted until the late 1700s and early 1800s. Unrelated paternal lines have adopted the same surnames. Related paternal lines have adopted different surnames. Surnames have been adapted to the country where descendants live today. In many cases, traditional paper trail records are lacking. The Jewish population is endogamous (intermarrying).
4 Y-DNA Do I have Jewish ancestry on my direct paternal (Ychromosome DNA) line? Judaism is a religion and not an attribute definable by a DNA mutation, but we can give you hints about having Jewish ancestry by comparing your results against our database. Look on the Y-DNA Ancestral Origins page to see whether or not the people you match have listed Jewish ancestry. Those in our Jewish database have a listing in the Comments column denoting Jewish ancestry. There are four situations when testing for Jewish ancestry. These situations are as follows: You match only people who are also Jewish on their direct paternal line. That is, the signature or haplotype only matches with people who have known Jewish ancestry. The answer in this case is clear. Your haplotype matches both Jewish and non-jewish lineages. The answer is not clear, and we cannot guess whether or not your personal lineage is Jewish. You match no one of known Jewish origin. The answer is clear. You are unlikely to have Jewish origins on this lineage. You have no matches in our system at all. That means we have never seen your specific results. We will know more about your ancestry when you start matching others. How does the nature of Jewish genealogy make Y-DNA research more challenging? Because Jewish genealogists cannot assume that paternal line ancestors have had the same surname for over 300 years, interpreting close and exact matches requires more thought and consideration than would otherwise be the case. Where a non-jewish genealogist with origins in a country such as
5 England might see an exact Y-DNA37 match with the same surname and use it to confirm a recent relationship, Jewish genealogists must approach it more cautiously. They need to consider each family s geographic origins and their knowledge of how the surname relates to their family history. On the other hand, an exact Y-DNA37, Y-DNA67, or Y-DNA111 match to someone with a different surname need not be a cause for alarm. Rather this is the potential discovery of a branch of the family that has undergone a name change. How does Y-DNA help with the challenges of Jewish Genealogy? Unlike many other populations, the Jewish people adopted hereditary surnames relatively recently. Surnames changed during recent emigrations. Some families modified their surname spellings to fit with local norms. By testing the Y-chromosome DNA, you and your cousins can recover the linkage along a direct paternal line. For example, someone has the surname Brown. They also have a family tradition that their ancestors and their cousins who moved to Australia and South Africa were Plikhs. By testing themselves and potential cousins with the Plikh surname, they can prove (or disprove) the family tradition. What percent of Jews carry the Cohanim Modal Haplotype (CMH)? From surveys of markers in Jewish cemeteries, about 5% of Jewish men have historically been Cohanim. Genetic research indicates that many Jewish men who self-identify as Cohanim belong to the Y-chromosome DNA lineage that is most common in the Cohanim. That is, they belong to the Cohanim Modal Haplotype (CMH). Further, in a study conducted in Israel where men were asked at random if they were Cohanim, Levite,
6 or Israel, of those answering Israel, about 3% when tested were part of the CMH lineage.
7 Mt-DNA How do I tell if I have Jewish ancestry on my direct maternal (mitochondrial DNA) line? Judaism is a religion and not a genetic attribute that can be defined by a DNA mutation. However, because Jewish populations have been endogamous for much of their history, hints to your Jewish ancestry for your direct maternal lineage are provided by looking at the mtdna Ancestral Origins page in your myftdna account. Check the Comments column on this page. There are four possible situations: You match only people who are Jewish. You will see in the Comments column Ashkenazim, Sephardim, and other historic branches. The answer here is a clear yes. You match both Jews and non-jews. The answer here is not clear. A higher level of testing, the Mitochondrial DNA Full Genomic Sequence test, will eliminate matches with one group or the other. You match nobody of known Jewish origins. It is highly unlikely that you have Jewish origins on this line. You do not have matches in our system. This is unlikely if you have Jewish origins. Source: Family Tree DNA
DNA Opening Doors for Today s s Genealogist
DNA Opening Doors for Today s s Genealogist Presented to JGSI Sunday, March 30, 2008 Presented by Alvin Holtzman Genetic Genealogy Discussion Points What is DNA How can it help genealogists What to expect
More informationDNA Testing What you need to know first
DNA Testing What you need to know first This article is like the Cliff Notes version of several genetic genealogy classes. It is a basic general primer. The general areas include Project support DNA test
More informationTRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter
TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter 1-1: DNA: WHERE DO I START? Definition Genetic genealogy is the application of genetics to traditional genealogy. Genetic genealogy uses genealogical
More information[CLIENT] SmithDNA1701 DE January 2017
[CLIENT] SmithDNA1701 DE1704205 11 January 2017 DNA Discovery Plan GOAL Create a research plan to determine how the client s DNA results relate to his family tree as currently constructed. The client s
More informationDNA and Ancestry. An Update on New Tests. Steve Louis. Jewish Genealogical Society of Washington State. January 13, 2014
DNA and Ancestry An Update on New Tests Steve Louis Jewish Genealogical Society of Washington State January 13, 2014 DISCLAIMER This document was prepared as a result of independent work and opinions of
More informationDNA Basics. OLLI: Genealogy 101 October 1, ~ Monique E. Rivera ~
DNA Basics OLLI: Genealogy 101 October 1, 2018 ~ Monique E. Rivera ~ WHAT IS DNA? DNA (deoxyribonucleic acid) is found in every living cell everywhere. It is a long chemical chain that tells our cells
More informationTHE BASICS OF DNA TESTING. By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library
THE BASICS OF DNA TESTING By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library TYPES OF TESTS Mitochondrial DNA (mtdna/mdna) Y-DNA Autosomal DNA (atdna/audna) MITOCHONDRIAL DNA Found
More informationUsing Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM
Using Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.
More informationY-DNA Genetic Testing
Y-DNA Genetic Testing 50 2/24/14 Y-DNA Genetic Testing Y-DNA flows from fathers to sons intact SNPs define Y-DNA haplogroups Haplogroups (clans) migrated together Timeframe between mutations is 2,000 to
More informationDNA Testing. February 16, 2018
DNA Testing February 16, 2018 What Is DNA? Double helix ladder structure where the rungs are molecules called nucleotides or bases. DNA contains only four of these nucleotides A, G, C, T The sequence that
More informationGenetic Genealogy Journey DNA Projects by Debbie Parker Wayne, CG SM, CGL SM
Genetic Genealogy Journey DNA Projects by Debbie Parker Wayne, CG SM, CGL SM Genealogy can be a solitary pursuit. Genealogists sometimes collaborate to work on common lines, but lone researchers can perform
More informationHalley Family. Mystery? Mystery? Can you solve a. Can you help solve a
Can you solve a Can you help solve a Halley Halley Family Family Mystery? Mystery? Who was the great grandfather of John Bennett Halley? He lived in Maryland around 1797 and might have been born there.
More informationFirst Results: Intro to FamilyTreeDNA s Family Finder. Learn what to do with results of autosomal DNA testing with FamilyTreeDNA (FTDNA).
First Results: Family Tree DNA When You First Get Your FamilyTreeDNA (FTDNA) Results Objective: Learn what to do with results of autosomal DNA testing with FamilyTreeDNA (FTDNA). Tools: familytreedna.com
More informationWhat Can I Learn From DNA Testing?
What Can I Learn From DNA Testing? From where did my ancestors migrate? What is my DNA Signature? Was my ancestor a Jewish Cohanim Priest? Was my great great grandmother really an Indian Princes? I was
More informationPizza and Who do you think you are?
Pizza and Who do you think you are? an overview of one of the newest and possibly more helpful developments in researching genealogy and family history that of using DNA for research What is DNA? Part
More informationAutosomal DNA. What is autosomal DNA? X-DNA
ANGIE BUSH AND PAUL WOODBURY info@thednadetectives.com November 1, 2014 Autosomal DNA What is autosomal DNA? Autosomal DNA consists of all nuclear DNA except for the X and Y sex chromosomes. There are
More informationGenetic Genealogy Journey Why Is My Cousin Not on my DNA Match List? Debbie Parker Wayne, CG SM, CGL SM
Genetic Genealogy Journey Why Is My Cousin Not on my DNA Match List? Debbie Parker Wayne, CG SM, CGL SM The CSI television shows have conditioned us to expect exact DNA matches and lead us to think DNA
More informationUsing Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM
Using Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.
More informationIntroduction to Autosomal DNA Tools
GENETIC GENEALOGY JOURNEY Debbie Parker Wayne, CG, CGL Introduction to Autosomal DNA Tools Just as in the old joke about a new genealogist walking into the library and asking for the book that covers my
More informationYour Family 101 Beginning Genealogical Research
Your Family 101 Beginning Genealogical Research What Will We Cover Today? Session 1: Getting Started Session 2: Your Resources Session 3: Common Mistakes and Pitfalls Session 4: DNA Testing and Medical
More informationDNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016
DNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016 1 What we will cover How testing helps genealogy What is DNA? How do you select from the three testing companies?
More informationGenetic Genealogy. Rules and Tools. Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter
Genetic Genealogy Rules and Tools Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter I am NOT this guy! 2 Genealogy s Newest Tool Genealogy research: Study of Family History Identifies
More informationTools: 23andMe.com website and test results; DNAAdoption handouts.
When You First Get Your 23andMe Results Objective: Learn what to do with results of atdna testing with 23andMe. Tools: 23andMe.com website and test results; DNAAdoption handouts. Exercises: Practice Exercises
More informationBETTER TOGETHER: MAKING YOUR CASE WITH DOCUMENTS AND DNA BCG-sponsored Webinar (https://bcgcertification.org) Patricia Lee Hobbs, CG
BETTER TOGETHER: MAKING YOUR CASE WITH DOCUMENTS AND DNA BCG-sponsored Webinar (https://bcgcertification.org) Patricia Lee Hobbs, CG LIMITATIONS & BENEFITS OF DNA TESTING DNA test results do not solve
More informationDNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding
DNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding by Dr. Ing. Robert L. Baber 2014 July 26 Rights reserved, see the copyright notice at http://gengen.rlbaber.de
More informationWalter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018
DNA, Ancestry, and Your Genealogical Research- Segments and centimorgans Walter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018 1 Today s agenda Brief review of previous DIG session
More informationEwing Surname Y-DNA Project Article 8
Ewing Surname Y-DNA Project Article 8 This is the eighth in a series of articles about the Ewing Surname Y-DNA Project. The previous seven articles have appeared in the last seven issues of the Journal
More informationYour mtdna Full Sequence Results
Congratulations! You are one of the first to have your entire mitochondrial DNA (DNA) sequenced! Testing the full sequence has already become the standard practice used by researchers studying the DNA,
More informationGetting the Most Out of Your DNA Matches
Helen V. Smith PG Dip Public Health, BMedLabSci, ADCLT, Dip. Fam. Hist. PLCGS 46 Kraft Road, Pallara, Qld, 4110 Email: HVSresearch@DragonGenealogy.com Website: www.dragongenealogy.com Blog: http://www.dragongenealogy.com/blog/
More informationMeek DNA Project Group B Ancestral Signature
Meek DNA Project Group B Ancestral Signature The purpose of this paper is to explore the method and logic used by the author in establishing the Y-DNA ancestral signature for The Meek DNA Project Group
More informationThe DNA Case for Bethuel Riggs
The DNA Case for Bethuel Riggs The following was originally intended as an appendix to Alvy Ray Smith, Edwardian Riggses of America I: Elder Bethuel Riggs (1757 1835) of Morris County, New Jersey, and
More informationDAR POLICY STATEMENT AND BACKGROUND Using DNA Evidence for DAR Applications
Effective January 1, 2014, DAR will begin accepting Y-DNA evidence in support of new member applications and supplemental applications as one element in a structured analysis. This analysis will use a
More informationAn Introduction. Your DNA. and Your Family Tree. (Mitochondrial DNA) Presentation by: 4/8/17 Page 1 of 10
An Introduction Your DNA and Your Family Tree (Mitochondrial DNA) Presentation by: FredCoffey@aol.com 4/8/17 Page 1 of 10 Coffey Surname, y-dna Project We're now ready to move on and look at the type of
More informationDNA for Genealogy Librarians. Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District
DNA for Genealogy Librarians Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District What does DNA do? It replicates itself. It codes for the production
More informationGEDmatch Home Page The upper left corner of your home page has Information about you and links to lots of helpful information. Check them out!
USING GEDMATCH Created March 2015 GEDmatch is a free, non-profit site that accepts raw autosomal data files from Ancestry, FTDNA, and 23andme. As such, it provides a large autosomal database that spans
More informationPrimer on Human Pedigree Analysis:
Primer on Human Pedigree Analysis: Criteria for the selection and collection of appropriate Family Reference Samples John V. Planz. Ph.D. UNT Center for Human Identification Successful Missing Person ID
More informationCAGGNI s DNA Special Interest Group
CAGGNI s DNA Special Interest Group 10 Jan 2015 Al & Michelle Wilson Agenda Survey Basics in Fan Charts Recombination Exercise Triangulation Overview Survey 1. Have you taken (or sponsored) a DNA test?
More informationFAMILY HISTORY QUESTIONNAIRE
FAMILY HISTORY QUESTIONNAIRE This form helps us to evaluate if you might have a higher risk of cancer because of your family history. Please complete this form to the best of your ability. If you are unsure
More informationGenealogical Research
DNA, Ancestry, and Your Genealogical Research Walter Steets Houston Genealogical Forum DNA Interest Group March 2, 2019 1 Today s Agenda Brief review of basic genetics and terms used in genetic genealogy
More informationWhen I started my genealogy
Beyond the paper records When I started my genealogy research a few years after my father died in 1989, the only information I had on my paternal grandfather was his name, Richard Frederick Meates, and
More informationUsing Mitochondrial DNA (mtdna) for Genealogy Debbie Parker Wayne, CG, CGL SM
Using Mitochondrial DNA (mtdna) for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical
More information! FTDNA! Ancestry. ! 23andMe. ! Medical Considera,ons. ! Iden,fying family medical history. ! Communica,ng with the medical community
by JEFF CARPENTER! Brief Defini,ons about YDNA, XDNA, mtdna, atdna (Covered in Part 1)! Benefits of Tes,ng DNA! Examples of DNA TESTING! FTDNA! Ancestry! 3andMe Jeff Carpenter, 016 jeffcarpenter1939@gmal.com!
More informationGenealogy Report of Alejandro Lorenzetti Tarabelli
Genealogy Report of Alejandro Lorenzetti Tarabelli My name is Donald Martin Mattos Lorenzetti, Mattos is my paternal surname, and Lorenzetti my maternal surname. For years my maternal family and I have
More informationWelcome to this issue of Facts & Genes, the only publication devoted to Genetic Genealogy.
Facts & Genes from Family Tree DNA ================================== March 3, 2004 Volume 3, Issue 2 In This Issue ============= Editor's Corner In the News: Family Tree DNA Announcements Haplogroups:
More informationIN THIS ISSUE: February From the Administrator Questions/News...1. George Varner of Missouri Direct Line...2
IN THIS ISSUE: From the Administrator..... 1 Questions/News.......1 George Varner of Missouri Direct Line...2 Do the Newtons & Varners Really Both have Riggs DNA?...2 2016 Newton/Varner Reunion. 5 February
More informationFamily Tree DNA Genetic Genealogy Started Here
Family Tree DNA Genetic Genealogy Started Here With 253,000 samples in our DNA database (the largest of its kind in the world) your genealogical search could become even easier Why Bennett Greenspan founded
More informationA Day Out With Your DNA
A Day Out With Your DNA Diahan Southard www.yourdnaguide.com Your testing company has evaluated around 800,000 locations on your DNA to help them determine your origins and your genetic cousins. While
More informationDNA Haplogroups Report
DNA Haplogroups Report for Matthew Mayberry Generated and printed on Sep 25 2011, 01:59 pm X This is a mtdna Haplogroup Report This is a mtdna Subclade Report Search criteria used in this report: HVR-1
More informationRecent Results from the Jackson Brigade DNA Project
Recent Results from the Jackson Brigade DNA Project Dr. Daniel C. Hyde Professor Emeritus of Computer Science Bucknell University Lewisburg, PA Presented at Jackson Brigade Reunion, Horner, WV on August
More informationMitochondrial DNA (mtdna) JGSGO June 5, 2018
Mitochondrial DNA (mtdna) JGSGO June 5, 2018 MtDNA - outline What is it? What do you do with it? How do you maximize its value? 2 3 mtdna a double-stranded, circular DNA that is stored in mitochondria
More informationPrincess Margaret Cancer Centre Familial Breast and Ovarian Cancer Clinic. Family History Questionnaire
Princess Margaret Cancer Centre Familial Breast and Ovarian Cancer Clinic Family History Questionnaire How to complete this questionnaire The information in this questionnaire will be used to determine
More informationThe Jewish Genealogical Society of Great Britain
Edition No. 1-04/2007 (currently under revision) Reformatted and reissued 01/2010 Written by Jill L. Whitehead, M.A. Issued for JGSGB by JGSGB Education & Mentoring JGSGB 33 Seymour Place London W1H 5AP
More informationThe Structure of DNA Let s take a closer look at how this looks under a microscope.
DNA Basics Adapted from a MyHeritage Blog and the International Society of Genetic Genealogy (ISOGG) Wiki by Earl Cory MyHeritage has started a series to explain DNA, how it works and answer the most common
More informationDNA Solu)ons for Brick Walls And Adop)on
DNA Solu)ons for Brick Walls And Adop)on "I have not failed. I've just found ten thousand ways that won't work." Thomas Edison Wise Woman Gene+c Genealogy Comments Listen Carefully! 1. DNA is not the be
More informationAn Introduction to Genetic Genealogy
An Introduction to Genetic Genealogy David A. Pike dapike@math.mun.ca Presented To: Family History Society of Newfoundland and Labrador 24 January 2006 Slide 1 of 21 Overview Genetic Genealogy using genetic
More informationAppendix III - Analysis of Non-Paternal Events
Appendix III - Analysis of Non-Paternal Events Summary One of the challenges that genetic genealogy researchers face when carrying out Y-DNA testing on groups of men within a family surname study is to
More informationFREQUENTLY ASKED QUESTIONS ABOUT THE OWSTON/OUSTON DNA PROJECT
FREQUENTLY ASKED QUESTIONS ABOUT THE OWSTON/OUSTON DNA PROJECT 1. What has been discovered thus far and what may be discovered with testing? The Owston/Ouston DNA project grew out of the combined genealogical
More informationComputer - aided Genealogy. Rob Drew
Computer - aided Genealogy Rob Drew Topics Building your family tree Off-line tools for your laptop or desktop at home. What s a gedcom file? Building an on-line tree. Research websites Where to get help
More informationPutting the genes into genealogy
Putting the genes into genealogy DNA testing can help find lost branches of your family tree. Susan C Meates describes how DNA surname projects work DNA testing for genealogy has been available since 2000,
More informationUsing X-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM
Using X-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.
More informationThe Meek Family of Allegheny Co., PA Meek Group A Introduction
Meek Group A Introduction In the 1770's a significant number of families named Meek(s) lived in S. W. Pennsylvania and they can be identified in the records of Westmoreland, Allegheny and Washington Counties.
More informationThe Kaighins of Scaresdale, Kirk German, Isle of Man
The Kaighins of Scaresdale, Kirk German, Isle of Man Greg Kaighin May 16, 2015 Background After twelve years of research, the parents of John Kaighin (Family 7600) 1 of Kirk German, Isle of Man have finally
More informationLearn what to do with results of autosomal DNA testing from AncestryDNA.
When You First Get Your AncestryDNA Results Objective: Learn what to do with results of autosomal DNA testing from AncestryDNA. Tools: AncestryDNA results; ancestry.com, genesis.gedmatch.com and familytreedna.com
More informationThe Meek Family of Allegheny Co., PA Meek Group A Introduction
Meek Group A Introduction In the 1770's a significant number of families named Meek(s) lived in S. W. Pennsylvania and they can be identified in the records of Westmoreland, Allegheny and Washington Counties.
More informationEvery human cell (except red blood cells and sperm and eggs) has an. identical set of 23 pairs of chromosomes which carry all the hereditary
Introduction to Genetic Genealogy Every human cell (except red blood cells and sperm and eggs) has an identical set of 23 pairs of chromosomes which carry all the hereditary information that is passed
More informationGetting the Most of Your DNA Test. Friends of Irish Research Richard Reid
Getting the Most of Your DNA Test Friends of Irish Research Richard Reid So You Have Been Tested! The results are back and now is time to explore and see if any of your brick walls can be broken down.
More informationEller DNA Project. Status Report for Nashville EFA Conference----July 25, Tom Eller, DNA Project Administrator
Eller DNA Project Status Report for Nashville EFA Conference----July 25, 2009 Tom Eller, DNA Project Administrator Eller DNA Project This presentation used material from Family Tree DNA and from World
More informationBig Y-700 White Paper
Big Y-700 White Paper Powering discovery in the field of paternal ancestry Authors: Caleb Davis, Michael Sager, Göran Runfeldt, Elliott Greenspan, Arjan Bormans, Bennett Greenspan, and Connie Bormans Last
More informationGenetic genealogy and my ancestral background
Genetic genealogy and my ancestral background Edward Gelles In recent years DNA tests have become an important part of genealogical research. The commercial availability of these tests, the increase in
More informationUsing a Y-DNA Surname Project to Dig Deeper Into Your Genealogy: A Case Study
Using a Y-DNA Surname Project to Dig Deeper Into Your Genealogy: A Case Study Allan H. Westreich, Ph.D. Address for correspondence: Allan H. Westreich, Ph.D., 250 Route 28, Suite 206, Bridgewater, NJ 08807,
More informationJewish Genealogy Society of NE Florida
Boris Savchuk - Oyfen Pripitchik - Authentic Jewish melody https://www.youtube.com/watch?v=qhk9cuktcpc Jewish Genealogy Society of NE Florida Bernie Grossman Marla Westberg December 19 th, 2018 Agenda:
More informationWalter Steets Houston Genealogical Forum DNA Interest Group November 18, 2017
DNA, Ancestry, and Your Genealogical Research Session 2 Walter Steets Houston Genealogical Forum DNA Interest Group November 18, 2017 1 Today s agenda Brief review of previous DIG session Degrees of Separation
More informationGenealogical Database merging A tool for the virtual reconstitution of vanished Jewish Communities
H. Daniel Wagner Genealogical Database merging A tool for the virtual reconstitution of vanished Jewish Communities The 15 th World Congress of Jewish Studies 2-6 August 2009, Jerusalem, ISRAEL Lecture
More informationReport on the VAN_TUYL Surname Project Y-STR Results 3/11/2013 Rory Van Tuyl
Report on the VAN_TUYL Surname Project Y-STR Results 3/11/2013 Rory Van Tuyl Abstract: Recent data for two descendants of Ott van Tuyl has been added to the project, bringing the total number of Gameren
More informationContributed by "Kathy Hallett"
National Geographic: The Genographic Project Name Background The National Geographic Society is undertaking the ambitious process of tracking human migration using genetic technology. By using the latest
More informationWINSLOW HERITAGE SOCIETY ~~~~~~~~~~~~~~~~~~
Newsletter, Vol. 2, No. 1 March, 2015 WINSLOW HERITAGE SOCIETY ~~~~~~~~~~~~~~~~~~ In Vol. 1, No. 1 of the Winslow Heritage Society Newsletter, Kathy Myers, Society Governor, a descendant of Kenelm Winslow,
More informationThe FERGUS(S)ON DNA project was organized in August of Currently there are about 450 participants whose y-chromosome has been analyzed.
FERGUS(S)ON DNA Project by Colin R. Ferguson, PhD (First Published in The Bee Line, Clan Fergusson Society of North America, Issue No. 94, Spring 2006 and perpetually revised since then) The FERGUS(S)ON
More informationGenetic Identity and
Genetic Identity and GACATGTAGCTCTTCACTTCACCCAGGTTGGGTTGTGTCAACAGGAAACATTGTAACATATCACTTGGATTAGCACCTAGG/TTAT/TTAT/TTA Community DTC Genetic Testing Workshop The National Academies' August 31 September 1,
More informationFinding a Male Hodge(s) Descendant for Y-Chromosome DNA Testing. Prepared by Jan Alpert
Finding a Male Hodge(s) Descendant for Y-Chromosome DNA Testing Prepared by Jan Alpert Why Test Male Y-Chromosome DNA All males carry the Y-Chromosome of their fathers As a result the same DNA markers
More informationCase Study Pinpointing the Grace English Paternal Ancestral Genetic Homeland
Case Study Pinpointing the Grace English Paternal Ancestral Genetic Homeland Dr Tyrone Bowes 12 th June 2017 INTRODUCTION A simple painless commercial ancestral Y chromosome DNA test will potentially provide
More informationDNA: UNLOCKING THE CODE
DNA: UNLOCKING THE CODE Connecting Cousins for Genetic Genealogy Bryant McAllister, PhD Associate Professor of Biology University of Iowa bryant-mcallister@uiowa.edu Iowa Genealogical Society April 9,
More informationOrder of the Founders of North America Lineage Documentation Guidelines 09/18/2012 A. General Application requirements. 1. Application completeness
Order of the Founders of North America Lineage Documentation Guidelines 09/18/2012 A. General Application requirements 1. Application completeness Documentation of applicant s biological bloodline ascent
More informationTracking Your Roots With DNA
Tracking Your Roots With DNA Genetic Genealogy Lisa R Franklin RN,BSN 31 Oct 2013/27 Jun 2014 Andalusia, Alabama Why DNA test? Determine if two people are related Determine if two people descend from the
More informationDNA, A Genealogy Tool. The Search for an Expert Genealogist, Photos & Clues
DNA, A Genealogy Tool The Search for an Expert Genealogist, Photos & Clues mydanishancestors.com *Slide Show shared in this class & more web-sites under Toolbar/DNA *One doesn t have to have Danish ancestors
More informationHow a DNA Project has produced discoveries in the Meates One- Name Study not possible with paper records alone
How a DNA Project has produced discoveries in the Meates One- Name Study not possible with paper records alone By Susan C. Meates ORE AND more one-namers are fascinated by the new genealogy of DNA testing
More informationCommon ancestors of all humans
Definitions Skip the methodology and jump down the page to the Conclusion Discussion CAs using Genetics CAs using Archaeology CAs using Mathematical models CAs using Computer simulations Recent news Mark
More informationCLAN DONNACHAIDH DNA NEWS No 1
CLAN DONNACHAIDH DNA NEWS No Introduction Greetings to everyone who has taken part. This is the first of an occasional publication, which will be published when there is something to say or time to write
More informationLearn what to do with results of autosomal DNA testing from AncestryDNA. Tools: AncestryDNA results; ancestry.com, gedmatch.com and familytreedna.
First Look : AncestryDNA When You First Get Your AncestryDNA Results Objective: Learn what to do with results of autosomal DNA testing from AncestryDNA. Tools: AncestryDNA results; ancestry.com, gedmatch.com
More informationWalter Steets Houston Genealogical Forum DNA Interest Group April 7, 2018
Ancestry DNA and GEDmatch Walter Steets Houston Genealogical Forum DNA Interest Group April 7, 2018 Today s agenda Recent News about DNA Testing DNA Cautions: DNA Data Used for Forensic Purposes New Technology:
More informationDNA TESTING. This is the testing regime for FamilyTreeDNA. Other SNP tests were ordered from Yseq.
DNA & GENEALOGY DNA TESTING This is the testing regime for FamilyTreeDNA. Other SNP tests were ordered from Yseq. Product Date Batch Family Finder 30-May-14 Completed 569 05-Aug-14 Batched 569 05-Jul-14
More informationVisual Phasing of Chromosome 1
Visual Phasing of Chromosome 1 If you have the possibility to test three full siblings, then the next great thing you could do with your DNA, is to try out the Visual Phasing technique developed by Kathy
More informationcompany does improve its ethnicity estimates, your profile will automatically be updated, too. You won't have to retake the test to get the new
Ancestry dna kit The Y-DNA test is more limited than the ones from Family Tree DNA Does not offer a less expensive 'autosomal DNA-only' test Can't connect with other matches Can't upload raw data from
More informationGenetic Genealogy Journey Tips for Initial Contact with a Match Debbie Parker Wayne, CG SM, CGL SM
Genetic Genealogy Journey Tips for Initial Contact with a Match Debbie Parker Wayne, CG SM, CGL SM Genetic genealogists frequently complain about the low response rate to requests for contact with our
More informationPresentation for BCG Webinar, April 2016
Finding Your Early 1800 s US Ancestors Online Presentation for BCG Webinar, April 2016 James M. Baker, PhD, CG jimb@starstream.net Data Type Comments Online Sources 1. US 1850 census lists everyone and
More informationBefore India: Exploring Your Ancestry With DNA By David G. Mahal
Before India: Exploring Your Ancestry With DNA By David G. Mahal You then receive an email notifying you that your results are ready to explore on utilize your DNA results for family history by Ancestry.com
More informationPlease complete the information in this packet and return it PRIOR to your appointment with the Familial Cancer Risk Assessment Center.
Please complete the information in this packet and return it PRIOR to your appointment with the Familial Risk Assessment Center. The information gathered from these questionnaires will be used to assess
More informationFind JCD Project Date: Identification-DNA Process Updated:
New Look Investigations Created by: Jack Friess Find JCD Project Date: 04-20-2018 Identification-DNA Process Updated: 05-24-2018 Questions and Answers Identification-DNA (ID-DNA) is a scientific process
More informationUniversity of Washington, TOPMed DCC July 2018
Module 12: Comput l Pipeline for WGS Relatedness Inference from Genetic Data Timothy Thornton (tathornt@uw.edu) & Stephanie Gogarten (sdmorris@uw.edu) University of Washington, TOPMed DCC July 2018 1 /
More informationOrigins: Coffey/Keogh Families By Fred Coffey. ONLINE:
Origins: Coffey/Keogh Families By Fred Coffey ONLINE: http://www.coffey.ws/familytree/dna/origins-coffeykeoghfamilies.pdf My name is Coffey, and I m very interested in working out the origins of my family.
More informationDNA CHARLOTTE COUNTY GENEALOGICAL SOCIETY - MARCH 30, 2013 WALL STREET JOURNAL ARTICLE
DNA CHARLOTTE COUNTY GENEALOGICAL SOCIETY - MARCH 30, 2013 WALL STREET JOURNAL ARTICLE NATIONAL GEOGRAPHIC GENOGRAPHIC PROJECT ABOUT NEWS RESULTS BUY THE KIT RESOURCES Geno 2.0 - Genographic Project
More information