Understanding your Results

Size: px
Start display at page:

Download "Understanding your Results"

Transcription

1 Paternal Ancestry Report: Sample Understanding your Results What Does this Genetic Test Accomplish? This genetic ancestry test works by analyzing specific regions of your Y chromosome. These regions, termed Short Tandem Repeats (STRs), are segments of your DNA that contain repeated sequences in your DNA code. The vast majority of STRs do not contain any critical information, so they are highly variable among the human population. For example, at the STR DYS19 you may have three repeats of TAGA on your DNA, while your neighbor, John, has four repeats of TAGA. Please see Figure 1 below. Figure 1. Simple example illustrating different versions of the Short Tandem Repeat (STR), DYS19. These variations are useful for a number of different purposes. Interestingly, STR analysis is the same technology that is used to genetically identify humans. This is because the odds of two people having the exact same set of STRs are astronomical. However, groups of people still share patterns in their STRs. This genetic test takes advantage of this shared information to determine your long-term ancestral heritage. Why the Y Chromosome? First of all, what is the Y chromosome? It is one of two sex chromosomes (the other being X) that determines the gender of an individual. Unlike the other 23 chromosomes that make up your genome, the Y chromosome is only passed from father to son. It is this unique pattern of inheritance that makes the Y chromosome especially useful for paternal ancestry determinations. Essentially, the genetic material contained in the Y chromosome ( Y-DNA ) is passed down the male side of the family in an unbroken chain, eventually leading back to the very beginnings of mankind. 1

2 Figure 2. Genomic map of the Y chromosome. The labeled regions indicate the STRs that are analyzed in this genetic test. A total of 23 different regions are analyzed to determine your paternal ancestry. What is a Y-DNA Haplogroup? Y-DNA haplogroups are groupings created to represent the development and migration of early human populations. In general, Y-DNA haplogroups are assigned an alpha character based on the age of the population they represent. For example, haplogroup D first appeared roughly 50,000 years ago, while haplogroup H first appeared around 30,000 years ago. Please see figure 2 below for a family tree of all Y-DNA haplogroups. Figure 3. Lineage of all Y-DNA haplogroups. 2 At the very top of the tree there is one man known as the Y-Chromosomal Most Recent Common Ancestor, informally known as Y-Chromosomal Adam. This individual passed on his copy of the Y chromosome to every male human and is quite literally father to all mankind. Estimates regarding when Y-Chromosomal Adam lived vary, but is generally thought to be roughly 200,000 to 300,000 years ago.

3 Your Results! Dynamic DNA Laboratories certifies that the foillowing results are authentic and 100% accurate. STR Genotype 1 Genotype 2 Haplogroup Probability (%) DYS E1b1a 0.0 DYS389-I 13 E1b1b 0.0 DYS G2a 0.0 DYS389-II 28 G2c - DYS19 14 H - DYS I1 0.0 DYS I2a (xi2a1) 0.0 DYS I2a1 0.0 DYS I2b (xi2b1) - DYS I2b1 0.0 DYS J1 0.0 DYS J2a1b - DYS J2a1h - DYS J2a1 x J2a1-bh - DYS J2b 0.0 DYS L 0.0 DYS N - DYS Q 0.0 DYS R1a 0.0 DYS R1b DYS T - GATA-H4 11 S - Table 1. STR and haplogroup results from your ancestry test at Dynamic DNA Laboratories. Additional comparison of your STR genotypes has indicated that you belong to the subgroup L21/M529. RAW DATA Figure 4. Output from the DNA sequencer identifying the lengths of your STRs. The numbers below each peak refer to the number of repeats in each STR. This number is referred to as your STR Genotype. 3

4 Additional Information Regarding Your Y-DNA Haplogroup Due to patterns in your STR data, additional information is available regarding your Y- DNA haplogroup. Due to your genotype at the loci (position) DYS390 and DYS576, your refined Y-haplogroup is defined as L21/M529. This additional genetic information allows for a wealth of additional information. Please see Figure 5 for a breakdown of R1b haplogroups. Figure 5. Phylogenetic tree of haplogroup R1b provided by Eupedia. This tree reveals the mutations in the R1b haplogroup over time and location. Your testing results indicate that you belong to the L21/M529 Proto- Italo-Celto- Germanic haplogroup. Getting Acquainted with The Stone Age Throughout this report, you will find references to various periods throughout the Stone Age. To better understand these time points and their perspective to human development, we encourage you to refer to the timeline below while reading these findings. 4 Figure 6. Timeline of major milestones in early European humans, ranging from 50,000 to 2,000 years ago (kya).

5 About Haplogroup R1b Origins and Migrations Paleolithic & Mesolithic Time Periods Haplogroup R is thought to have emerged from one man roughly 24,000 years ago in Western Asia (Eurasia), just before the last glacier maximum in Europe. In this time period, the hunter-gatherer societies of R1b roamed across Siberia and parts of Europe. These early people were likely associated with the Gravettian culture and lived during the upper Paleolithic era (Late Stone Age), just before the beginnings of agriculture. They were primarily a hunter-gather society and have contributed some of the most recognizable artifacts from this period in time, including the Venus figurine. Figures such as this were likely produced during the most extensive phase of the last ice age (last glacier maximum). Figure 7. The Venus of Lespugue figurine. Produced by the Gravettian culture roughly 25,000 years ago. Artifacts such as this represent some of the earliest examples of prehistoric art in Europe. Neolithic Eventually, R1b individuals migrated into mesopotamia and the fertile crescent. This migration was largely driven by the extinction of the woolly mammoths, which were the primary prey for R1b tribes. The transition to hunting other large game, such as bisons, was also supplemented by the domestication of early cattle. R1b individuals are thought to be some of the first humans to have domesticated cattle. Farming was also developing during this time, but largely by other Y-haplogroups (G and T). The nomadic requirements of R1b cattle herders spurred their eventual migration out of the fertile crescent. Three different migratory paths have been identified and your ancestors made the best choice by crossing the Caucasus and Pontic Steppe into present-day Europe. This lineage of individuals is often referred to as R1b-M529. During this period of time, archaeologists have identified several early European cultures that have been associated with R1b, including the Hassuna, Anatolian, and Amuq-Byblos (Figure 8). 5

6 Figure 8. Early European cultures from the neolithic time period. Your ancestors migrated out of the fertile crescent during this time period. The Early Bronze Age As R1b tribes progressed onto the Pontic Steppe they contributed to one of the first true bronze age cultures, the Maykop. This advanced culture was one of the first to have developed metalworking. In fact, the world s oldest sword was found in a Maykop grave (Figure 9). Maykop individuals are also credited for developing the first wheeled vehicles. These technical abilities would soon combine to create one of the first warlike people, which would have a huge impact on Bronze-Age Europe (Figure 10). Figure 9. Some of the oldest swords found in modern day Turkey over 5,000 years ago by the Maykop culture. 6

7 Figure 10. European cultures in existence during the late neolithic time period. Your ancestors likely belonged to the Maykop culture. The R1b Conquest of Europe It is important to note that Europe was already well-colonized by the time R1b tribes began to migrate into Western Europe, mostly by Y-haplogroups I1 and I2. However, the advanced technology of the incoming R1b tribes and cultural appreciation for warfare led to the conquering of much of Europe during the end of the Bronze Age into the Iron Age (ca years ago). During this time, the predominate European cultures were the Bell Beaker and Unetice cultures (although this remains a source of debate in the archaeological community). Regardless, R1b tribes so effectively spread across Europe, that it has only been recently agreed upon using genetic evidence that R1b actually migrated into and conquered Europe from Mesopotamia (Figure 11). You are here 7 Figure 11. Full migration map of R1b lineages through the Near East and Europe.

8 The End of the Bronze Age and Expansion into Western Europe As R1b tribes made their way into and settled Western Europe, the Iron Age was developing and the majority of your genetic ancestors (L21/M529) were associated with the Hallstatt culture. This was an advanced, Proto-Celtic culture, eventually giving rise to all Celtic culture. It is at this point that DNA evidence begins to lose resolution; however, this period of time also coincides with the end of ancient history and the beginning of the Middle Ages and better-written history. In the next section, we will discuss what may be learned about your ancestry using modern frequencies of individuals with your same Y- DNA haplogroup. Figure 11. European cultures in existence during the late Bronze Age. Your ancestors likely belonged to the Hallstatt culture. Your R1b Subgroup L21/M529 Geographic Distribution Overall, haplogroup R1b is one of the most widely distributed Y-DNA haplogroups across the world, with members showing up across a diverse population set. Figure 12 below highlights the populations that contain the most members of haplogroup R1b. From an ancestral point of view, the broad range of R1b is not especially useful. Luckily, additional determinations may be made using your more precise haplogroup, L21/M529. Please see Table 2 and Figure 12 below for additional information regarding your geographic ancestry. It is clear that the highest frequencies of R1b-L21 occur throughout the British Isles, although lower amounts are found throughout Western Europe. Your Regional Ancestry It is very likely that your paternal lineage can be traced back directly to the British Isles. Aside from the high concentration of R1b-L21 in this region, your Y-DNA profile also produced several close matches to individuals with known English and Scottish heritages. Given this, it can be said with 100% certainty that your paternal heritiage is exclusively Western European and in all liklihood is a mixture of English and Scottish lineages. However, in very rare circumstances a different country of origin is possible. 8

9 Figure 12. Worldwide frequency of haplogroup R1b, prior to the era of intercontinental travel (ca. 500 years ago). Population % of Population Haplogroup R1b Belarus 5.5 Belgium 61 Croatia 8.5 Denmark 33 England 67 Finland 3.5 France 58.5 Germany 44.5 Greece 15.5 Ireland 81 Italy 39 Lithuania 5 Netherands 49 Portugal 56 Russia 6 Spain 69 Sweden 21.5 Wales 74 Table 2. Frequency of haplogroup R1b throughout Europe. 9

10 Figure 13. Heatmap highlighting the distribution of the L21/M529 haplogroup prior to the era of intercontinental travel. It is very likely that your paternal lineage can be traced back directly to the British Isles. Genetic Matches and Possible Living Relatives In some circumstances, it is possible to identify other individuals that share some or all of your genetic markers. This is accomplished by comparing your results to an online database of individuals that have also had their Y ancestry tested using STRs. Given this, in order to find a distant relative, they must have also had their test performed and entered into this database. Even then, the odds of finding a long lost relative are somewhat low, but certainly not impossible! Often times, a partial match is found that you were likely related to in the very distant past. With the use of some mathematics, an estimate can be generated as to when you and your match last shared an ancestor. This calculation is referred to as the time to most recent common ancestor (TMRCA). Analysis of your genetic data revealed one individual that you share 14/14 markers with. TMRCA calculations using this data suggest that there is a 25% chance that you shared an ancestor with this individual 4 generations ago, a 50% chance that you shared an ancestor 10 generations ago, and a 95% chance that you shared an ancestor 42 generations ago. These calculations assume that one generation equals 31 years. 10

11 The online database provided some additional information regarding this possible genetic match: Last Name Westbrook Contact Person Michelle Westbrook Most distant known paternal ancestor James Westbrook, born 1634 Country of Origin England If you are interested in contacting this individual, then you can do so by logging into the account on that was created for you by Dynamic DNA Laboratories using the following credentials: User ID: Password: DDNA dynamic To find this individual select the Search by Last Name tab and search by last name for Westbrook. If you have any difficulties with this process please feel free to contact us for assistance! Also, please note that other very close matches were found to the surnames, Zellers, Brooks, and Stoner. Famous People from Y-DNA Haplogroup R1b Several noteworthy individuals have been identified as belonging to haplogroup R1b. These individuals include: Nicolaus Copernicus Prussian astronomer Charles Darwin Proposed the theory of evolution and natural selection George Washington 1 st president of the United States Abraham Lincoln 16 th president of the United States Ulysses S. Grant 18 th president of the United States/Civil War military commander James D. Watson Co-discoverer of the structure of DNA It is important to note that just because there is a shared Y-DNA haplogroup, there is still a low liklihood that you are closely related to any one of these individuals. World Migration So, now that you know your paternal haplogroup, let s put this information in perspective. To do this, we need to start at the beginning of the human story. It is estimated that between 200,000 and 300,000 years ago there was a man who is quite literally father to us all this is our Y Chromosomal Adam. It is important to note that this man was not the only living human male at the time, but he was the only one to produce a direct line of inheritance to any person alive today. This man lived in Africa, where humans first evolved and eventually migrated away from. The figure below outlines this migration out of Africa and throughout the world. Using this information, you can quite literally trace the steps that your paternal ancestors took throughout history! 11

12 Figure 14. Map of human Y-DNA migrations out of Africa, beginning over 150,000 years ago. Next Steps! In closing, we at Dynamic DNA encourage you to continue to explore your genetic heritage. The information presented in this report is only meant to act as an introduction. Now that you are armed with your Y-DNA haplogroup, you now have access to a wealth of new information via the internet. Here are some interesting links to wonderful websites that help you to explore your paternal ancestry. 1) an excellent source of information regarding Y-DNA haplogroups 2) all things genetic genealogy! Lastly, please remember that your Y-DNA testing results are only representative of your paternal line. If you are interested in pursuing your maternal ancestry, please consider having your mitochondrial DNA (mtdna) tested at Dynamic DNA Laboratories. Please go to or us at info@dynamicdnalabs.com for additional information E. Republic Road, Suite B204, Springfield, MO Please help us out by adding a comment on our Facebook page!

13 References Lazardis I, Patterson N, Mittnik A, et al. Ancient human genomes suggest three ancestral populations for present-day Europeans. Nature. 2014; (513); 7518; Passarino G, Cavalleri GL, Lin AA, Cavalli-Sforza LL, Børresen-Dale AL, Underhill PA (2002). "Different genetic components in the Norwegian population revealed by the analysis of mtdna and Y chromosome polymorphisms". European Journal of Human Genetics 10 (9): Skoglund P, Malmstrom H, Raghavan M, et al. Origins and genetic legacy of Neolithic farmers and hunter-gathers in Europe. Science. 2012; (336); 6080; Szecsenyi-Nagy A, Brandt G, Keerl V, et al. Tracing the genetic origin of Europe's first farmers reveals insights into their social organization. Proc Roy Soc Bio Sci. 2014; (282); Wells RS, Yuldasheva N, Ruzibakiev R, et al. (August 2001). "The Eurasian heartland: a continental perspective on Y-chromosome diversity" (Table 1: Y-chromosome haplotype frequencies in 49 Eurasian populations, listed according to geographic region). Proc. Natl. Acad. Sci. U.S.A. 98 (18):

Every human cell (except red blood cells and sperm and eggs) has an. identical set of 23 pairs of chromosomes which carry all the hereditary

Every human cell (except red blood cells and sperm and eggs) has an. identical set of 23 pairs of chromosomes which carry all the hereditary Introduction to Genetic Genealogy Every human cell (except red blood cells and sperm and eggs) has an identical set of 23 pairs of chromosomes which carry all the hereditary information that is passed

More information

DNA and Ancestry. An Update on New Tests. Steve Louis. Jewish Genealogical Society of Washington State. January 13, 2014

DNA and Ancestry. An Update on New Tests. Steve Louis. Jewish Genealogical Society of Washington State. January 13, 2014 DNA and Ancestry An Update on New Tests Steve Louis Jewish Genealogical Society of Washington State January 13, 2014 DISCLAIMER This document was prepared as a result of independent work and opinions of

More information

DNA study deals blow to theory of European origins

DNA study deals blow to theory of European origins 23 August 2011 Last updated at 23:15 GMT DNA study deals blow to theory of European origins By Paul Rincon Science editor, BBC News website Did Palaeolithic hunters leave a genetic legacy in today's European

More information

TribeMapper Report for Michael Maglio

TribeMapper Report for Michael Maglio TribeMapper Report for Michael Maglio TribeMapper Report for Michael Maglio Why This Works There are four phases of our genetic past. The four phases are Origins, Nomadic, Stationary and Historical. Our

More information

DNA TESTING. This is the testing regime for FamilyTreeDNA. Other SNP tests were ordered from Yseq.

DNA TESTING. This is the testing regime for FamilyTreeDNA. Other SNP tests were ordered from Yseq. DNA & GENEALOGY DNA TESTING This is the testing regime for FamilyTreeDNA. Other SNP tests were ordered from Yseq. Product Date Batch Family Finder 30-May-14 Completed 569 05-Aug-14 Batched 569 05-Jul-14

More information

Recent Results from the Jackson Brigade DNA Project

Recent Results from the Jackson Brigade DNA Project Recent Results from the Jackson Brigade DNA Project Dr. Daniel C. Hyde Professor Emeritus of Computer Science Bucknell University Lewisburg, PA Presented at Jackson Brigade Reunion, Horner, WV on August

More information

DNA Testing What you need to know first

DNA Testing What you need to know first DNA Testing What you need to know first This article is like the Cliff Notes version of several genetic genealogy classes. It is a basic general primer. The general areas include Project support DNA test

More information

DNA Basics. OLLI: Genealogy 101 October 1, ~ Monique E. Rivera ~

DNA Basics. OLLI: Genealogy 101 October 1, ~ Monique E. Rivera ~ DNA Basics OLLI: Genealogy 101 October 1, 2018 ~ Monique E. Rivera ~ WHAT IS DNA? DNA (deoxyribonucleic acid) is found in every living cell everywhere. It is a long chemical chain that tells our cells

More information

[CLIENT] SmithDNA1701 DE January 2017

[CLIENT] SmithDNA1701 DE January 2017 [CLIENT] SmithDNA1701 DE1704205 11 January 2017 DNA Discovery Plan GOAL Create a research plan to determine how the client s DNA results relate to his family tree as currently constructed. The client s

More information

DNA Haplogroups Report

DNA Haplogroups Report DNA Haplogroups Report for Matthew Mayberry Generated and printed on Sep 25 2011, 01:59 pm X This is a mtdna Haplogroup Report This is a mtdna Subclade Report Search criteria used in this report: HVR-1

More information

Halley Family. Mystery? Mystery? Can you solve a. Can you help solve a

Halley Family. Mystery? Mystery? Can you solve a. Can you help solve a Can you solve a Can you help solve a Halley Halley Family Family Mystery? Mystery? Who was the great grandfather of John Bennett Halley? He lived in Maryland around 1797 and might have been born there.

More information

Eller DNA Project. Status Report for Nashville EFA Conference----July 25, Tom Eller, DNA Project Administrator

Eller DNA Project. Status Report for Nashville EFA Conference----July 25, Tom Eller, DNA Project Administrator Eller DNA Project Status Report for Nashville EFA Conference----July 25, 2009 Tom Eller, DNA Project Administrator Eller DNA Project This presentation used material from Family Tree DNA and from World

More information

Using Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM

Using Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM Using Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.

More information

TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter

TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter 1-1: DNA: WHERE DO I START? Definition Genetic genealogy is the application of genetics to traditional genealogy. Genetic genealogy uses genealogical

More information

Y-Chromosome Haplotype Origins via Biogeographical Multilateration

Y-Chromosome Haplotype Origins via Biogeographical Multilateration Y-Chromosome Haplotype Origins via Biogeographical Multilateration Michael R. Maglio Abstract Current Y-chromosome migration maps only cover the broadest-brush strokes of the highest-level haplogroups.

More information

Meek DNA Project Group B Ancestral Signature

Meek DNA Project Group B Ancestral Signature Meek DNA Project Group B Ancestral Signature The purpose of this paper is to explore the method and logic used by the author in establishing the Y-DNA ancestral signature for The Meek DNA Project Group

More information

Mitochondrial DNA (mtdna) JGSGO June 5, 2018

Mitochondrial DNA (mtdna) JGSGO June 5, 2018 Mitochondrial DNA (mtdna) JGSGO June 5, 2018 MtDNA - outline What is it? What do you do with it? How do you maximize its value? 2 3 mtdna a double-stranded, circular DNA that is stored in mitochondria

More information

DNA Opening Doors for Today s s Genealogist

DNA Opening Doors for Today s s Genealogist DNA Opening Doors for Today s s Genealogist Presented to JGSI Sunday, March 30, 2008 Presented by Alvin Holtzman Genetic Genealogy Discussion Points What is DNA How can it help genealogists What to expect

More information

Y-DNA Genetic Testing

Y-DNA Genetic Testing Y-DNA Genetic Testing 50 2/24/14 Y-DNA Genetic Testing Y-DNA flows from fathers to sons intact SNPs define Y-DNA haplogroups Haplogroups (clans) migrated together Timeframe between mutations is 2,000 to

More information

CLAN DONNACHAIDH DNA NEWS No 1

CLAN DONNACHAIDH DNA NEWS No 1 CLAN DONNACHAIDH DNA NEWS No Introduction Greetings to everyone who has taken part. This is the first of an occasional publication, which will be published when there is something to say or time to write

More information

Genetics Project. So how can DNA testing be used by the HFA? Consider the following:

Genetics Project. So how can DNA testing be used by the HFA? Consider the following: Genetics Project During the 2006 reunion the HFA discussed how genetics could be used in genealogical research. This is more than just a simple paternity test. This is using genetics to determine a family

More information

THE BASICS OF DNA TESTING. By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library

THE BASICS OF DNA TESTING. By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library THE BASICS OF DNA TESTING By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library TYPES OF TESTS Mitochondrial DNA (mtdna/mdna) Y-DNA Autosomal DNA (atdna/audna) MITOCHONDRIAL DNA Found

More information

An Introduction to Genetic Genealogy

An Introduction to Genetic Genealogy An Introduction to Genetic Genealogy David A. Pike dapike@math.mun.ca Presented To: Family History Society of Newfoundland and Labrador 24 January 2006 Slide 1 of 21 Overview Genetic Genealogy using genetic

More information

DNA Testing. February 16, 2018

DNA Testing. February 16, 2018 DNA Testing February 16, 2018 What Is DNA? Double helix ladder structure where the rungs are molecules called nucleotides or bases. DNA contains only four of these nucleotides A, G, C, T The sequence that

More information

Family Tree DNA Genetic Genealogy Started Here

Family Tree DNA Genetic Genealogy Started Here Family Tree DNA Genetic Genealogy Started Here With 253,000 samples in our DNA database (the largest of its kind in the world) your genealogical search could become even easier Why Bennett Greenspan founded

More information

Autosomal-DNA. How does the nature of Jewish genealogy make autosomal DNA research more challenging?

Autosomal-DNA. How does the nature of Jewish genealogy make autosomal DNA research more challenging? Autosomal-DNA How does the nature of Jewish genealogy make autosomal DNA research more challenging? Using Family Finder results for genealogy is more challenging for individuals of Jewish ancestry because

More information

Case Study Pinpointing the Grace English Paternal Ancestral Genetic Homeland

Case Study Pinpointing the Grace English Paternal Ancestral Genetic Homeland Case Study Pinpointing the Grace English Paternal Ancestral Genetic Homeland Dr Tyrone Bowes 12 th June 2017 INTRODUCTION A simple painless commercial ancestral Y chromosome DNA test will potentially provide

More information

Genetic Genealogy Journey DNA Projects by Debbie Parker Wayne, CG SM, CGL SM

Genetic Genealogy Journey DNA Projects by Debbie Parker Wayne, CG SM, CGL SM Genetic Genealogy Journey DNA Projects by Debbie Parker Wayne, CG SM, CGL SM Genealogy can be a solitary pursuit. Genealogists sometimes collaborate to work on common lines, but lone researchers can perform

More information

Report on the VAN_TUYL Surname Project Y-STR Results 3/11/2013 Rory Van Tuyl

Report on the VAN_TUYL Surname Project Y-STR Results 3/11/2013 Rory Van Tuyl Report on the VAN_TUYL Surname Project Y-STR Results 3/11/2013 Rory Van Tuyl Abstract: Recent data for two descendants of Ott van Tuyl has been added to the project, bringing the total number of Gameren

More information

What Can I Learn From DNA Testing?

What Can I Learn From DNA Testing? What Can I Learn From DNA Testing? From where did my ancestors migrate? What is my DNA Signature? Was my ancestor a Jewish Cohanim Priest? Was my great great grandmother really an Indian Princes? I was

More information

y-haplogroups I1 and R1b in European Countries, plus Ancient Migrations within Europe

y-haplogroups I1 and R1b in European Countries, plus Ancient Migrations within Europe y-haplogroups I1 and R1b in European Countries, plus Ancient Migrations within Europe Abstract A concise summary of some of the ancient migrations of the people within Europe is given for general interest,

More information

DNA CHARLOTTE COUNTY GENEALOGICAL SOCIETY - MARCH 30, 2013 WALL STREET JOURNAL ARTICLE

DNA CHARLOTTE COUNTY GENEALOGICAL SOCIETY - MARCH 30, 2013 WALL STREET JOURNAL ARTICLE DNA CHARLOTTE COUNTY GENEALOGICAL SOCIETY - MARCH 30, 2013 WALL STREET JOURNAL ARTICLE NATIONAL GEOGRAPHIC GENOGRAPHIC PROJECT ABOUT NEWS RESULTS BUY THE KIT RESOURCES Geno 2.0 - Genographic Project

More information

Pinpointing the BLAIR Paternal Ancestral Genetic Homeland. A Scottish Case Study

Pinpointing the BLAIR Paternal Ancestral Genetic Homeland. A Scottish Case Study Pinpointing the BLAIR Paternal Ancestral Genetic Homeland A Scottish Case Study Dr Tyrone Bowes Updated 6 th June 2015 Introduction A simple painless commercial ancestral Y chromosome DNA test will potentially

More information

Unit 2: Paleolithic Era to Agricultural Revolution

Unit 2: Paleolithic Era to Agricultural Revolution Unit 2: Paleolithic Era to Agricultural Revolution Standard(s) of Learning: WHI.2 The student will demonstrate knowledge of early development of humankind from the Paleolithic Era to the agricultural revolution

More information

An Introduction. Your DNA. and Your Family Tree. (Mitochondrial DNA) Presentation by: 4/8/17 Page 1 of 10

An Introduction. Your DNA. and Your Family Tree. (Mitochondrial DNA) Presentation by: 4/8/17 Page 1 of 10 An Introduction Your DNA and Your Family Tree (Mitochondrial DNA) Presentation by: FredCoffey@aol.com 4/8/17 Page 1 of 10 Coffey Surname, y-dna Project We're now ready to move on and look at the type of

More information

Your mtdna Full Sequence Results

Your mtdna Full Sequence Results Congratulations! You are one of the first to have your entire mitochondrial DNA (DNA) sequenced! Testing the full sequence has already become the standard practice used by researchers studying the DNA,

More information

DNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016

DNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016 DNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016 1 What we will cover How testing helps genealogy What is DNA? How do you select from the three testing companies?

More information

Kenneth Nordtvedt. Many genetic genealogists eventually employ a time-tomost-recent-common-ancestor

Kenneth Nordtvedt. Many genetic genealogists eventually employ a time-tomost-recent-common-ancestor Kenneth Nordtvedt Many genetic genealogists eventually employ a time-tomost-recent-common-ancestor (TMRCA) tool to estimate how far back in time the common ancestor existed for two Y-STR haplotypes obtained

More information

The Meek Family of Allegheny Co., PA Meek Group A Introduction

The Meek Family of Allegheny Co., PA Meek Group A Introduction Meek Group A Introduction In the 1770's a significant number of families named Meek(s) lived in S. W. Pennsylvania and they can be identified in the records of Westmoreland, Allegheny and Washington Counties.

More information

An O-F3288 Y DNA Discovery for Patrilineal Descendants of James Revell (Accomack) By Marie A. Rundquist, DNA Project Administrator November 2018

An O-F3288 Y DNA Discovery for Patrilineal Descendants of James Revell (Accomack) By Marie A. Rundquist, DNA Project Administrator November 2018 Project Scope Rundquist O-F3288 White Paper 11/2018 An O-F3288 Y DNA Discovery for Patrilineal Descendants of James Revell (Accomack) By Marie A. Rundquist, DNA Project Administrator November 2018 The

More information

Big Y-700 White Paper

Big Y-700 White Paper Big Y-700 White Paper Powering discovery in the field of paternal ancestry Authors: Caleb Davis, Michael Sager, Göran Runfeldt, Elliott Greenspan, Arjan Bormans, Bennett Greenspan, and Connie Bormans Last

More information

In-depth search advice. genetic. homeland

In-depth search advice. genetic. homeland How to find your genetic Modern science can confirm the ancestral link to an area by DNA testing its current inhabitants. Piece together your paper trail and combine that with a fuller understanding of

More information

Using Mitochondrial DNA (mtdna) for Genealogy Debbie Parker Wayne, CG, CGL SM

Using Mitochondrial DNA (mtdna) for Genealogy Debbie Parker Wayne, CG, CGL SM Using Mitochondrial DNA (mtdna) for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical

More information

Autosomal DNA. What is autosomal DNA? X-DNA

Autosomal DNA. What is autosomal DNA? X-DNA ANGIE BUSH AND PAUL WOODBURY info@thednadetectives.com November 1, 2014 Autosomal DNA What is autosomal DNA? Autosomal DNA consists of all nuclear DNA except for the X and Y sex chromosomes. There are

More information

Yoder Doors Opened by DNA Studies

Yoder Doors Opened by DNA Studies Yoder Doors Opened by DNA Studies A Special Report to the 2012 North Carolina Yoder Reunion By Chris Yoder Yoder Newsletter Oct. 2012 www.yodernewsletter.org Established 1983 BACKGROUND How DNA Testing

More information

6 EARLY HUMANS WHAT MAKES HUMANS DIFFERENT FROM OTHER SPECIES?

6 EARLY HUMANS WHAT MAKES HUMANS DIFFERENT FROM OTHER SPECIES? 6 EARLY HUMANS WHAT MAKES HUMANS DIFFERENT FROM OTHER SPECIES? UNIT 6 EARLY HUMANS CONTENTS UNIT 6 BASICS 3 Unit 6 Overview 4 Unit 6 Learning Outcomes 5 Unit 6 Lessons 6 Unit 6 Key Concepts LOOKING BACK

More information

Getting the Most Out of Your DNA Matches

Getting the Most Out of Your DNA Matches Helen V. Smith PG Dip Public Health, BMedLabSci, ADCLT, Dip. Fam. Hist. PLCGS 46 Kraft Road, Pallara, Qld, 4110 Email: HVSresearch@DragonGenealogy.com Website: www.dragongenealogy.com Blog: http://www.dragongenealogy.com/blog/

More information

DNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding

DNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding DNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding by Dr. Ing. Robert L. Baber 2014 July 26 Rights reserved, see the copyright notice at http://gengen.rlbaber.de

More information

Clan Donnachaidh DNA report extracts from newsletters in 2006

Clan Donnachaidh DNA report extracts from newsletters in 2006 Clan Donnachaidh DNA report extracts from newsletters in 00 The Clan Donnachaidh DNA project was set up in December 00. It now has 7 participants representing the most numerous clan surnames Robertson,

More information

The Meek Family of Allegheny Co., PA Meek Group A Introduction

The Meek Family of Allegheny Co., PA Meek Group A Introduction Meek Group A Introduction In the 1770's a significant number of families named Meek(s) lived in S. W. Pennsylvania and they can be identified in the records of Westmoreland, Allegheny and Washington Counties.

More information

Genealogy Report of Alejandro Lorenzetti Tarabelli

Genealogy Report of Alejandro Lorenzetti Tarabelli Genealogy Report of Alejandro Lorenzetti Tarabelli My name is Donald Martin Mattos Lorenzetti, Mattos is my paternal surname, and Lorenzetti my maternal surname. For years my maternal family and I have

More information

INTRODUCTION. Over the past few years there have been great strides in the application of DNA testing for genealogical purposes.

INTRODUCTION. Over the past few years there have been great strides in the application of DNA testing for genealogical purposes. DNA & GENEALOGY Over the past few years there have been great strides in the application of DNA testing for genealogical purposes. Y-DNA testing can confirm your genealogical connections on your direct

More information

John Doe Knight Premium Male DNA Ancestry Report

John Doe Knight Premium Male DNA Ancestry Report John Doe Knight Premium Male DNA Ancestry Report Kxxxx- 8xxxxxx A sample of the Y-chromosome DNA was extracted, amplified and genotyped by DNA Diagnostics Center. Chromosomes are the double-helix genetic

More information

A STUDY OF ANDREAS KILIAN S ANCESTRIAL Y-DNA

A STUDY OF ANDREAS KILIAN S ANCESTRIAL Y-DNA 1 A STUDY OF ANDREAS KILIAN S ANCESTRIAL Y-DNA Be Silent Were the Bible Is Silent For someone who believes the Bible is the inspired Word of God, how can I believe in DNA and the dates given in this paper?

More information

Steve Harding, *Turi King and *Mark Jobling Universities of Nottingham & *Leicester, UK

Steve Harding, *Turi King and *Mark Jobling Universities of Nottingham & *Leicester, UK Viking DNA Steve Harding, *Turi King and *Mark Jobling Universities of Nottingham & *Leicester, UK Viking DNA in Northern England Project Part 1 - Wirral and West Lancashire (2002-2007) Part 2 - North

More information

Welcome to this issue of Facts & Genes, the only publication devoted to Genetic Genealogy.

Welcome to this issue of Facts & Genes, the only publication devoted to Genetic Genealogy. Facts & Genes from Family Tree DNA ================================== March 3, 2004 Volume 3, Issue 2 In This Issue ============= Editor's Corner In the News: Family Tree DNA Announcements Haplogroups:

More information

Ernie Ebayley s Adventure in DNA-Land. A Resource for Beginning Your Own Adventure into Genealogical Genetics

Ernie Ebayley s Adventure in DNA-Land. A Resource for Beginning Your Own Adventure into Genealogical Genetics Ernie Ebayley s Adventure in DNA-Land A Resource for Beginning Your Own Adventure into Genealogical Genetics 2006 C.E. Smith Museum of Anthropology College of Arts, Letters, and Social Sciences (CLASS)

More information

Before India: Exploring Your Ancestry With DNA By David G. Mahal

Before India: Exploring Your Ancestry With DNA By David G. Mahal Before India: Exploring Your Ancestry With DNA By David G. Mahal You then receive an email notifying you that your results are ready to explore on utilize your DNA results for family history by Ancestry.com

More information

Coalescence time distributions for hypothesis testing -Kapil Rajaraman 498BIN, HW# 2

Coalescence time distributions for hypothesis testing -Kapil Rajaraman 498BIN, HW# 2 Coalescence time distributions for hypothesis testing -Kapil Rajaraman (rajaramn@uiuc.edu) 498BIN, HW# 2 This essay will be an overview of Maryellen Ruvolo s work on studying modern human origins using

More information

Tools: 23andMe.com website and test results; DNAAdoption handouts.

Tools: 23andMe.com website and test results; DNAAdoption handouts. When You First Get Your 23andMe Results Objective: Learn what to do with results of atdna testing with 23andMe. Tools: 23andMe.com website and test results; DNAAdoption handouts. Exercises: Practice Exercises

More information

Origins: Coffey/Keogh Families By Fred Coffey. ONLINE:

Origins: Coffey/Keogh Families By Fred Coffey. ONLINE: Origins: Coffey/Keogh Families By Fred Coffey ONLINE: http://www.coffey.ws/familytree/dna/origins-coffeykeoghfamilies.pdf My name is Coffey, and I m very interested in working out the origins of my family.

More information

Putting the genes into genealogy

Putting the genes into genealogy Putting the genes into genealogy DNA testing can help find lost branches of your family tree. Susan C Meates describes how DNA surname projects work DNA testing for genealogy has been available since 2000,

More information

Common ancestors of all humans

Common ancestors of all humans Definitions Skip the methodology and jump down the page to the Conclusion Discussion CAs using Genetics CAs using Archaeology CAs using Mathematical models CAs using Computer simulations Recent news Mark

More information

Using Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM

Using Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM Using Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.

More information

Walter Steets Houston Genealogical Forum DNA Interest Group April 7, 2018

Walter Steets Houston Genealogical Forum DNA Interest Group April 7, 2018 Ancestry DNA and GEDmatch Walter Steets Houston Genealogical Forum DNA Interest Group April 7, 2018 Today s agenda Recent News about DNA Testing DNA Cautions: DNA Data Used for Forensic Purposes New Technology:

More information

DAR POLICY STATEMENT AND BACKGROUND Using DNA Evidence for DAR Applications

DAR POLICY STATEMENT AND BACKGROUND Using DNA Evidence for DAR Applications Effective January 1, 2014, DAR will begin accepting Y-DNA evidence in support of new member applications and supplemental applications as one element in a structured analysis. This analysis will use a

More information

Genealogical trees, coalescent theory, and the analysis of genetic polymorphisms

Genealogical trees, coalescent theory, and the analysis of genetic polymorphisms Genealogical trees, coalescent theory, and the analysis of genetic polymorphisms Magnus Nordborg University of Southern California The importance of history Genetic polymorphism data represent the outcome

More information

23 March I will try and summarize the Y-DNA male line test results for both of you and the other members of the Stubbs DNA Project:

23 March I will try and summarize the Y-DNA male line test results for both of you and the other members of the Stubbs DNA Project: 23 March 2019 Hello Irving and Rodney, I would like to share with you my thoughts regarding the recent DNA testing both of you in the Big Y program. I am therefore including both of you in this message.

More information

Finding a Male Hodge(s) Descendant for Y-Chromosome DNA Testing. Prepared by Jan Alpert

Finding a Male Hodge(s) Descendant for Y-Chromosome DNA Testing. Prepared by Jan Alpert Finding a Male Hodge(s) Descendant for Y-Chromosome DNA Testing Prepared by Jan Alpert Why Test Male Y-Chromosome DNA All males carry the Y-Chromosome of their fathers As a result the same DNA markers

More information

Ewing Surname Y-DNA Project Article 8

Ewing Surname Y-DNA Project Article 8 Ewing Surname Y-DNA Project Article 8 This is the eighth in a series of articles about the Ewing Surname Y-DNA Project. The previous seven articles have appeared in the last seven issues of the Journal

More information

Human Origins and the Agricultural Revolution

Human Origins and the Agricultural Revolution Lesson Plan: Subject: Human Origins and the Agricultural Revolution World History Grade: 9 CBC Connection: IIB1: IIB2L: Describe and give examples of social, political and economic development from the

More information

First Results: Intro to FamilyTreeDNA s Family Finder. Learn what to do with results of autosomal DNA testing with FamilyTreeDNA (FTDNA).

First Results: Intro to FamilyTreeDNA s Family Finder. Learn what to do with results of autosomal DNA testing with FamilyTreeDNA (FTDNA). First Results: Family Tree DNA When You First Get Your FamilyTreeDNA (FTDNA) Results Objective: Learn what to do with results of autosomal DNA testing with FamilyTreeDNA (FTDNA). Tools: familytreedna.com

More information

The Historian and Pre-History: Vocabulary Terms

The Historian and Pre-History: Vocabulary Terms Calendars: Dating systems that measure time. Calendars differ and vary across cultures. B.C.: Before Christ measures the years before the birth of Jesus. A.D.: Anno Domini comes from latin, and means in

More information

Contributed by "Kathy Hallett"

Contributed by Kathy Hallett National Geographic: The Genographic Project Name Background The National Geographic Society is undertaking the ambitious process of tracking human migration using genetic technology. By using the latest

More information

DOWNLOAD OR READ : THE ANCESTRY OF EDGAR RICE BURROUGHS PDF EBOOK EPUB MOBI

DOWNLOAD OR READ : THE ANCESTRY OF EDGAR RICE BURROUGHS PDF EBOOK EPUB MOBI DOWNLOAD OR READ : THE ANCESTRY OF EDGAR RICE BURROUGHS PDF EBOOK EPUB MOBI Page 1 Page 2 the ancestry of edgar rice burroughs the ancestry of edgar pdf the ancestry of edgar rice burroughs J Forensic

More information

Genetic Identity and

Genetic Identity and Genetic Identity and GACATGTAGCTCTTCACTTCACCCAGGTTGGGTTGTGTCAACAGGAAACATTGTAACATATCACTTGGATTAGCACCTAGG/TTAT/TTAT/TTA Community DTC Genetic Testing Workshop The National Academies' August 31 September 1,

More information

! FTDNA! Ancestry. ! 23andMe. ! Medical Considera,ons. ! Iden,fying family medical history. ! Communica,ng with the medical community

! FTDNA! Ancestry. ! 23andMe. ! Medical Considera,ons. ! Iden,fying family medical history. ! Communica,ng with the medical community by JEFF CARPENTER! Brief Defini,ons about YDNA, XDNA, mtdna, atdna (Covered in Part 1)! Benefits of Tes,ng DNA! Examples of DNA TESTING! FTDNA! Ancestry! 3andMe Jeff Carpenter, 016 jeffcarpenter1939@gmal.com!

More information

ICMP DNA REPORTS GUIDE

ICMP DNA REPORTS GUIDE ICMP DNA REPORTS GUIDE Distribution: General Sarajevo, 16 th December 2010 GUIDE TO ICMP DNA REPORTS 1. Purpose of This Document 1. The International Commission on Missing Persons (ICMP) endeavors to secure

More information

company does improve its ethnicity estimates, your profile will automatically be updated, too. You won't have to retake the test to get the new

company does improve its ethnicity estimates, your profile will automatically be updated, too. You won't have to retake the test to get the new Ancestry dna kit The Y-DNA test is more limited than the ones from Family Tree DNA Does not offer a less expensive 'autosomal DNA-only' test Can't connect with other matches Can't upload raw data from

More information

IN THIS ISSUE: February From the Administrator Questions/News...1. George Varner of Missouri Direct Line...2

IN THIS ISSUE: February From the Administrator Questions/News...1. George Varner of Missouri Direct Line...2 IN THIS ISSUE: From the Administrator..... 1 Questions/News.......1 George Varner of Missouri Direct Line...2 Do the Newtons & Varners Really Both have Riggs DNA?...2 2016 Newton/Varner Reunion. 5 February

More information

DOWNLOAD OR READ : NEW ENGLAND ANCESTRY OF GROVER CLEVELAND PRESIDENT OF THE UNITED STATES OF AMERICA PDF EBOOK EPUB MOBI

DOWNLOAD OR READ : NEW ENGLAND ANCESTRY OF GROVER CLEVELAND PRESIDENT OF THE UNITED STATES OF AMERICA PDF EBOOK EPUB MOBI DOWNLOAD OR READ : NEW ENGLAND ANCESTRY OF GROVER CLEVELAND PRESIDENT OF THE UNITED STATES OF AMERICA PDF EBOOK EPUB MOBI Page 1 Page 2 new england ancestry of grover cleveland president of the united

More information

Pizza and Who do you think you are?

Pizza and Who do you think you are? Pizza and Who do you think you are? an overview of one of the newest and possibly more helpful developments in researching genealogy and family history that of using DNA for research What is DNA? Part

More information

Use of DNA information in family research information for IOWFHS members

Use of DNA information in family research information for IOWFHS members Use of DNA information in family research information for IOWFHS members What is DNA? Since the discovery of deoxyribonucleic acid (DNA) in the 1950s, we have come to understand more about its role as

More information

The DNA Case for Bethuel Riggs

The DNA Case for Bethuel Riggs The DNA Case for Bethuel Riggs The following was originally intended as an appendix to Alvy Ray Smith, Edwardian Riggses of America I: Elder Bethuel Riggs (1757 1835) of Morris County, New Jersey, and

More information

The Structure of DNA Let s take a closer look at how this looks under a microscope.

The Structure of DNA Let s take a closer look at how this looks under a microscope. DNA Basics Adapted from a MyHeritage Blog and the International Society of Genetic Genealogy (ISOGG) Wiki by Earl Cory MyHeritage has started a series to explain DNA, how it works and answer the most common

More information

Subgroup A2: Reilly-McGovern Cluster

Subgroup A2: Reilly-McGovern Cluster Subgroup A2: Reilly-McGovern Cluster Charts 15 & 16 below shows the names and origins for the members of this cluster, except for the Faughnans, who are placed with the A2 Various Lineages for economy

More information

Industrialization Spreads Close Read

Industrialization Spreads Close Read Industrialization Spreads Close Read Standards Alignment Text with Close Read instructions for students Intended to be the initial read in which students annotate the text as they read. Students may want

More information

BETTER TOGETHER: MAKING YOUR CASE WITH DOCUMENTS AND DNA BCG-sponsored Webinar (https://bcgcertification.org) Patricia Lee Hobbs, CG

BETTER TOGETHER: MAKING YOUR CASE WITH DOCUMENTS AND DNA BCG-sponsored Webinar (https://bcgcertification.org) Patricia Lee Hobbs, CG BETTER TOGETHER: MAKING YOUR CASE WITH DOCUMENTS AND DNA BCG-sponsored Webinar (https://bcgcertification.org) Patricia Lee Hobbs, CG LIMITATIONS & BENEFITS OF DNA TESTING DNA test results do not solve

More information

Genesis and Genetics Matthew Price

Genesis and Genetics Matthew Price Genesis and Genetics Matthew Price Apologetics and Creation Camp 16 June 2018 Karakariki Christian Camp, Waikato, NZ 1 What is Science? 2 What is Science? Hypothesis Theory Start with a hypothesis; a reasonable

More information

Warm-up. Need Note Books. Sit where you want. List 4 tools used by modern man. What effect does each have on humanity?

Warm-up. Need Note Books. Sit where you want. List 4 tools used by modern man. What effect does each have on humanity? Warm-up Need Note Books Sit where you want. List 4 tools used by modern man. What effect does each have on humanity? Objectives and Terms for today How specific tools Helped early human survival Methods

More information

FREQUENTLY ASKED QUESTIONS ABOUT THE OWSTON/OUSTON DNA PROJECT

FREQUENTLY ASKED QUESTIONS ABOUT THE OWSTON/OUSTON DNA PROJECT FREQUENTLY ASKED QUESTIONS ABOUT THE OWSTON/OUSTON DNA PROJECT 1. What has been discovered thus far and what may be discovered with testing? The Owston/Ouston DNA project grew out of the combined genealogical

More information

Chapter 1: Before History Due: Friday, August 21, 2015

Chapter 1: Before History Due: Friday, August 21, 2015 Chapter 1: Before History Due: Friday, August 21, 2015 The first chapter of Traditions and Encounters sets the stage for the drama of world history by presenting the major milestones in the development

More information

How a DNA Project has produced discoveries in the Meates One- Name Study not possible with paper records alone

How a DNA Project has produced discoveries in the Meates One- Name Study not possible with paper records alone How a DNA Project has produced discoveries in the Meates One- Name Study not possible with paper records alone By Susan C. Meates ORE AND more one-namers are fascinated by the new genealogy of DNA testing

More information

The African Origin Hypothesis What do the data tell us?

The African Origin Hypothesis What do the data tell us? The African Origin Hypothesis What do the data tell us? Mitochondrial DNA and Human Evolution Cann, Stoneking and Wilson, Nature 1987. WOS - 1079 citations Mitochondrial DNA and Human Evolution Cann, Stoneking

More information

GEDmatch Home Page The upper left corner of your home page has Information about you and links to lots of helpful information. Check them out!

GEDmatch Home Page The upper left corner of your home page has Information about you and links to lots of helpful information. Check them out! USING GEDMATCH Created March 2015 GEDmatch is a free, non-profit site that accepts raw autosomal data files from Ancestry, FTDNA, and 23andme. As such, it provides a large autosomal database that spans

More information

Genetic Genealogy. Rules and Tools. Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter

Genetic Genealogy. Rules and Tools. Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter Genetic Genealogy Rules and Tools Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter I am NOT this guy! 2 Genealogy s Newest Tool Genealogy research: Study of Family History Identifies

More information

Getting the Most of Your DNA Test. Friends of Irish Research Richard Reid

Getting the Most of Your DNA Test. Friends of Irish Research Richard Reid Getting the Most of Your DNA Test Friends of Irish Research Richard Reid So You Have Been Tested! The results are back and now is time to explore and see if any of your brick walls can be broken down.

More information

Primer on Human Pedigree Analysis:

Primer on Human Pedigree Analysis: Primer on Human Pedigree Analysis: Criteria for the selection and collection of appropriate Family Reference Samples John V. Planz. Ph.D. UNT Center for Human Identification Successful Missing Person ID

More information

Population Genetics using Trees. Peter Beerli Genome Sciences University of Washington Seattle WA

Population Genetics using Trees. Peter Beerli Genome Sciences University of Washington Seattle WA Population Genetics using Trees Peter Beerli Genome Sciences University of Washington Seattle WA Outline 1. Introduction to the basic coalescent Population models The coalescent Likelihood estimation of

More information