INTRODUCTION. Over the past few years there have been great strides in the application of DNA testing for genealogical purposes.

Transcription

1 DNA & GENEALOGY

2 Over the past few years there have been great strides in the application of DNA testing for genealogical purposes. Y-DNA testing can confirm your genealogical connections on your direct paternal lineage and expand your understanding of your deepest paternal ancestral origins. Because your Y-DNA has been passed on to you generation after generation by your direct paternal ancestors, it offers the most exact information possible for this line. Testing your mtdna, which men and women inherit from their mother, uncovers the deep ancestral origin of your direct maternal line (your mother, your mother s mother, etc.) and connects you with genetic cousins How DNA is inherited INTRODUCTION Humans have 46 chromosomes in the nucleus of our cells, long strands of DNA that - even under a microscope - are only visible during cell division. We inherit 23 chromosomes from each of our parents, and we get 22 of them whether we are male or female; they are called autosomes. The last two chromosomes determine sex: females have two X chromosomes, one inherited from each parent; males have one X chromosome (inherited from their mother) and one Y chromosome (inherited from their father). Cells also contain organelles (the word means 'little organs') called mitochondria which have their own DNA (it's thought that mitochondria are the relics of bacteria that invaded cells over a billion years ago); the role of mitochondria is to provide energy for the cell. These mitochondria are passed by mothers to all of their children, both male and female - but only the female children can pass their mitochondria, and thus their mtdna, to the next generation. Y chromosome

3 The fact that the Y chromosome passes from father to son with only slight modifications means that Y-DNA tests can be very useful when used in conjunction with surname studies - because surnames normally pass from father to son - and it allows male cousins who bear the same surname to confirm that they share a common ancestor. It's even possible to estimate how many generations back that common ancestor lived, which is very useful. There's also the tantalising possibility of using a Y-DNA test to discover the identity of the father of an illegitimate child - but only in certain circumstances. For a start, the child must be a boy - otherwise the Y chromosome won't have been passed on - and for the same reason the person providing the DNA sample needs to be a descendant in the direct male line. Mitochondrial DNA INTRODUCTION What will an mtdna test tell you? Mitochondrial DNA passes virtually unaltered from mother to child, which means that in theory you can trace back your ancestry on your maternal line for thousands of years. This was the logic behind the 'Seven daughters of Eve' concept developed by Professor Bryan Sykes, and described in his book. Whilst it has a romantic appeal, so far as genealogy is concerned it's pretty useless. Why? Because with every generation you go back the number of ancestors doubles, and once you go back more than a few thousand years it's statistically likely that we all share exactly the same ancestors. This means that identifying one person on one line 45,000 years ago is pretty meaningless, because everyone else in the world is also descended from that person, albeit by a different route. Can mtdna tests provide any insight in cases of illegitimacy? Usually there will be no doubt who the mother was, but there are exceptions - for example, the child may have been a foundling, or adopted and given a new name. However, because the surname changes with each generation, it won't be easy to interpret matches in a meaningful way.

4 INTRODUCTION Are autosomal DNA tests the future? Autosomal DNA comes from the 22 pairs of chromosomes that are inherited by all children, male or female. Whereas Y-DNA and mtdna tests can only tell us about the ancestors at the extreme edges of our family tree, an autosomal DNA test (such as the Family Finder test from Family Tree DNA) offers the potential to make discoveries and solve mysteries in any of our family lines. However, before getting too excited about the prospects it's important to understand how autosomal DNA is inherited. We inherit one chromosome in each pair from our father and one from our mother - and that sounds pretty simple, until you remember that each of our parents has two copies of each autosome. What decides which one of each pair they pass to us? In practice we get a mixture - within each of the autosomes you inherited from your father there will be some parts that came from his father, and some that came from his mother. The same applies to your grandparents - they inherited a mixture from their parents, and so on, and so on. This means that our DNA literally does contain a record of our ancestry, though of course, what we don't know is which bit of autosomal DNA came from which ancestor. The companies which offer auto tests use sophisticated statistical algorithms to determine which of their customers may be related - and they're also able to estimate how close the relationship is (the longer the segments of DNA that two possible cousins share, the closer the relationship is likely to be). One day it will be feasible for the average family historian to have their entire genome sequenced: until then autosomal tests are the best option for those of us who are looking for more information about our ancestry than can be reliably ascertained using the available records. Family Tree DNA's test uses over 700,000 pairs of locations, which is a phenomenally large number compared to previous tests - and yet it still represents only 0.024% (about 1/4000th) of your autosomal DNA! Your genetic history. How is it possible to retrace the steps of our ancestors by analysing the DNA of living people? Inheritance is the key. Each of us inherits around six billion letters of DNA from our parents, three billion from each. Made up from four biochemicals, adenine, cytosine, guanine and thymine, our genes are read by scientists like very long strings of letters, sequences of A,C,G and T. There are two special sorts of DNA that are particularly useful for learning about our past. Our fathers pass on Y chromosome DNA to their sons while mothers pass on mitochondrial DNA, or mtdna, to their sons and to their daughters. But mtdna dies with men and it survives only in the female line. This means we can read two stories in men s DNA, one for their Y chromosome lineage and one for their mtdna lineage. In women we can read only their mtdna story. As we have seen above, it is important to realise that the Y chromosome and mtdna are only a small part of our DNA, our genome. Nevertheless they are the most informative means we have for learning about our ancient lineages. However these two piece of DNA are only a small part of a much larger genetic inheritance that includes, for example, physical traits such as eye and hair colour or stature.

5 DNA CONCEPTS Y DNA Every human has DNA within the cells. The DNA is passed from parents to each new child when the human embryo is first formed. The DNA is not found in one continuous unit. Instead there are several dozen identifiable parts called chromosomes. We are interested, in particular, in the Y-DNA chromosome. This chromosome has the unique feature of being passed almost unchanged from a father to his biological sons. Because Y-DNA is almost unchanged, we can find the nearest relatives to any male person by locating persons whose Y-DNA looks almost the same. The farther back in time one shares a common ancestor with someone, the more differences will be found on the Y-DNA. SNP MUTATIONS Scientists noticed that it is possible to divide up all the world's men into genetic groups based on whether they have or do not have certain changes in the Y-DNA, called mutations. In particular, they were interested in types of mutations called SNP mutations. These mutations once present on the Y-DNA chromosome are never lost if they are true SNP mutations. Typically, a person who is initially tested at Family Tree DNA and many other DNA labs will not have testing for SNPs. These are ordered later. Because a SNP mutation is a change in the structure of a chromosome structure, the lab will report only whether the SNP mutation is present (+) or is absent (-). HAPLOGROUPS Scientists determined that it was possible to divide all the men in the world into distinctive groups, which they called haplogroups. If one belongs to a particular haplogroup, one possesses a specific SNP mutation on the Y-DNA chromosome. Because all men belong to one of several dozen haplogroups, the scientists assigned each haplogroup a letter of the alphabet. Some men will belong to haplogroup A; others to haplogroup B; others to haplogroup C, and so on. SUB-HAPLOGROUPS Scientists also noticed that some men within a specific haplogroup, such as haplogroup G, share additional SNP mutations that others within the same haplogroup lack. So it is possible to once again categorize the men within a haplogroup, but this time the categories can be called sub-haplogroups. The clumsy method used to identify these sub-haplogroups involves alternating letters and numbers. For example, a particular man within haplogroup G might belong to sub-haplogroup G2a3b1a1a1. The oldest shared mutation is found on the far left -- the G. Everyone within haplogroup G has this mutation. The component next to the G (the 2) is the next oldest mutation shared by only the men in the sub-haplogroup. Once one reaches the far right, the final 1, this is the most recent mutation shared by men in this particular sub-haplogroup. The more of these groupings that can be identified, the better. They give a picture of the migratory history of our particular ancestors. It is definitely possible to identify many more of these shared SNP mutations, providing a very specific genetic history of deep ancestry.

6 SHORTHAND DESIGNATIONS FOR SNPs Because Y-DNA is enormously long, the labs have come up with shorthand designations for the SNPs used to define haplogroups and their sub-haplogroups. For example, instead of saying the SNP that defines the final component of G2a3b1a1a1 is at position on the Y-DNA chromosome, they have provided the shortened designation of L13. And for the first component, instead of, for example , they call it M201. Because sub-haplogroup designations frequently change as new SNPs are identified, it is necessary for you to know which SNP item, such as L13, is the most recent and specific one tested in your situation. The DNA labs often sell tests that combine a number of SNP tests specific to a haplogroup. At Family Tree DNA, for example, this is called the deep clade SNP test for a specific haplogroup. This field of research is so fast-moving, however, that not all the relevant SNPs are included in the standard panel of tests yet, and some may have to be ordered separately. MARKERS AND MUTATIONS DNA CONCEPTS The initial test for most customers of DNA labs consists of a series of what are called markers. While the SNPs mutations involve permanent changes to the structure of the DNA, what is tested at these markers instead is the number of times a particular DNA component is repeated. The result at a particular marker is reported as a number. Each marker has a short designation, such as DYS390, DYS425, YCA, etc. The value reported to you associated with the marker indicates how many repeats were found there. For example, when marker DYS390 has 22 repeats, one can say DYS390=22. When the Y-DNA is passed on to a son, slippage may occur at one of the marker sites. If another repeat is added, the value would increase to 23. If a repeat is lost, the value drops to 21. While these marker number changes are valuable in comparing persons in recent centuries, they are not suitable for grouping persons into the major haplogroup categories because they are not permanent changes. Occasionally the process of passing on Y-DNA to a son may result in more severe slippage at a particular marker, and this results in loss or gain of multiple repeats. If this big change in number of repeats is found to be shared by other men in the sub-haplogroup, then this can be the basis of yet another subgroup in addition to the the categories based on shared SNP mutations. Categories based on marker value oddities are not perfect choices for grouping because someone may occasionally develop another mutation as to number of repeats at this same marker. But marker oddities are, nevertheless, very helpful though not perfect.

7 There are some markers where mutations almost never occur. At such markers a one-value change may be the basis of a category. The complete loss of all repeats at a marker may also make a useful category. A category based on a marker oddity can be designated, for example, as the DYS568=9 subgroup when a mutation in number of repeats has changed the normal finding from 12 to 9. PREDICTING SUB-HAPLOGROUPS FROM MARKER VALUES It is often possible to predict which sub-haplogroup is your sub-haplogroup based on he values seen at the markers. This is why the labs do marker testing first. Having these marker results dramatically narrows down which SNPs needed to be tested. Some sub-haplogroups are associated with extremely distinctive marker values. Others may have number patterns seen in multiple sub-haplogroups, and predicting the correct sub-haplogroup for these latter samples may be difficult. CLUSTERS DNA CONCEPTS A final way of categorizing men once the SNP mutations categories and marker oddity categories are exhausted, is locating persons whose complete set of marker values are very similar. Such groupings are called clusters or clades. Within the haplogroup G project people who have 9 or fewer differences in marker values when comparing 67 markers can be considered part of the same cluster. Once more than 9 differences are found, overlapping with other subgroups can occur and use of less than 67 markers has not proven reliable.

8 DNA CONCEPTS Y-DNA (Y-chromosome DNA) This can confirm your genealogical connections on your direct paternal lineage and expand your understanding of your deepest paternal ancestral origins. Because your Y-DNA has been passed on to you generation after generation by your direct paternal ancestors, it offers the most exact information possible for this line. Information supplied by FamilyTreeDNA on completion of tests. Matches - If your DNA has exact or close matches to other results in FTDNA database, you will see a list with the names, addresses and the level of matching, so that you can contact them and exchange genealogical information. Haplogroup - Results for all standard Y-STR tests include your predicted Y-DNA haplogroup, i.e., your paternal line's deep ancestral origin. If we cannot predict the haplogroup with 100% certainty, we will run a SNP test free of charge to determine it. Ancestral Origins - Based on your matches, results pages include Ancestral Origins and Haplogroup Origins lists that provide hints of your direct paternal line's recent ancestral origins. The magnitude and content of the list will depend on the level of uniqueness of your sample in the database. Maps - Several maps show both the locations of your matches' most distant known ancestors and the ancient migration paths of your distant ancestors. Y-chromosome DNA (Y-DNA) haplogroups are the major branches on the human paternal family tree. Each haplogroup has many subbranches. These are subclades. Haplogroups and their subclades (branches) mark human migrations. Thus, learning about haplogroups can tell you about your ancestors' history and travels. Y-chromosome DNA (Y-DNA) haplogroups and subclades names follow the conventions of the Y- Chromosome Consortium's (YCC). There are two naming methods: the long form and the short form. The YCC long form names haplogroups with alternating numbers and letters: S, S1, S1a, etc. The YCC short form names haplogroups with the first letter from the major haplogroup branch. This is followed by a dash and the name of the final SNP: S-M310, S-M254, S-P57, etc. Note: Both mtdna and Y-DNA tests provide haplogroup information. The haplogroup nomenclature is different for each. A Y-DNA Deepclade test uses a calculation based on genetic distance to determine your most likely Y- chromosome DNA (Y-DNA) haplogroup. The program compares your Y-DNA STR (short tandem repeat) profile to our results database. The program uses exact and near matches to provide an estimate of your likely haplogroup and subclade. The program then tests your DNA for the actual SNPs (single nucleotide polymorphisms). If positive results confirm the initial placement, the program tests subbranches on the Y-Chromosome Consortium's (YCC) tree. If negative results disprove the initial SNP placement, the program tests SNPs higher up on the tree until it finds a positive result. The result is a high quality confirmation of your placement on the YCC tree.

9 DNA TESTING The first DNA tests were taken in 2003 using a UK company called GeoGene. The Y-DNA result indicated that it was unusual, though the scope of the test was quite limited. The mtdna result showed that it belonged to the H group. In recent years DNA testing has progressed to become more sophisticated so it was decided in 2012 to undergo another test using the American company FamilyTreeDNA. This company was selected because of the large number of tests it has carried out. The initial Y-DNA test was the 37 marker test, this was followed up by further test such as the Deep Clade test and the 67 Marker and 111 marker tests. These were followed by individual SNP tests which are ongoing. The mtdna test was also added to the list along with the latest Family Finder test. The details of the test regime and the results are shown on the following pages. An example of a testing kit used for mouth swabs

10 DNA TESTING This is the testing regime for FamilyTreeDNA. Other SNP tests were ordered from Yseq. Product Family Finder Z726 CTS4803 Y-DNA111 Y-DNA67 mtfull Sequence Z725 Deep Clade Y-DNA37 Kit Date Batch 30-May-14 Completed Aug-14 Batched Jul-14 Ordered Mar-14 Completed Jan-14 Batched Jan-14 Ordered Jan-14 Completed Jan-14 Batched Jan-14 Ordered Feb-14 Completed Feb-14 Batched Dec-13 Ordered Jul-13 Completed Jun-13 Batched Jun-13 Ordered Apr-13 Completed Nov-12 Ordered Nov-12 Batched Nov-12 Completed Oct-12 Batched Oct-12 Ordered Sep-12 Completed Jul-12 Batched Jul-12 Ordered Jul-12 Completed Jun-12 Batched May-12 Ordered /06/2012 Received By Lab 08/06/2012 Received 25-May-12 Sent 24-May-12 Ordered

11 _Y-DNA TEST RESULTS Y-DNA Results. The results for 111 markers are shown below. The first 37 markers were used to predict my Haplogroup of G. Subsequent Deep Clade and individual SNP tests refined the classification even further. PANEL 1 (1-12) Marker DYS393 DYS390 DYS19 DYS391 DYS385 DYS426 DYS388 DYS439 DYS389I DYS392 DYS389II Value PANEL 2 (13-25) Marker DYS458 DYS459 DYS455 DYS454 DYS447 DYS437 DYS448 DYS449 DYS464 Value PANEL 3 (26-37) Marker DYS460 Y-GATA-H4 YCAII DYS456 DYS607 DYS576 DYS570 CDY DYS442 DYS438 Value PANEL 4 (38-47) Marker DYS531 DYS578 DYF395S1 DYS590 DYS537 DYS641 DYS472 DYF406S1 DYS511 Value PANEL 4 (48-60) Marker DYS425 DYS413 DYS557 DYS594 DYS436 DYS490 DYS534 DYS450 DYS444 DYS481 DYS520 DYS446 Value PANEL 4 (61-67) Marker DYS617 DYS568 DYS487 DYS572 DYS640 DYS492 DYS565 Value PANEL 5 (68-75) Marker DYS710 DYS485 DYS632 DYS495 DYS540 DYS714 DYS716 DYS717 Value PANEL 5 (76-85) Marker DYS505 DYS556 DYS549 DYS589 DYS522 DYS494 DYS533 DYS636 DYS575 DYS638 Value PANEL 5 (86-93) Marker DYS462 DYS452 DYS445 Y-GATA-A10 DYS463 DYS441 Y-GGAAT-1B07 DYS525 Value PANEL 5 (94-102) Marker DYS712 DYS593 DYS650 DYS532 DYS715 DYS504 DYS513 DYS561 DYS552 Value PANEL 5 ( ) Marker DYS726 DYS635 DYS587 DYS643 DYS497 DYS510 DYS434 DYS461 DYS435 Value

12 _Y-DNA TEST RESULTS STR Test Certificate. The FamilyTreeDNA test certificate for all 111 Loci.

13 _Y-DNA TEST RESULTS SNP Test Certificate. The FamilyTreeDNA SNP test certificate.

14 _Y-DNA TEST RESULTS As at February 2017

15 _Y-DNA TEST RESULTS - MAPS Maps. The Y-DNA Migration Maps page shows two maps to help you visualize your direct paternal ancestors' historic and anthropological migrations. The current version of the main Haplogroup migrations map is shown below. On the next page are the maps specific to my Y-DNA tests The first is the Haplogroup Migrations Map. It shows general migration paths for the major haplogroups. The second is the Haplogroup Frequency map. It shows the frequency of the major haplogroups for different world regions.

16 _Y-DNA TEST RESULTS - MAPS

17 _Y-DNA TEST RESULTS - MAPS Haplogroups G and G-FGC14522 Distribution in Europe.

18 Yseq SNP Test Results - March 2016 In the past decade Y chromosome analysis has made huge progress and allows experienced genealogists to decipher their ancestry far beyond the paper trails. The YSEQ DNA Origins Project is your partner for your DNA related research. Discover what great and interesting information is hidden in your Y-chromosome. YSEQ provides SNP (single nucleotide poly-morphism) analysis on the human Y-chromosome. You may put a marker on the SNP wish list if you can t find it in our Shop. We constantly expand the paternal haplogroup tree with updated information about exact SNP positions. Our service includes STR (short tandem repeat) analysis as well. You have the choice between single markers and entire panels. The main goal of the YSEQ DNA Origins Project is detailed knowledge about male ancestry. The YSEQ project serves as a platform for citizen scientists. Newly discovered SNPs will be added to YBrowse on ISOGG s website and the results will be shared with the community of DNA genealogists. + No Subscription Fees + No DNA-extraction Costs + Single Markers & Panels + Custom designed Primers + SNP wish list + SNP discovery + Verification of new SNPs + Registration of new SNPs + Support of Citizen Science + Get raw sequencing data + Get other SNPs on same segment for FREE Y-DNA TEST RESULTS (YSEQ) The results from my SNP tests at Yseq are shown on the next page For an explanation of the results see the copy of the from Rolf Langland (Project Administrator of the G-L497 project) later.

19 Y-DNA TEST RESULTS (YSEQ) SampleID Marker+ Chr Start End Allele 444 A7256 ChrY C- 444 DYF399X ChrY DYS464X ChrY t-20.1t- 23c 12g-13g-13g- 14g 444 F149 ChrY T- 444 FGC12057 ChrY G- 444 FGC13748 ChrY A- 444 FGC14522 ChrY T+ 444 FGC25549 ChrY G- 444 FGC37088 ChrY G- 444 FGC4433 ChrY G- 444 FGC4856 ChrY C- 444 K228 ChrY G- 444 M1567 ChrY T- 444 M6653 ChrY G- 444 M8468 ChrY T- 444 PF3426 ChrY A- 444 PF5666 ChrY C- 444 S23438 ChrY A- 444 S24385 ChrY C- 444 S2808 ChrY A+ 444 Y13104 ChrY A- 444 Y3001 ChrY G- 444 YFS ChrY C- 444 YP2576 ChrY G- 444 Z1685 ChrY G- 444 Z17780 ChrY A- 444 Z17783 ChrY T- 444 Z30729 ChrY A-

20 Y-DNA TEST RESULTS (YSEQ) The technical details from Yseq concerning the S2808 and S23438 SNP s. These SNP s were identified by Jim Wilson in 2014 as a result of Y-DNA testing at Britains DNA. The FGC14522 SNP was characterised by the Full Genomes Corporation. S2808 [S2808] HG19 Position: ChrY: Ancestral: G Derived: A Reference: Jim Wilson (2014) ISOGG Haplogroup: G2a2b2a1b1a2a1 Comments: below CTS4803 Forward Primer: S2808_F GCAAGGAGCAGCACTACCTC Reverse Primer: S2808_R AGCACATCCCAGTGCTCTTC S23438 [S23438] HG19 Position: ChrY: Ancestral: A Derived: G Reference: Jim Wilson (2014) ISOGG Haplogroup: G2a2b2a1b1a2a1a Comments: below CTS4803 Forward Primer: S23438v2_F GGAGTTCTGATAAGAGAGGGACAC Reverse Primer: S23438v2_R CTGACCATAATATTTTAGGCCAGG FGC14522 [FGC14522] HG19 Position: ChrY: Ancestral: C Derived: T Reference: Full Genomes Corp. (2014) ISOGG Haplogroup: G (not listed) Comments: Below Z726 > S2808 Forward Primer: FGC14522_F AAGGAACAATAGGAGTGCAAGTC Reverse Primer: FGC14522_R ACAAAGGCCAGACACACCTC

21 Y-DNA TEST RESULTS (YSEQ) Rolf Langland writes - Thank you for sending these new SNP results. It shows that you are positive for the S2808 SNP, and negative for its subgroup S The other SNPs shown on your results are not currently used for classification in the YDNA-G phylogenetic tree, except for PF3426, which is an SNP in the L694 branch and it is expected that you would be negative for that, since our project (GL497) descends from L140 and not from L694. For reference, the two attached diagrams show the current structure of the G-tree. I have updated your categorization in the Project Roster, so you are now in S2808+ and negative for sub-group S This is a fairly new category for which we do not currently have a large sample size. At present, it is comprised of persons from nations around the Baltic Sea and North Sea, including England, Belgium, Sweden and Poland, see below. The age of S2808 may be about 3,500 to 4,000 years. Also, at present, we have not identified any SNPs (other than S23438) below S2808 for possible testing. We hope additional SNP testing options for S2808 persons may be identified later this year. Note: Subsequently the Big Y test found FGC14522 below S2808, indeed further subgroups of S2808 have been determined. Haplogroups G-FGC14522 Distribution in Europe (February 2017).

22 G-L497 PHYLOGENETIC TREE

23 G-L497 PHYLOGENETIC TREE

24 G-L497 PHYLOGENETIC TREE

25 DNA TESTING - BIG Y The BIG Y product is a direct paternal lineage test. FTDNA have designed it to explore deep ancestral links on our common paternal tree. It tests both thousands of known branch markers and millions of places where there may be new branch markers. We intend it for expert users with an interest in advancing science. It may also be of great interest to genealogy researchers of a specific lineage. It is not however a test for matching you to one or more men with the same surname in the way of our Y-DNA37 and other tests. The BIG Y product uses next-generation sequencing to reveal genetic variations across the Y-Chromosome. Both BIG Y and Geno 2.0 test for thousands of paternal lineage branch markers (SNPs). Unlike Geno 2.0 and related technologies though, BIG Y is able to detect new branch markers that are unique to your paternal lineage, surname, or even you. Geno 2.0 is microarray chip based and programmed for specific SNPs. BIG Y is a next-generation sequence-based test. Targeted Non-recombining Y-DNA sequencing Illumina HiSeq X to 80X average coverage Around 11.5 to 12.5 million base-pairs of reliably mapped positions of non-recombining Y- Chromosome Analyzed using Arpeggi genome analysis technology for improved variant calls. All samples are processed in-house using our custom laboratory methods and informatics.

26 In October 2014 I submitted a sample for testing by Yorkshire DNA. The test is Chromo2 YDNA Your fatherline story from over 15,000 Y chromosome markers, more than any other product on the market. The results were received in December Fatherline - was defined as Ancient Caucasian, G-S314, using the terminology used by Yorkshires DNA Subtype Your subtype is G-S2808 DNA TESTING - YORKSHIRES DNA Your S2808 marker defines a subtype of the major CTS4803 cluster. So far it has only been seen in British men, but it is too early to tell whether it is truly confined to the British Isles. You may carry markers that further define your subtype, but do not yet appear on our tree. You will find these in your genetic signature. Note: In fact there are other European individuals with the same Subtype as tested by FtDNA and yseq. Your DNA marker is ANCIENT CAUCASIAN. In Europe it is widespread but rare with a distribution that thins out from the south-east to the north-west and in Britain it is very rare, carried by only 0.5% of men. By contrast, it is by far the most common type in the Caucasus, the mountainous region between the Black Sea and the Caspian Sea. Your Y chromosome group, what tracks your paternal lineage, is part of the G group of lineages and it is designated G-S314. It indicates descent in the male line from the prehistoric inhabitants of what is now Georgia and parts of the Russian Federation. In the region of North Ossetia-Alania (named after the barbarian tribe, the Alans, who attacked the Roman Empire in the 4th and 5th centuries) 57% of all men carry your marker, while 30% of all Georgian men have it. The G group developed in the Caucasus and spread from there to what is now modern Turkey and the plateaus of central Iran more than 15,000 years ago. Very rare in Britain, it was brought across Europe by the spread of farming techniques, the most profound revolution in human history. Sub-groups of your lineage have been identified in DNA extracted from prehistoric skeletons in Germany and France. Both examples date to c3,000bc and their location tracks the movement of farming and dates its arrival in Western Europe. Your earliest ancestors probably reached Britain at around the same time. It also sailed across the North Sea with the peoples known collectively as the Anglo-Saxons. They raided and then began to settle in the 5th and 6th centuries. Later, in the 9th and 10th centuries, more Germanic peoples, this time collectively known as the Danes, also came and settled, particularly in what came to be called the Danelaw, the north and east of England. They too brought G-S314 with them.

27 British Isles Genetic makeup. DNA TESTING - YORKSHIRES DNA Recent results from the testing carried out by Britains DNA is now beginning to show the Y-DNA Haplogroup makeup of the British Isles. It shows that my Haplogroup accounts for around 1.6% of the population. This is very much in line with other sources such as FamilyTreeDNA.

28 DNA TESTING - LIVING DNA In February 2017 I submitted a sample for testing by LivingDNA. The results were available by the end of April A Living DNA test brings your history to life and provides over twice the detail of other ancestry tests. Discover where your ancestors come from and much more. Your family ancestry broken down across 80 worldwide regions including 21 in Britain and Ireland. Twice the detail of other tests. 3 tests in 1 - we also show your motherline ancestry and, if you are a male, your fatherline ancestry too. As our research is refined, your results are updated into more detail at no charge We put your results into context, allowing you to explore your ancestry at different points in history The DNA testing laboratory and our entire team have developed state of the art facilities to ensure the most reliable test results possible. And as the first company worldwide to have access to the latest Illumina chip platform, your results are cutting edge. Family Ancestry We give you your estimated family ancestry breakdown today, and we also put your results in context, looking at your ancestry through history. If you have British or Irish ancestry then it s the only test that shows where within Britain and Ireland your ancestry comes from. Motherline Ancestry Find out where your motherline descends from with a detailed breakdown of all the ancestral groups that have been part of this line. Through your mtdna, we look at the history of your motherline from the point in Africa when we all shared the same DNA until recent times. We also highlight any famous people who share the same motherline group as you. Fatherline Ancestry Through your Y-DNA, men can see the paths of their male ancestors and explore the history of their fatherline from the point in Africa when we all shared the same DNA until recent times. We also highlight any famous people who share the same fatherline group as you. You will only receive this if you are a male because females don t carry the Y chromosome however, females will still get parts of their father's ancestry through their autosomal DNA.

29 DNA TESTING - LIVING DNA Example result from Living DNA (Sub regional - based on the People of the British Isles project. The results from the LivingDNA test were posted at the end of April The test results were split into three parts, Fatherline (ydna), Motherline (mtdna) and Family Ancestry (Autosomal DNA). The Family Ancestry results are shown in a later section, Fatherline (ydna) The results were as follows. These are in line with the results from other sources. The subclade shown is higher in the G tree than the result from FamilyTreeDNA which is G-FGC14522, though it is in the same branch, see the chart on page 206. Haplogroup: G2a Subclade: G-CTS4803

30 DNA TESTING - LIVING DNA The description of my Fatherline given by LivingDNA is shown below as is the coverage map.

31 DNA TESTING - LIVING DNA Motherline (mtdna) The description of my Fatherline given by LivingDNA is shown below as is the coverage map.

32 DNA TESTING - DATA ANALYSIS BY YFULL Technical progress never has a standstill, and technologies in the field of DNA sequence analysis of next generation have began to develop so promptly recently, that volumes of received initial information exceeds tens gigabytes, and complexity of its processing demands professional interpretation tools. The main aim of the project is providing high-quality service for the raw data (.BAM and.fastq) analysis of Full Y-chromosome and its available and convenient visualization. Your data are always handy in any point of the world. Our service isn't limited only by the analysis of individual raw data, but also has a social focus. The groups, created within service (haplogroup and thematic projects) have to combine efforts in studying and understanding of history and migrations ways of our ancestors. Serious attention is paid to the privacy of raw data; it is possible to adjust display of certain information easy. Scientific work on positioning of the found single nucleotide polimorphism (SNP) on a experimental Y-tree is carried out on the basis of the gathered and analysed data. We approach to interpretation of data seriously. More than 150 new variable STR-markers found, selected, studied and systematized by us can serve as a proof. More than 470 markers totally give the chance of the detailed analysis and positioning of Y-chromosomes relatively each other in a cluster, being notable addition to the SNP found. G-FGC14522 (age: 2174 ybp) Formula: ( )/2 Branch ID Numb er of SNPs Coverage (bp) Formula to correct SNPs number Corrected number of SNPs Formula to estimate age YF / * * YF / * * Age by this line only

33 DNA TESTING - DATA ANALYSIS BY YFULL

34 mtdna TEST RESULTS Testing your mtdna uncovers the deep ancestral origin of your direct maternal line (your mother, your mother s mother, etc.) and connects you with genetic cousins. Because your mtdna has been passed on to you generation after generation by your direct maternal ancestors, it offers the most exact information possible for this line. The results show that my maternal line is Haplogroup H1. A more detailed grouping has been given by the mtdna H project group, it is now designated H1* - A10049G predictive new sub branch. At the time of writing my mtdna is the only one other person with this grouping.

35 mtdna TEST RESULTS MtDNA Test Certificate. The FamilyTreeDNA test certificate for mitochondria DNA.

36 MtDNA Haplogroup Maps mtdna TEST RESULTS - MAPS Migration map and frequency map showing H1*-10049G (Predictive new sub branch, as at 28/02/2017

37 AUTOSOMAL DNA TEST RESULTS Family Finder Results. The Family Finder program uses only the autosomal SNP (single nucleotide polymorphism) test results from the Family Finder microarray chip. The results of the autosomal test can be used in the following way. Your Matches View your Family Finder match list, and connect with genetic cousins. Chromosome Browser Compare your matching DNA segments (blocks) with your matches, see example on next page. myorigins View results of the myorigins program your personal genetic history.

38 Chromosome Browser AUTOSOMAL DNA TEST RESULTS

39 myorigins attempts to reduce the wild complexity of your genealogy to the major historical-genetic themes which arc through the life of our species since its emergence 100,000 years ago on the plains of Africa. Each of our 22 clusters describe a vivid and critical colour on the palette from which history has drawn the brushstrokes which form the complexity that is your own genome. Though we are all different and distinct, we are also drawn from the same fundamental elements. The explanatory narratives in myorigins attempt to shed some detailed light upon each of the threads which we have highlighted in your genetic code. Though the discrete elements are common to all humans, the weight you give to each element is unique to you. Each individual therefore receives a narrative fabric tailored to their own personal history, a story stitched together from bits of DNA. We ve listed the population clusters and accompanying narratives below. Primary Population Clusters AUTOSOMAL DNA TEST RESULTS - ORIGINS Asia Minor Native American South East Asia Central Asia European Coastal Plain South Asia South-Central Africa North Africa Southern Europe Northeast Asia East Central Africa Eastern Middle East British Isles Scandinavia Ashkenazi Diaspora West Africa Finland & Northern Siberia Eastern Europe Blended Population Clusters British Isles, Western & Central Europe Scandinavia, western & Central Europe Southern, Western & Central Europe Eastern, Western & Central Europe

40 AUTOSOMAL DNA TEST RESULTS - ORIGINS MyOrigins (MyOrgins - Release 1, 2014)

41 AUTOSOMAL DNA TEST RESULTS - ORIGINS British Isles European Coastal Islands is typical to the British Isles, especially Ireland. Its reach includes all European Islands from the far north and down south to the Azores Islands off the coast of Spain. The continuous mixing of European populations means that this group is also present in lesser amounts on the mainland. Genetically close to European Coastal Plain and European Northlands, European Coastal Islands has had an impact on the demography of the world because of the explosion of population in the Anglosphere over the past few centuries. The farmers came to Britain late, but when they came they brought great change. The hunters were assimilated by the farmers. This admixture caused the European Coastal Islands as we know it to become a hybrid of farmer and hunter. Perhaps due to its isolation and strategic placement, the major powers in the world and throughout history have wanted to rule the islands. From Caesar to the Irish king Niall of the Nine Hostages, we see the wide variety of genetic influence from the Celts, Picts, Vikings, Normans and French. Western & Central Europe The European Coastal Plain combines nearly all of the threads of European genetic history into one. This cluster goes from the Bay of Biscay near Spain, toward the Pripet Marshes of western Russia, to the coastal plain of Northern Europe. The hunter-gatherer, farmer, and intruder from the steppes were forged together as one people. The French and the German were created by the intersection European Coastal Plain represents the diverse groups brought together over the past 5,000 years, as Germans, Celts, and Slavs have moved in with their cattle, and the Romans brought their mills and cities. This cluster is common among many populations with Northern European heritage. Germanic migrations after the fall of Rome guaranteed its presence in the south. The people on the European Coastal Plain are at the heart of recent history. Being the engines behind the Great Powers of the age, they became the dominant actors in colonization of the world. Scandinavia The European Northlands centres on the people of Scandinavia. They thought of their homeland as an island because it is relatively isolated from the rest of the world by the Baltic and other seas. This isolation and later association with the Finnic peoples, however, have changed them in ways that are genetically clear. A sister cluster to European Coastal Plain and European Coastal Islands, the European Northland has developed in moderate seclusion, influenced by the arctic heritage it shares with those from the North Circumpolar cluster. Its history is rooted in the original hunters of Europe and the late arrival of farmers only about 5,000 years ago. Members of this cluster are kin to other Europeans of the north. The migrations of the Norse spread the European Northlands west and east. As the Vikings expanded from the south of Scandinavia, European Northlands absorbed Lapps and other people who were exemplars of North Circumpolar. An expansion over the past 2,000 years has brought this heritage from the nearer shores of continental and Atlantic Europe, all the way to the plains of the Dakotas in the United States.

42 AUTOSOMAL DNA TEST RESULTS - ORIGINS MyOrigins (MyOrgins - Release 2, 2017)

43 AUTOSOMAL DNA TEST RESULTS - ORIGINS British Isles Modern humans arrived on the British Isles roughly 40,000 years ago via a land bridge that connected these islands to continental Europe. Early hunter-gatherer populations were able to navigate into and out of this region until roughly BCE, when melting ice sheets caused sea levels to rise, and the connection between the populations on the British Isles and continental Europe was severed. Farming occurred largely as an indigenous adaptation, with limited evidence for the introduction from surrounding colonizing regions by 4000 BCE. Small agricultural communities persisted throughout the ancient time period and is even recorded as the primary lifestyle by Roman invaders in the early 1st century. By the second millennium BCE trade intensified, and, under control of the Chieftains of Wessex trade, spanned from Ireland into central and eastern continental Europe. The wealth amassed from this intensified trade likely enabled the Wessex Chieftains to begin construction on what would grow to become Stonehenge. These trade practices further solidified a deep genetic connection with populations in the West and Central Europe cluster and areas of Scandinavia. By 43 CE Roman forces had conquered Britain; but by 500 CE, Celtic tribes (originated in Gaul and Scandinavia) and Asian forces toppled to Roman empire, and the subsequent Celtic Expansions brought Celtic Saxon tribes into the British Isles. Powers in the British Isles also conscripted mercenary populations from continental Europe. The Saxons, Angles, and Jutes came over to support Briton forces defending against the Picts and Scots in the 6th century. Between the 8th and 11th centuries, the British Isles were invaded and settled by Viking parties during the Viking expansion. Normandy later invaded and solidified cultural and economic connections between the British Isles and continental Europe. To this day, these ancient occupations and trading practices left a lasting impression on the genetic relatedness between populations in the British Isles cluster and Southeast Europe, Scandinavia, and West and Central Europe clusters. Western & Central Europe The West and Central Europe cluster consists of present day countries of France, Belgium, Netherlands, Luxembourg, Switzerland, Austria, Czech Republic, and Germany. Modern humans began to populate West and Central Europe toward the end of the last ice age, when the ice sheets north of the Mediterranean coast began to retreat. This cluster displays an incredible history of migration, invasion, and colonization resulting in shared genetic relatedness with nearly all of the other European clusters. Experiencing ancient interactions and exchanges with cultures from the British Isles, Scandinavia, Asia, and Africa. Thus, populations in this cluster continue to display genetic, cultural, and linguistic influence from these ancient interactions. Long distance travel between continental Europe and populations in the British Isles are illustrated by the shared knowledge of specific pottery and metalworking technologies. More convincingly, archaeological remains of an individual (the Amesbury Archer from roughly 2000 BCE) buried near Stonehenge in England is known (through oxygen isotope analysis of his teeth) to have grown up in mainland Europe, thus illustrating the close connections between these two clusters. The development of complex city-states was first established along the southern coastlines of France. Colonies of Greek, Phoenician, and Carthaginian settlers were the first to establish these complex so-

44 cieties; Roman colonies were quick to follow transferring cultural practices such as the importance of wine drinking for the elites in central and eastern France. To the North, Celtic bands maintained semi-nomadic settlements throughout most of the cluster. By roughly 300 CE, a Celtic group, having originated in Scandinavia, was pushed westward by invading forces from Attila the Hun, further intensifying tension between the Romans and Celts. With the Germanic tribes pushed out of eastern Europe, Slavic speaking peoples moved into these regions and settled in areas leading up to east Germany. Continual raids from Germanic tribes and Mongolian forces from Asia ended Roman occupation in this area by roughly 500 CE. During this time period, the Celts continued migration to further reaches of land. The Celts moved into and settled in regions southward. These regions included Northern Italy, most of Britain, modern day France, and Spain; they also conquered most of Northern Africa, Sardinia, and Rome in the process. It is after the Celtic spread that populations within this cluster began to establish complex and diverse civilizations that are later recognized as some of the most powerful and influential cultures in the world. These ancient histories continue to influence identities and histories of present day populations in this cluster. Scandinavia AUTOSOMAL DNA TEST RESULTS - ORIGINS The Scandinavian cluster consists of present day Norway, Sweden, and Denmark. Due to the remaining ice sheets from the last Ice Age, modern humans did not settle permanently into this region until roughly 9000 BCE. During this time, Denmark and Sweden were connected via a land bridge that enabled migration from continental Europe to the Scandinavian Peninsula roughly 13,000 years ago. These early hunter-gatherer populations settled along the waterways lakes, marshes, and rivers. By 6000 BCE, the Ertebolle peoples had established complex hunter-gatherer settlements and seasonal camps along the coastlines. The cultural and technological achievements of these peoples are paralleled in regions of the North European plains stretching eastward to regions in Ukraine and Siberia. By 2500 BCE, local populations in the Scandinavia cluster had begun farming, and soon established strong trade links with continental Europe. These were particularly robust with populations along the Danube River basin stretching from present day Moldova, west to Germany, and south to the Roman empire. Chieftain tribes ruled ancient Scandinavia, and the Viking Age was born around 800 CE in the bay between the Gotta River in Sweden and Cape Lindesnes of Norway. Between 800 and 900 CE, Viking populations had taken control of trade from the Dnieper River to the Baltic Sea and Constantinople, connecting them to populations as far away as the Middle East, Western Russia, and Siberia to the east. During the Viking Age ( CE), Vikings spread throughout the Old World in raiding and settlement parties. Vikings traveling west spread as far as North America and conquered areas between such as Ireland, Scotland, England, France, Iceland, and Greenland. Viking populations moving into the east maintained control in the Slavic states along the Baltic Sea, Russia, and Steppe regions until they were forced out by invading Mongol armies. By the 11th century, the Viking Age had ended and the powers of Sweden, Denmark, and Norway battled for control of the Scandinavian cluster. In 1397 the Kalman Union unified the three powers up to the early 16th century.

45 AUTOSOMAL DNA TEST RESULTS - ANCIENT ORIGINS Ancient European Origins The European Continent has been witness to many episodes of human migration, some of which have spanned over thousands of years. The most up-to-date research into these ancient migrations on the European Continent suggests that there were three major groups of people that have had a lasting effect on present day peoples of European descent: Hunter-Gatherers, Early Farmers, and Metal Age Invaders. The graphics below display the percentages of autosomal DNA that you still carry from these ancient European groups.

46 Hunter-Gatherer 46% The climate during the Pleistocene Epoch (2.6 mill 11,700 YA) fluctuated between episodes of glaciation (or ice ages) and episodes of warming, during which glaciers would retreat. It is within this epoch that modern humans migrated into the European continent at around 45,000 years ago. These Anatomically Modern Humans (AMH) were organized into bands whose subsistence strategy relied on gathering local resources as well as hunting large herd animals as they travelled along their migration routes. Thus these ancient peoples are referred to as Hunter-Gatherers. The timing of the AMH migration into Europe happens to correspond with a warming trend on the European continent, a time when glaciers retreated and large herd animals expanded into newly available grasslands. Evidence of hunter-gatherer habitation has been found throughout the European continent from Spain at the La Brana cave to Loschbour, Luxembourg and Motala, Sweden. The individuals found at the Loschbour and Motala sites have mitochondrial U5 or U2 haplogroups, which is typical of Hunter- Gatherers in Europe and Y-chromosome haplogroup I. These findings suggest that these maternally and paternally inherited haplogroups, respectively, were present in the population before farming populations gained dominance in the area. Based on the DNA evidence gathered from these three sites, scientists are able to identify surviving genetic similarities between current day Northern European populations and the first AMH Hunter- Gatherers in Europe. The signal of genetic sharing between present-day populations and early Hunter-Gatherers, however, begins to become fainter as one moves further south in Europe. The huntergatherer subsistence strategy dominated the landscape of the European continent for thousands of years until populations that relied on farming and animal husbandry migrated into the area during the middle to late Neolithic Era around 8,000 7,000 years ago. Farmer 44% AUTOSOMAL DNA TEST RESULTS - ANCIENT ORIGINS Roughly 8,000 7,000 years ago, after the last glaciation period (Ice Age), modern human farming populations began migrating into the European continent from the Near East. This migration marked the beginning of the Neolithic Era in Europe. The Neolithic Era, or New Stone Age, is aptly named as it followed the Paleolithic Era, or Old Stone Age. Tool makers during the Neolithic Era had improved on the rudimentary standard of tools found during the Paleolithic Era and were now creating specialized stone tools that even show evidence of having been polished and reworked. The Neolithic Era is unique in that it is the first era in which modern humans practiced a more sedentary lifestyle as their subsistence strategies relied more on stationary farming and pastoralism, further allowing for the emergence of artisan practices such as pottery making. Farming communities are believed to have migrated into the European continent via routes along Anatolia, thereby following the temperate weather patterns of the Mediterranean. These farming groups are known to have populated areas that span from modern day Hungary, Germany, and west into Spain. Remains of the unique pottery styles and burial practices from these farming communities are found within these regions and can be attributed, in part, to artisans from the Funnel Beaker and Linear Pottery cultures. Ötzi (the Tyrolean Iceman), the well-preserved natural mummy that was found in the Alps on the Italian/Austrian border and who lived around 3,300 BCE, is even thought to have belonged to a farming culture similar to these. However, there was not enough evidence found with him to accurately suggest to which culture he may have belonged. Although farming populations were dispersed across the European continent, they all show clear evidence of close genetic relatedness. Evidence suggests that these farming peoples did not yet carry a tolerance for lactose in high frequencies (as the Yamnaya peoples of the later Bronze Age did); however, they did carry a salivary amylase gene, which may have allowed them to break down starches more efficiently than their hunter-gatherer forebears. Further DNA analysis has found that the Y-chromosome haplogroup G2a and mitochondrial haplogroup N1a were frequently found within the European continent during the early Neolithic Era.

47 AUTOSOMAL DNA TEST RESULTS - ANCIENT ORIGINS Metal Age Invader 10% Following the Neolithic Era (New Stone Age), the Bronze Age (3,000 1,000 BCE) is defined by a further iteration in tool making technology. Improving on the stone tools from the Paleolithic and Neolithic Eras, tool makers of the early Bronze Age relied heavily on the use of copper tools, incorporating other metals such as bronze and tin later in the era. The third major wave of migration into the European continent is comprised of peoples from this Bronze Age; specifically, Nomadic herding cultures from the Eurasian steppes found north of the Black Sea. These migrants were closely related to the people of the Black Sea region known as the Yamnaya. This migration of Asian Steppe nomads into the temperate regions further west changed culture and life on the European continent in a multitude of ways. Not only did the people of the Yamnaya culture bring their domesticated horses, wheeled vehicles, and metal tools; they are also credited for delivering changes to the social and genetic makeup of the region. By 2,800 BCE, evidence of new Bronze Age cultures, such as the Bell Beaker and Corded Ware, were emerging throughout much of Western and Central Europe. In the East around the Urals, a group referred to as the Sintashta emerged, expanding east of the Caspian Sea bringing with them chariots and trained horses around 4,000 years ago. These new cultures formed through admixture between the local European farming cultures and the newly arrived Yamnaya peoples. Research into the influence the Yamnaya culture had on the European continent has also challenged previously held linguistic theories of the origins of Indo-European language. Previous paradigms argued that the Indo-European languages originated from populations from Anatolia; however, present research into the Yamnaya cultures has caused a paradigm shift and linguists now claim the Indo-European languages are rooted with the Yamnaya peoples. By the Bronze Age, the Y-chromosome haplogroup R1b was quickly gaining dominance in Western Europe (as we see today) with high frequencies of individuals belonging to the M269 subclade. Ancient DNA evidence supports the hypothesis that the R1b was introduced into mainland Europe by the Asian Steppe invaders coming from the Black Sea region. Further DNA evidence suggests that a lactose tolerance originated from the Yamnaya or another closely tied steppe group. Current day populations in Northern Europe typically show a higher frequency of relatedness to Yamnaya populations, as well as earlier populations of Western European Hunter-Gatherer societies.

48 AUTOSOMAL DNA TEST RESULTS - ORIGINS DNA.LAND DNA Land is non-profit and run by academics affiliated with Columbia University and the NY Genome Centre. By sharing your data you are enabling scientists to make new discoveries We also want to enable you to learn more about your DNA. We will compare your DNA with reference data from different populations to see where in the world your ancestors might have lived.

49 AUTOSOMAL DNA TEST RESULTS - ORIGINS

50 FAMILY ANCESTRY AUTOSOMAL LIVINGDNA TEST RESULTS - FAMILY ANCESTRY The Family Ancestry maps shows areas of the world where I share my genetic ancestry in recent times (10 generations). The original results from LivingDNA showed a 54.4% from North Yorkshire with 11% from Northumbria and Lincolnshire. I June 2017 the results were refined when the North Yorkshire content went up to 84%, more in line with my known family tree. The maps and results of the updated calculations are shown on the following pages.

51 AUTOSOMAL LIVINGDNA TEST RESULTS - FAMILY ANCESTRY

52 AUTOSOMAL LIVINGDNA TEST RESULTS - FAMILY ANCESTRY

53 AUTOSOMAL LIVINGDNA TEST RESULTS - FAMILY ANCESTRY

54 DNA TEST RESULTS - GED MATCH ANALYSIS Base Pairs with Full Match = Base Pairs with Half Match = Match with Phased data = Base Pairs with No Match = Base Pairs not included in comparison = Matching segments greater than 7 centimorgans = Evaluating Kit T (John Goldsbrough) for related parents. Minimum threshold size to be included in total = 700 SNPs Minimum segment cm to be included in total = 7.0 cm Largest segment = 0.0 cm Total of segments > 7 cm = 0.0 cm No shared DNA segments found No indication that your parents are related.

55 DNA TEST RESULTS - GED MATCH ANALYSIS

56 DNA TEST RESULTS - GED MATCH ANALYSIS Base Pairs with Full Match = Base Pairs with Half Match = Match with Phased data = Base Pairs with No Match = Base Pairs not included in comparison = Matching segments greater than 7 centimorgans = Comparing Kit T (John Goldsbrough) and A (Brian Hird) Minimum threshold size to be included in total = 500 SNPs Mismatch-bunching Limit = 250 SNPs Minimum segment cm to be included in total = 7.0 cm

57 DNA TEST RESULTS - GED MATCH ANALYSIS

58 ANCESTORS BIRTH LOCATIONS PATERNAL ANCESTORS MATERNAL ANCESTORS Skelton Liverton Bilsdale Bilsdale Egton Egton Danby Bilsdale Danby is Greatham Skelton Lythe Bilsdale Kirby Kirbymoor- Lasting- Sinning- Danby Bilsdale Middleton Ruswarp Ann Foster Pickering Kilburn Pickering Kirby Mills Egton Husthwaite Kilburn Pickering Bilsdale Pickering Crathorne Sculcoates Helmsley Felixkirk Pickering Pickering Great Smea- Osmother- Pickering Pickering Helmsley Great Osmotherley Great Smea- Hornby Pickering Husthwaite Helmsley Pickering Osmotherley Pickering Y-DNA LINE mtdna LINE Kepwick PATERNAL ANCESTORS - Born in North Yorkshire (North Riding) Father - 1 Grandparents - 2 Great Grandparents - 4 2x Great Grandparents - 7 MATERNAL ANCESTORS - Born in North Yorkshire (North Riding) Mother - 1 Grandparents - 2 Great Grandparents - 3 2x Great Grandparents - 6 The total number of ancestors to 3x Great grandparent level is 62, a total of 53 have been identified, with 50 of those born in

59 ANCESTORS BIRTH LOCATIONS The map on this page shows the birth locations for my ancestors to 3GG level. On the next page is a family tree using the colour scheme used by LivingDNA to identify sub-regions in Great Britain and Ireland. Ancestor locations in North Yorkshire Paternal Paternal Maternal Maternal [3] [11] [6] [3] [2] [2] [2] [2] [N] number of ancestors born in the location. Note: Outside map Sculcoates towards Hull is located in East Yorkshire, near Greatham is located in South Durham near