DNA TESTING. This is the testing regime for FamilyTreeDNA. Other SNP tests were ordered from Yseq.

Transcription

1 DNA & GENEALOGY

2 DNA TESTING This is the testing regime for FamilyTreeDNA. Other SNP tests were ordered from Yseq. Product Date Batch Family Finder 30-May-14 Completed Aug-14 Batched Jul-14 Ordered 569 Z Mar-14 Completed Jan-14 Batched Jan-14 Ordered 553 CTS Jan-14 Completed Jan-14 Batched Jan-14 Ordered 551 Y-DNA Feb-14 Completed Feb-14 Batched Dec-13 Ordered 549 Y-DNA67 15-Jul-13 Completed Jun-13 Batched Jun-13 Ordered 521 mtfull Sequence 15-Apr-13 Completed Nov-12 Ordered Nov-12 Batched 492 Z Nov-12 Completed Oct-12 Batched Oct-12 Ordered 488 Deep Clade 27-Sep-12 Completed Jul-12 Batched Jul-12 Ordered 474 Y-DNA37 25-Jul-12 Completed Jun-12 Batched May-12 Ordered 468 Kit 12/06/2012 Received By Lab 08/06/2012 Received 25-May-12 Sent 24-May-12 Ordered

3 _Y-DNA TEST RESULTS Y-DNA Results. The results for 111 markers are shown below. The first 37 markers were used to predict my Haplogroup of G. Subsequent Deep Clade and individual SNP tests refined the classification even further. PANEL 1 (1-12) Marker DYS393 DYS390 DYS19 DYS391 DYS385 DYS426 DYS388 DYS439 DYS389I DYS392 DYS389II Value PANEL 2 (13-25) Marker DYS458 DYS459 DYS455 DYS454 DYS447 DYS437 DYS448 DYS449 DYS464 Value PANEL 3 (26-37) Marker DYS460 Y-GATA-H4 YCAII DYS456 DYS607 DYS576 DYS570 CDY DYS442 DYS438 Value PANEL 4 (38-47) Marker DYS531 DYS578 DYF395S1 DYS590 DYS537 DYS641 DYS472 DYF406S1 DYS511 Value PANEL 4 (48-60) Marker DYS425 DYS413 DYS557 DYS594 DYS436 DYS490 DYS534 DYS450 DYS444 DYS481 DYS520 DYS446 Value PANEL 4 (61-67) Marker DYS617 DYS568 DYS487 DYS572 DYS640 DYS492 DYS565 Value PANEL 5 (68-75) Marker DYS710 DYS485 DYS632 DYS495 DYS540 DYS714 DYS716 DYS717 Value PANEL 5 (76-85) Marker DYS505 DYS556 DYS549 DYS589 DYS522 DYS494 DYS533 DYS636 DYS575 DYS638 Value PANEL 5 (86-93) Marker DYS462 DYS452 DYS445 Y-GATA-A10 DYS463 DYS441 Y-GGAAT-1B07 DYS525 Value PANEL 5 (94-102) Marker DYS712 DYS593 DYS650 DYS532 DYS715 DYS504 DYS513 DYS561 DYS552 Value PANEL 5 ( ) Marker DYS726 DYS635 DYS587 DYS643 DYS497 DYS510 DYS434 DYS461 DYS435 Value

4 _Y-DNA TEST RESULTS STR Test Certificate. The FamilyTreeDNA test certificate for all 111 Loci.

5 _Y-DNA TEST RESULTS SNP Test Certificate. The FamilyTreeDNA SNP test certificate.

6 _Y-DNA TEST RESULTS As at February 2017

7 _Y-DNA TEST RESULTS - MAPS Maps. The Y-DNA Migration Maps page shows two maps to help you visualize your direct paternal ancestors' historic and anthropological migrations. The current version of the main Haplogroup migrations map is shown below. On the next page are the maps specific to my Y-DNA tests The first is the Haplogroup Migrations Map. It shows general migration paths for the major haplogroups. The second is the Haplogroup Frequency map. It shows the frequency of the major haplogroups for different world regions.

8 _Y-DNA TEST RESULTS - MAPS

9 _Y-DNA TEST RESULTS - MAPS Haplogroups G and G-FGC14522 Distribution in Europe.

10 Yseq SNP Test Results - March 2016 In the past decade Y chromosome analysis has made huge progress and allows experienced genealogists to decipher their ancestry far beyond the paper trails. The YSEQ DNA Origins Project is your partner for your DNA related research. Discover what great and interesting information is hidden in your Y-chromosome. YSEQ provides SNP (single nucleotide poly-morphism) analysis on the human Y-chromosome. You may put a marker on the SNP wish list if you can t find it in our Shop. We constantly expand the paternal haplogroup tree with updated information about exact SNP positions. Our service includes STR (short tandem repeat) analysis as well. You have the choice between single markers and entire panels. The main goal of the YSEQ DNA Origins Project is detailed knowledge about male ancestry. The YSEQ project serves as a platform for citizen scientists. Newly discovered SNPs will be added to YBrowse on ISOGG s website and the results will be shared with the community of DNA genealogists. + No Subscription Fees + No DNA-extraction Costs + Single Markers & Panels + Custom designed Primers + SNP wish list + SNP discovery + Verification of new SNPs + Registration of new SNPs + Support of Citizen Science + Get raw sequencing data + Get other SNPs on same segment for FREE Y-DNA TEST RESULTS (YSEQ) The results from my SNP tests at Yseq are shown on the next page For an explanation of the results see the copy of the from Rolf Langland (Project Administrator of the G-L497 project) later.

11 Y-DNA TEST RESULTS (YSEQ) SampleID Marker+ Chr Start End Allele 444 A7256 ChrY C- 444 DYF399X ChrY DYS464X ChrY t-20.1t- 23c 12g-13g-13g- 14g 444 F149 ChrY T- 444 FGC12057 ChrY G- 444 FGC13748 ChrY A- 444 FGC14522 ChrY T+ 444 FGC25549 ChrY G- 444 FGC37088 ChrY G- 444 FGC4433 ChrY G- 444 FGC4856 ChrY C- 444 K228 ChrY G- 444 M1567 ChrY T- 444 M6653 ChrY G- 444 M8468 ChrY T- 444 PF3426 ChrY A- 444 PF5666 ChrY C- 444 S23438 ChrY A- 444 S24385 ChrY C- 444 S2808 ChrY A+ 444 Y13104 ChrY A- 444 Y3001 ChrY G- 444 YFS ChrY C- 444 YP2576 ChrY G- 444 Z1685 ChrY G- 444 Z17780 ChrY A- 444 Z17783 ChrY T- 444 Z30729 ChrY A-

12 Y-DNA TEST RESULTS (YSEQ) The technical details from Yseq concerning the S2808 and S23438 SNP s. These SNP s were identified by Jim Wilson in 2014 as a result of Y-DNA testing at Britains DNA. The FGC14522 SNP was characterised by the Full Genomes Corporation. S2808 [S2808] HG19 Position: ChrY: Ancestral: G Derived: A Reference: Jim Wilson (2014) ISOGG Haplogroup: G2a2b2a1b1a2a1 Comments: below CTS4803 Forward Primer: S2808_F GCAAGGAGCAGCACTACCTC Reverse Primer: S2808_R AGCACATCCCAGTGCTCTTC S23438 [S23438] HG19 Position: ChrY: Ancestral: A Derived: G Reference: Jim Wilson (2014) ISOGG Haplogroup: G2a2b2a1b1a2a1a Comments: below CTS4803 Forward Primer: S23438v2_F GGAGTTCTGATAAGAGAGGGACAC Reverse Primer: S23438v2_R CTGACCATAATATTTTAGGCCAGG FGC14522 [FGC14522] HG19 Position: ChrY: Ancestral: C Derived: T Reference: Full Genomes Corp. (2014) ISOGG Haplogroup: G (not listed) Comments: Below Z726 > S2808 Forward Primer: FGC14522_F AAGGAACAATAGGAGTGCAAGTC Reverse Primer: FGC14522_R ACAAAGGCCAGACACACCTC

13 Y-DNA TEST RESULTS (YSEQ) Rolf Langland writes - Thank you for sending these new SNP results. It shows that you are positive for the S2808 SNP, and negative for its subgroup S The other SNPs shown on your results are not currently used for classification in the YDNA-G phylogenetic tree, except for PF3426, which is an SNP in the L694 branch and it is expected that you would be negative for that, since our project (GL497) descends from L140 and not from L694. For reference, the two attached diagrams show the current structure of the G-tree. I have updated your categorization in the Project Roster, so you are now in S2808+ and negative for sub-group S This is a fairly new category for which we do not currently have a large sample size. At present, it is comprised of persons from nations around the Baltic Sea and North Sea, including England, Belgium, Sweden and Poland, see below. The age of S2808 may be about 3,500 to 4,000 years. Also, at present, we have not identified any SNPs (other than S23438) below S2808 for possible testing. We hope additional SNP testing options for S2808 persons may be identified later this year. Note: Subsequently the Big Y test found FGC14522 below S2808, indeed further subgroups of S2808 have been determined. Haplogroups G-FGC14522 Distribution in Europe (February 2017).

14 G-L497 PHYLOGENETIC TREE

15 G-L497 PHYLOGENETIC TREE

16 G-L497 PHYLOGENETIC TREE

17 DNA TESTING - BIG Y The BIG Y product is a direct paternal lineage test. FTDna have designed it to explore deep ancestral links on our common paternal tree. It tests both thousands of known branch markers and millions of places where there may be new branch markers. We intend it for expert users with an interest in advancing science. It may also be of great interest to genealogy researchers of a specific lineage. It is not however a test for matching you to one or more men with the same surname in the way of our Y-DNA37 and other tests. The BIG Y product uses next-generation sequencing to reveal genetic variations across the Y-Chromosome. Both BIG Y and Geno 2.0 test for thousands of paternal lineage branch markers (SNPs). Unlike Geno 2.0 and related technologies though, BIG Y is able to detect new branch markers that are unique to your paternal lineage, surname, or even you. Geno 2.0 is microarray chip based and programmed for specific SNPs. BIG Y is a next-generation sequence-based test. Targeted Non-recombining Y-DNA sequencing Illumina HiSeq X to 80X average coverage Around 11.5 to 12.5 million base-pairs of reliably mapped positions of non-recombining Y- Chromosome Analyzed using Arpeggi genome analysis technology for improved variant calls. All samples are processed in-house using our custom laboratory methods and informatics.

18 In October 2014 I submitted a sample for testing by Yorkshire DNA. The test is Chromo2 YDNA Your fatherline story from over 15,000 Y chromosome markers, more than any other product on the market. The results were received in December Fatherline - was defined as Ancient Caucasian, G-S314, using the terminology used by Yorkshires DNA Subtype Your subtype is G-S2808 DNA TESTING - YORKSHIRES DNA Your S2808 marker defines a subtype of the major CTS4803 cluster. So far it has only been seen in British men, but it is too early to tell whether it is truly confined to the British Isles. You may carry markers that further define your subtype, but do not yet appear on our tree. You will find these in your genetic signature. Note: In fact there are other European individuals with the same Subtype as tested by FtDNA and yseq. Your DNA marker is ANCIENT CAUCASIAN. In Europe it is widespread but rare with a distribution that thins out from the south-east to the north-west and in Britain it is very rare, carried by only 0.5% of men. By contrast, it is by far the most common type in the Caucasus, the mountainous region between the Black Sea and the Caspian Sea. Your Y chromosome group, what tracks your paternal lineage, is part of the G group of lineages and it is designated G-S314. It indicates descent in the male line from the prehistoric inhabitants of what is now Georgia and parts of the Russian Federation. In the region of North Ossetia-Alania (named after the barbarian tribe, the Alans, who attacked the Roman Empire in the 4th and 5th centuries) 57% of all men carry your marker, while 30% of all Georgian men have it. The G group developed in the Caucasus and spread from there to what is now modern Turkey and the plateaus of central Iran more than 15,000 years ago. Very rare in Britain, it was brought across Europe by the spread of farming techniques, the most profound revolution in human history. Sub-groups of your lineage have been identified in DNA extracted from prehistoric skeletons in Germany and France. Both examples date to c3,000bc and their location tracks the movement of farming and dates its arrival in Western Europe. Your earliest ancestors probably reached Britain at around the same time. It also sailed across the North Sea with the peoples known collectively as the Anglo-Saxons. They raided and then began to settle in the 5th and 6th centuries. Later, in the 9th and 10th centuries, more Germanic peoples, this time collectively known as the Danes, also came and settled, particularly in what came to be called the Danelaw, the north and east of England. They too brought G-S314 with them.

19 British Isles Genetic makeup. DNA TESTING - YORKSHIRES DNA Recent results from the testing carried out by Britains DNA is now beginning to show the Y-DNA Haplogroup makeup of the British Isles. It shows that my Haplogroup accounts for around 1.6% of the population. This is very much in line with other sources such as FamilyTreeDNA.

20 DNA TESTING - LIVING DNA In February 2017 I submitted a sample for testing by LivingDNA. The results should be available by the end of May A Living DNA test brings your history to life and provides over twice the detail of other ancestry tests. Discover where your ancestors come from and much more. Your family ancestry broken down across 80 worldwide regions including 21 in Britain and Ireland. Twice the detail of other tests. 3 tests in 1 - we also show your motherline ancestry and, if you are a male, your fatherline ancestry too. As our research is refined, your results are updated into more detail at no charge We put your results into context, allowing you to explore your ancestry at different points in history The DNA testing laboratory and our entire team have developed state of the art facilities to ensure the most reliable test results possible. And as the first company worldwide to have access to the latest Illumina chip platform, your results are cutting edge. Family Ancestry We give you your estimated family ancestry breakdown today, and we also put your results in context, looking at your ancestry through history. If you have British or Irish ancestry then it s the only test that shows where within Britain and Ireland your ancestry comes from. Motherline Ancestry Find out where your motherline descends from with a detailed breakdown of all the ancestral groups that have been part of this line. Through your mtdna, we look at the history of your motherline from the point in Africa when we all shared the same DNA until recent times. We also highlight any famous people who share the same motherline group as you. Fatherline Ancestry Through your Y-DNA, men can see the paths of their male ancestors and explore the history of their fatherline from the point in Africa when we all shared the same DNA until recent times. We also highlight any famous people who share the same fatherline group as you. You will only receive this if you are a male because females don t carry the Y chromosome however, females will still get parts of their father's ancestry through their autosomal DNA.

21 DNA TESTING - LIVING DNA Example result from Living DNA (Sub regional - based on the People of the British Isles project.