Genetic Genealogy. Using DNA to research your maternal & paternal lines. Ed McGuire. Vermont Genealogy Library 2/24/14
|
|
|
- Candice Poole
- 5 years ago
- Views:
Transcription
1 Genetic Genealogy Using DNA to research your maternal & paternal lines Ed McGuire 2/24/14
2 Introduction Soprano Family Tree 2 2/24/14
3 Introduction 3 2/24/14
4 Introduction 4 2/24/14
5 Introduction Contradictory Evidence Brickwalls Many identical names in one place 5 2/24/14
6 Introduction Lacking answers from basic sources, we try - Immigration, naturalization records - Military service, pension records - Newspapers, journals, online searches - Collateral lines, friends & associates 6 2/24/14
7 Introduction 7 2/24/14
8 Introduction 8 2/24/14
9 DNA Basics 9 2/24/14
10 DNA Basics Source: National Genealogical Society: Genetic Genealogy The Basics 10 2/24/14
11 DNA Basics Each Cell s 23 Chromosome Pairs Karyogram of Human Male Cell Source: Wikipedia.org (en.wikipeida.org/wiki/karyotype) 11 2/24/14
12 DNA Basics DNA Molecule 12 2/24/14
13 DNA Basics DNA Molecule Source: National Human Genome Research Institute (NHGRI) 13 2/24/14
14 DNA Basics Source: NGS Course Genetic Genealogy, the Basics 14 2/24/14
15 DNA Basics Humans have about 20,000 genes Genes comprise 1.5% of our DNA Source: NGS Course Genetic Genealogy, the Basics 15 2/24/14
16 DNA Basics Genetic Genealogy and Privacy Concerns Our DNA is integral to our identity y-dna and mt-dna tests do not use medically sensitive sites at-dna tests w/ AncestryDNA & FamilyTreeDNA don t either - 23andMe does test a extra SNPs w/ medical implications Extensive protections are used by all 3 companies & 3d party sites Loss of the raw data w/o links to identity of owner is near useless If you aren t happy after reading T s & C s of sites don t test 16 2/24/14
17 DNA Basics Humans have about 20,000 genes Genes comprise 1.5% of our DNA Source: NGS Course Genetic Genealogy, the Basics 17 2/24/14
18 DNA Basics DNA Mutations 18 2/24/14
19 DNA Basics DNA Mutations SNP = Single Nucleotide Polymorphism 19 2/24/14
20 DNA Basics Mutation rates much higher in non-coding region Source: NGS Course Genetic Genealogy, the Basics 20 2/24/14
21 DNA Basics Source: NGS Course Genetic Genealogy, the Basics 21 2/24/14
22 DNA Basics Modern Humans Present in Africa (200,000 YBP) 22 2/24/14
23 DNA Basics African Y-DNA Haplogroup A A ( > 100,000 Years Ago) 23 2/24/14
24 DNA Basics Y-DNA Haplogroup B Diverges From A B A ( > 100,000 Years Ago) 24 2/24/14
25 DNA Basics Modern Y-DNA Haplogroups of Africa E D C B A ( > 100,000 Years Ago) 25 2/24/14
26 DNA Basics Modern Y-DNA Haplogroups of Africa E D C B A ( > 100,000 Years Ago) 26 2/24/14
27 The Spread of Haplogroup F Source: Wikimedia Commons ( 27 2/24/14
28 Haplogroup R s Dispersion Source: Wikimedia Commons ( 28 2/24/14
29 DNA Basics Source: FamilyTreeDNA.com 29 2/24/14
30 DNA Basics Recap DNA comprises our chromosomes & mitochondrial genome Mutations accumulate over time especially in non-coding areas Population groups (clans) can be defined by SNP mutations The major clans are called haplogroups Our DNA allows us to track our haplogroups & their migrations 30 2/24/14
31 DNA Basics Mitochondrial (mtdna) Genetic Testing 31 2/24/14
32 Mitochondrial DNA Tests Cell Wall Chromosomes Cytoplasm Mitochondria Nucleus Hominid Cell 32 2/24/14
33 Mitochondrial DNA Tests Maternal Descent of Mitochondrial DNA (mtdna) Mitochondrial DNA Nuclear (autosomal) DNA 33 2/24/14
34 Mitochondrial DNA Tests Mitochondrial DNA (~16,600 Base Pairs) (Hyper-variable Region) HVR-1 Non-Coding (Hyper-variable Region) HVR-2 Non-Coding mtdna Coding Region (37 genes) 34 2/24/14
35 Mitochondrial DNA Tests Mitochondrial DNA Haplogroup Migration Source: FamilyTreeDNA.com 35 2/24/14
36 Mitochondrial DNA Tests mtdna Haplogroups & Origins Location Haplogroups African Middle Eastern European Asian Native American L1, L2, L3, M N, M H, I, J, K, T, U, V, W, X B, C, D, F, G, M, Y, Z, A A, B, C, D, X 36 2/24/14
37 Mitochondrial DNA Tests Mitochondrial Inheritance Pattern
38 Mitochondrial DNA Tests GGG-Mother GG-Mother G-Mother Mother Path of mitochondrial DNA
39 Mitochondrial DNA Tests Characteristics of mtdna Data Deep ancestry (mutations 2,000 to 10,000 years ago) Migration routes & locations Most matches in anthropological time vs. genealogical time 39 2/24/14
40 Mitochondrial DNA Tests Common Uses of mtdna Tests Group-specific studies (Acadian, Jewish, Mi kma ki, etc) Native American ancestor on maternal line? African? Asian? mtdna haplogroup studies Used to identify remains of fallen military It can also provide recent evidence 40 2/24/14
41 Mitochondrial DNA Tests Fille du Roi Catherine Pillard Catherine CHARRON-DUCHARME Marie Angélique CHAGNON Marie Antoinette BENOIT-LIVERNOIS Marie Angélique LEDUC Angélique LANGEVIN Marguerite DANSEREAU Marguerite GUYON dit Dion Delphine CORDEAU Marie Yvonne DAIGNEAULT Thérèse RICHARD Nicole BOUTIN 41 2/24/14
42 Mitochondrial DNA Tests mtdna Haplogroups & Origins Location Haplogroups African Middle Eastern European Asian Native American L1, L2, L3, M N, M H, I, J, K, T, U, V, W, X B, C, D, F, G, M, Y, Z, A A, B, C, D, X 42 2/24/14
43 Y-Chromosome Tests Fille du Roi Catherine Pillard Catherine CHARRON-DUCHARME Marie Angélique CHAGNON Marie Antoinette BENOIT-LIVERNOIS Marie Angélique LEDUC Angélique LANGEVIN Marguerite DANSEREAU Marguerite GUYON dit Dion Delphine CORDEAU Marie Yvonne DAIGNEAULT Thérèse RICHARD Nicole BOUTIN 43 2/24/14
44 Mitochondrial DNA Tests Filles du Roi Catherine Pillard Catherine CHARRON-DUCHARME Marie Louise CHARRON-DUCHARME Catherine CHARRON-DUCHARME Marie Angélique CHAGNON Marie Madeleine COLIN dit Laliberté Marie Angélique CHAGNON Marie Antoinette BENOIT-LIVERNOIS Marie Judith CHARON dit Larose Geneviève BENOIT-LIVERNOIS Marie Angélique LEDUC Marie Judith GODU Marie Magdeleine BEAUDRY Angélique LANGEVIN Marie Judith VACHON Marie Amable GUYON Marguerite DANSEREAU Angélique DALPÉ dit Pariseau Euphrosine BOURGEOIS Marguerite GUYON dit Dion Sophie MINOR Marie Delphine LUCIER Delphine CORDEAU Mathilde DUFRESNE/ASHLEY Marie Yvonne DAIGNEAULT Dorothy JOHNSON Delphine DE FORGE Thérèse RICHARD Betty Ann BRADY Lena Della MAY Faith Eleanor MORROW Nicole BOUTIN John CROTEAU Sandra MCGRATH Three mtdna Tests: All results are haplogroup A (Native American) 44 2/24/14
45 Mitochondrial DNA Tests Genealogical Value in mtdna Tests 1. Disprove a hypothesis Annie Jones DAWKINS was a sister of Mary Jones ADAMS 2. Find a genetic cousin who has researched further back in time 3. Find genetic cousins with links to a specific location in Europe CeCe Moore s DNA helps w/ woman s 1730 brickwall 45 2/24/14
46 Mitochondrial DNA Tests mtdna Results from FamilyTreeDNA 46 2/24/14
47 Mitochondrial DNA Tests Key Data From mtdna Testing 47 2/24/14
48 Mitochondrial DNA Tests mtdna Test Results (Haplogroup = U5) Source: FamilyTreeDNA.com 48 2/24/14
49 Mitochondrial DNA Tests Example of mtdna Matches Maria Adams Fred Jones Janet O Neill Lynn Kopec Elisa Schmidt Sally Martinez Home Brown Jean-Luc Leclerc Source: FamilyTreeDNA.com 49 2/24/14
Y-DNA Genetic Testing
Y-DNA Genetic Testing 50 2/24/14 Y-DNA Genetic Testing Y-DNA flows from fathers to sons intact SNPs define Y-DNA haplogroups Haplogroups (clans) migrated together Timeframe between mutations is 2,000 to
DNA Basics. OLLI: Genealogy 101 October 1, ~ Monique E. Rivera ~
DNA Basics OLLI: Genealogy 101 October 1, 2018 ~ Monique E. Rivera ~ WHAT IS DNA? DNA (deoxyribonucleic acid) is found in every living cell everywhere. It is a long chemical chain that tells our cells
THE BASICS OF DNA TESTING. By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library
THE BASICS OF DNA TESTING By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library TYPES OF TESTS Mitochondrial DNA (mtdna/mdna) Y-DNA Autosomal DNA (atdna/audna) MITOCHONDRIAL DNA Found
Your mtdna Full Sequence Results
Congratulations! You are one of the first to have your entire mitochondrial DNA (DNA) sequenced! Testing the full sequence has already become the standard practice used by researchers studying the DNA,
DNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016
DNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016 1 What we will cover How testing helps genealogy What is DNA? How do you select from the three testing companies?
TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter
TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter 1-1: DNA: WHERE DO I START? Definition Genetic genealogy is the application of genetics to traditional genealogy. Genetic genealogy uses genealogical
Mitochondrial DNA (mtdna) JGSGO June 5, 2018
Mitochondrial DNA (mtdna) JGSGO June 5, 2018 MtDNA - outline What is it? What do you do with it? How do you maximize its value? 2 3 mtdna a double-stranded, circular DNA that is stored in mitochondria
DNA Opening Doors for Today s s Genealogist
DNA Opening Doors for Today s s Genealogist Presented to JGSI Sunday, March 30, 2008 Presented by Alvin Holtzman Genetic Genealogy Discussion Points What is DNA How can it help genealogists What to expect
Halley Family. Mystery? Mystery? Can you solve a. Can you help solve a
Can you solve a Can you help solve a Halley Halley Family Family Mystery? Mystery? Who was the great grandfather of John Bennett Halley? He lived in Maryland around 1797 and might have been born there.
DNA and Ancestry. An Update on New Tests. Steve Louis. Jewish Genealogical Society of Washington State. January 13, 2014
DNA and Ancestry An Update on New Tests Steve Louis Jewish Genealogical Society of Washington State January 13, 2014 DISCLAIMER This document was prepared as a result of independent work and opinions of
DNA Testing What you need to know first
DNA Testing What you need to know first This article is like the Cliff Notes version of several genetic genealogy classes. It is a basic general primer. The general areas include Project support DNA test
Genetic Genealogy Journey DNA Projects by Debbie Parker Wayne, CG SM, CGL SM
Genetic Genealogy Journey DNA Projects by Debbie Parker Wayne, CG SM, CGL SM Genealogy can be a solitary pursuit. Genealogists sometimes collaborate to work on common lines, but lone researchers can perform
Every human cell (except red blood cells and sperm and eggs) has an. identical set of 23 pairs of chromosomes which carry all the hereditary
Introduction to Genetic Genealogy Every human cell (except red blood cells and sperm and eggs) has an identical set of 23 pairs of chromosomes which carry all the hereditary information that is passed
Walter Steets Houston Genealogical Forum DNA Interest Group April 7, 2018
Ancestry DNA and GEDmatch Walter Steets Houston Genealogical Forum DNA Interest Group April 7, 2018 Today s agenda Recent News about DNA Testing DNA Cautions: DNA Data Used for Forensic Purposes New Technology:
An Introduction. Your DNA. and Your Family Tree. (Mitochondrial DNA) Presentation by: 4/8/17 Page 1 of 10
An Introduction Your DNA and Your Family Tree (Mitochondrial DNA) Presentation by: FredCoffey@aol.com 4/8/17 Page 1 of 10 Coffey Surname, y-dna Project We're now ready to move on and look at the type of
DNA Testing. February 16, 2018
DNA Testing February 16, 2018 What Is DNA? Double helix ladder structure where the rungs are molecules called nucleotides or bases. DNA contains only four of these nucleotides A, G, C, T The sequence that
Pizza and Who do you think you are?
Pizza and Who do you think you are? an overview of one of the newest and possibly more helpful developments in researching genealogy and family history that of using DNA for research What is DNA? Part
Walter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018
DNA, Ancestry, and Your Genealogical Research- Segments and centimorgans Walter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018 1 Today s agenda Brief review of previous DIG session
Ernie Ebayley s Adventure in DNA-Land. A Resource for Beginning Your Own Adventure into Genealogical Genetics
Ernie Ebayley s Adventure in DNA-Land A Resource for Beginning Your Own Adventure into Genealogical Genetics 2006 C.E. Smith Museum of Anthropology College of Arts, Letters, and Social Sciences (CLASS)
Autosomal DNA. What is autosomal DNA? X-DNA
ANGIE BUSH AND PAUL WOODBURY info@thednadetectives.com November 1, 2014 Autosomal DNA What is autosomal DNA? Autosomal DNA consists of all nuclear DNA except for the X and Y sex chromosomes. There are
Using Mitochondrial DNA (mtdna) for Genealogy Debbie Parker Wayne, CG, CGL SM
Using Mitochondrial DNA (mtdna) for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical
company does improve its ethnicity estimates, your profile will automatically be updated, too. You won't have to retake the test to get the new
Ancestry dna kit The Y-DNA test is more limited than the ones from Family Tree DNA Does not offer a less expensive 'autosomal DNA-only' test Can't connect with other matches Can't upload raw data from
! FTDNA! Ancestry. ! 23andMe. ! Medical Considera,ons. ! Iden,fying family medical history. ! Communica,ng with the medical community
by JEFF CARPENTER! Brief Defini,ons about YDNA, XDNA, mtdna, atdna (Covered in Part 1)! Benefits of Tes,ng DNA! Examples of DNA TESTING! FTDNA! Ancestry! 3andMe Jeff Carpenter, 016 jeffcarpenter1939@gmal.com!
CAGGNI s DNA Special Interest Group
CAGGNI s DNA Special Interest Group 10 Jan 2015 Al & Michelle Wilson Agenda Survey Basics in Fan Charts Recombination Exercise Triangulation Overview Survey 1. Have you taken (or sponsored) a DNA test?
DNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding
DNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding by Dr. Ing. Robert L. Baber 2014 July 26 Rights reserved, see the copyright notice at http://gengen.rlbaber.de
Your Family 101 Beginning Genealogical Research
Your Family 101 Beginning Genealogical Research What Will We Cover Today? Session 1: Getting Started Session 2: Your Resources Session 3: Common Mistakes and Pitfalls Session 4: DNA Testing and Medical
Using Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM
Using Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.
Recent Results from the Jackson Brigade DNA Project
Recent Results from the Jackson Brigade DNA Project Dr. Daniel C. Hyde Professor Emeritus of Computer Science Bucknell University Lewisburg, PA Presented at Jackson Brigade Reunion, Horner, WV on August
Ewing Surname Y-DNA Project Article 8
Ewing Surname Y-DNA Project Article 8 This is the eighth in a series of articles about the Ewing Surname Y-DNA Project. The previous seven articles have appeared in the last seven issues of the Journal
Getting the Most of Your DNA Test. Friends of Irish Research Richard Reid
Getting the Most of Your DNA Test Friends of Irish Research Richard Reid So You Have Been Tested! The results are back and now is time to explore and see if any of your brick walls can be broken down.
What Can I Learn From DNA Testing?
What Can I Learn From DNA Testing? From where did my ancestors migrate? What is my DNA Signature? Was my ancestor a Jewish Cohanim Priest? Was my great great grandmother really an Indian Princes? I was
Autosomal-DNA. How does the nature of Jewish genealogy make autosomal DNA research more challenging?
Autosomal-DNA How does the nature of Jewish genealogy make autosomal DNA research more challenging? Using Family Finder results for genealogy is more challenging for individuals of Jewish ancestry because
DNA Haplogroups Report
DNA Haplogroups Report for Matthew Mayberry Generated and printed on Sep 25 2011, 01:59 pm X This is a mtdna Haplogroup Report This is a mtdna Subclade Report Search criteria used in this report: HVR-1
DNA: UNLOCKING THE CODE
DNA: UNLOCKING THE CODE Connecting Cousins for Genetic Genealogy Bryant McAllister, PhD Associate Professor of Biology University of Iowa bryant-mcallister@uiowa.edu Iowa Genealogical Society April 9,
A Day Out With Your DNA
A Day Out With Your DNA Diahan Southard www.yourdnaguide.com Your testing company has evaluated around 800,000 locations on your DNA to help them determine your origins and your genetic cousins. While
[CLIENT] SmithDNA1701 DE January 2017
![[CLIENT] SmithDNA1701 DE January 2017](/thumbs/93/113058427.jpg "[CLIENT] SmithDNA1701 DE January 2017")
[CLIENT] SmithDNA1701 DE1704205 11 January 2017 DNA Discovery Plan GOAL Create a research plan to determine how the client s DNA results relate to his family tree as currently constructed. The client s
Welcome to this issue of Facts & Genes, the only publication devoted to Genetic Genealogy.
Facts & Genes from Family Tree DNA ================================== March 3, 2004 Volume 3, Issue 2 In This Issue ============= Editor's Corner In the News: Family Tree DNA Announcements Haplogroups:
IN THIS ISSUE: February From the Administrator Questions/News...1. George Varner of Missouri Direct Line...2
IN THIS ISSUE: From the Administrator..... 1 Questions/News.......1 George Varner of Missouri Direct Line...2 Do the Newtons & Varners Really Both have Riggs DNA?...2 2016 Newton/Varner Reunion. 5 February
Genesis and Genetics Matthew Price
Genesis and Genetics Matthew Price Apologetics and Creation Camp 16 June 2018 Karakariki Christian Camp, Waikato, NZ 1 What is Science? 2 What is Science? Hypothesis Theory Start with a hypothesis; a reasonable
The Structure of DNA Let s take a closer look at how this looks under a microscope.
DNA Basics Adapted from a MyHeritage Blog and the International Society of Genetic Genealogy (ISOGG) Wiki by Earl Cory MyHeritage has started a series to explain DNA, how it works and answer the most common
First Results: Intro to FamilyTreeDNA s Family Finder. Learn what to do with results of autosomal DNA testing with FamilyTreeDNA (FTDNA).
First Results: Family Tree DNA When You First Get Your FamilyTreeDNA (FTDNA) Results Objective: Learn what to do with results of autosomal DNA testing with FamilyTreeDNA (FTDNA). Tools: familytreedna.com
Tools: 23andMe.com website and test results; DNAAdoption handouts.
When You First Get Your 23andMe Results Objective: Learn what to do with results of atdna testing with 23andMe. Tools: 23andMe.com website and test results; DNAAdoption handouts. Exercises: Practice Exercises
Getting the Most Out of Your DNA Matches
Helen V. Smith PG Dip Public Health, BMedLabSci, ADCLT, Dip. Fam. Hist. PLCGS 46 Kraft Road, Pallara, Qld, 4110 Email: HVSresearch@DragonGenealogy.com Website: www.dragongenealogy.com Blog: http://www.dragongenealogy.com/blog/
Walter Steets Houston Genealogical Forum DNA Interest Group February 24, 2018
Using Ancestry DNA and Third-Party Tools to Research Your Shared DNA Segments Part 2 Walter Steets Houston Genealogical Forum DNA Interest Group February 24, 2018 1 Today s agenda Brief review of previous
DNA for Genealogy Librarians. Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District
DNA for Genealogy Librarians Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District What does DNA do? It replicates itself. It codes for the production
Computer - aided Genealogy. Rob Drew
Computer - aided Genealogy Rob Drew Topics Building your family tree Off-line tools for your laptop or desktop at home. What s a gedcom file? Building an on-line tree. Research websites Where to get help
Genealogical Research
DNA, Ancestry, and Your Genealogical Research Walter Steets Houston Genealogical Forum DNA Interest Group March 2, 2019 1 Today s Agenda Brief review of basic genetics and terms used in genetic genealogy
Before India: Exploring Your Ancestry With DNA By David G. Mahal
Before India: Exploring Your Ancestry With DNA By David G. Mahal You then receive an email notifying you that your results are ready to explore on utilize your DNA results for family history by Ancestry.com
Using Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM
Using Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.
Walter Steets Houston Genealogical Forum DNA Interest Group May 5, 2018
GEDmatch: The Golden State Killer Tier 1 Tools Walter Steets Houston Genealogical Forum DNA Interest Group May 5, 2018 1 Today s agenda Walter s Take on DNA Developments Growth in Number of DNA Testers
Yoder Doors Opened by DNA Studies
Yoder Doors Opened by DNA Studies A Special Report to the 2012 North Carolina Yoder Reunion By Chris Yoder Yoder Newsletter Oct. 2012 www.yodernewsletter.org Established 1983 BACKGROUND How DNA Testing
Introduction. Looking at Faces
Introduction Looking at Faces Our complete ancestry is within us. The individual is a result of a long chain of ancestors who are still present within us and exert power over us. Men must go inside themselves,
Identification of the Hypothesized African Ancestry of the Wife of Pvt. Henry Windecker Using Genomic Testing of the Autosomes.
Identification of the Hypothesized African Ancestry of the Wife of Pvt. Henry Windecker Using Genomic Testing of the Autosomes Introduction African Ancestry: The hypothesis, based on considerable circumstantial
Using X-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM
Using X-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.
Contributed by "Kathy Hallett"
National Geographic: The Genographic Project Name Background The National Geographic Society is undertaking the ambitious process of tracking human migration using genetic technology. By using the latest
DAR POLICY STATEMENT AND BACKGROUND Using DNA Evidence for DAR Applications
Effective January 1, 2014, DAR will begin accepting Y-DNA evidence in support of new member applications and supplemental applications as one element in a structured analysis. This analysis will use a
The African Origin Hypothesis What do the data tell us?
The African Origin Hypothesis What do the data tell us? Mitochondrial DNA and Human Evolution Cann, Stoneking and Wilson, Nature 1987. WOS - 1079 citations Mitochondrial DNA and Human Evolution Cann, Stoneking
Walter Steets Houston Genealogical Forum DNA Interest Group January 27, 2018
Using Ancestry DNA and Third-Party Tools to Research Your Shared DNA Segments Walter Steets Houston Genealogical Forum DNA Interest Group January 27, 2018 1 Today s agenda Brief review of previous DIG
DNA Solu)ons for Brick Walls And Adop)on
DNA Solu)ons for Brick Walls And Adop)on "I have not failed. I've just found ten thousand ways that won't work." Thomas Edison Wise Woman Gene+c Genealogy Comments Listen Carefully! 1. DNA is not the be
Report on the VAN_TUYL Surname Project Y-STR Results 3/11/2013 Rory Van Tuyl
Report on the VAN_TUYL Surname Project Y-STR Results 3/11/2013 Rory Van Tuyl Abstract: Recent data for two descendants of Ott van Tuyl has been added to the project, bringing the total number of Gameren
Genetic Genealogy. Rules and Tools. Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter
Genetic Genealogy Rules and Tools Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter I am NOT this guy! 2 Genealogy s Newest Tool Genealogy research: Study of Family History Identifies
Coalescence time distributions for hypothesis testing -Kapil Rajaraman 498BIN, HW# 2
Coalescence time distributions for hypothesis testing -Kapil Rajaraman (rajaramn@uiuc.edu) 498BIN, HW# 2 This essay will be an overview of Maryellen Ruvolo s work on studying modern human origins using
DNA, A Genealogy Tool. The Search for an Expert Genealogist, Photos & Clues
DNA, A Genealogy Tool The Search for an Expert Genealogist, Photos & Clues mydanishancestors.com *Slide Show shared in this class & more web-sites under Toolbar/DNA *One doesn t have to have Danish ancestors
An Introduction to Genetic Genealogy
An Introduction to Genetic Genealogy David A. Pike dapike@math.mun.ca Presented To: Family History Society of Newfoundland and Labrador 24 January 2006 Slide 1 of 21 Overview Genetic Genealogy using genetic
Genetic Identity and
Genetic Identity and GACATGTAGCTCTTCACTTCACCCAGGTTGGGTTGTGTCAACAGGAAACATTGTAACATATCACTTGGATTAGCACCTAGG/TTAT/TTAT/TTA Community DTC Genetic Testing Workshop The National Academies' August 31 September 1,
Simulated gene genealogy of a sample of size 50 from a population of constant size. The History of Population Size from Whole Genomes.
Simulated gene genealogy of a sample of size 50 from a population of constant size The History of Population Size from Whole Genomes Alan R Rogers October 1, 2018 Short terminal branches; long basal ones
Mitochondrial Eve and Y-chromosome Adam: Who do your genes come from?
Mitochondrial Eve and Y-chromosome Adam: Who do your genes come from? 28 July 2010. Joe Felsenstein Evening At The Genome Mitochondrial Eve and Y-chromosome Adam: Who do your genes come from? p.1/39 Evolutionary
Big Y-700 White Paper
Big Y-700 White Paper Powering discovery in the field of paternal ancestry Authors: Caleb Davis, Michael Sager, Göran Runfeldt, Elliott Greenspan, Arjan Bormans, Bennett Greenspan, and Connie Bormans Last
GEDmatch Home Page The upper left corner of your home page has Information about you and links to lots of helpful information. Check them out!
USING GEDMATCH Created March 2015 GEDmatch is a free, non-profit site that accepts raw autosomal data files from Ancestry, FTDNA, and 23andme. As such, it provides a large autosomal database that spans
Approaching and Connecting with Your DNA Matches
Approaching and Connecting with Your DNA Matches Shannon Stewart Christmas, MCP throughthetreesblog@gmail.com Understand DNA Tests The four types of DNA and the relevant test companies Segment triangulation
DNA TESTING. This is the testing regime for FamilyTreeDNA. Other SNP tests were ordered from Yseq.
DNA & GENEALOGY DNA TESTING This is the testing regime for FamilyTreeDNA. Other SNP tests were ordered from Yseq. Product Date Batch Family Finder 30-May-14 Completed 569 05-Aug-14 Batched 569 05-Jul-14
An O-F3288 Y DNA Discovery for Patrilineal Descendants of James Revell (Accomack) By Marie A. Rundquist, DNA Project Administrator November 2018
Project Scope Rundquist O-F3288 White Paper 11/2018 An O-F3288 Y DNA Discovery for Patrilineal Descendants of James Revell (Accomack) By Marie A. Rundquist, DNA Project Administrator November 2018 The
Understanding Third Party DNA Analysis Tools. Copyright 2014 James R. Lannin, Jr. aka Jimmy Chromosomes
Understanding Third Party DNA Analysis Tools Copyright 2014 James R. Lannin, Jr. aka Jimmy Chromosomes A Review of the Basics You have 46 chromosomes and they come to you in 23 pairs from your mother and
Use of DNA information in family research information for IOWFHS members
Use of DNA information in family research information for IOWFHS members What is DNA? Since the discovery of deoxyribonucleic acid (DNA) in the 1950s, we have come to understand more about its role as
DNA study deals blow to theory of European origins
23 August 2011 Last updated at 23:15 GMT DNA study deals blow to theory of European origins By Paul Rincon Science editor, BBC News website Did Palaeolithic hunters leave a genetic legacy in today's European
Table of Contents. Introduction DNA Basics DNA Origins: How it works Concepts of Race BioGeographical Ancestry...
Table of Contents Introduction... 1 In This Manual Your Results Package DNA Basics... 2 Terms You Will Encounter in this Manual Types of DNA Used in Ancestry Testing DNA Origins: How it works... 4 Concepts
Understanding DNA in Genealogy. Peter Biggins, BY3164 Darien Library, Darien, CT November 18, 2017
Understanding DNA in Genealogy Peter Biggins, BY3164 Darien Library, Darien, CT November 18, 2017 1953: Watson 25, Crick 37, Franklin 33 My BY3164 SNP 1953 paper published on the structure of DNA 1962
Introduction to Autosomal DNA Tools
GENETIC GENEALOGY JOURNEY Debbie Parker Wayne, CG, CGL Introduction to Autosomal DNA Tools Just as in the old joke about a new genealogist walking into the library and asking for the book that covers my
Tracking Your Roots With DNA
Tracking Your Roots With DNA Genetic Genealogy Lisa R Franklin RN,BSN 31 Oct 2013/27 Jun 2014 Andalusia, Alabama Why DNA test? Determine if two people are related Determine if two people descend from the
Primer on Human Pedigree Analysis:
Primer on Human Pedigree Analysis: Criteria for the selection and collection of appropriate Family Reference Samples John V. Planz. Ph.D. UNT Center for Human Identification Successful Missing Person ID
DNA SEGMENT SHARING in DESCENDANTS of ADAM YOUNG ( ) and CATHARINE E. SCHREMLING ( ) David K. Faux
DNA SEGMENT SHARING in DESCENDANTS of ADAM YOUNG (1717-1790) and CATHARINE E. SCHREMLING (1720-1798) By David K. Faux The following manuscript is an interpretive guide to the data from the autosomal and
Advanced Autosomal DNA Techniques used in Genetic Genealogy
Advanced Autosomal DNA Techniques used in Genetic Genealogy Tim Janzen, MD E-mail: tjanzen@comcast.net Summary of Chromosome Mapping Technique The following are specific instructions on how to map your
Souhrada Family Reunion U.S.A. #36
Souhrada Family Reunion U.S.A. #36 CEDAR FALLS, IOWA AUGUST 11, 2018 THANKS TO DAVE & CHERIE SOUHRADA AND JANEL STEPHENS! NOTE: SOUHRADA REUNION IN THE CZECH REPUBLIC SEPTEMBER 15, 2018 In memory of Leota
NextGen Genealogy: The DNA Connection By David R. Dowell
NextGen Genealogy: The DNA Connection By David R. Dowell NextGen Genealogy: The DNA Connection: Amazon.co.uk: David R - Buy NextGen Genealogy: The DNA Connection by David R. Dowell Ph.D (ISBN: 9781610697279)
Meek DNA Project Group B Ancestral Signature
Meek DNA Project Group B Ancestral Signature The purpose of this paper is to explore the method and logic used by the author in establishing the Y-DNA ancestral signature for The Meek DNA Project Group
Academic Path to a Genetic Genealogy Curriculum
International Journal of Humanities Social Sciences and Education (IJHSSE) Volume 5, Issue 10, October 2018, PP 34-42 ISSN 2349-0373 (Print) & ISSN 2349-0381 (Online) http://dx.doi.org/10.20431/2349-0381.0510004
From Sticky Mucus to Probing our Past: Aspects and problems of the Biotechnological use of Macromolecules
From Sticky Mucus to Probing our Past: Aspects and problems of the Biotechnological use of Macromolecules DNA natures most important glycoconjugate DNA natures most important glycoconjugate High molecular
The Jewish Genealogical Society of Great Britain
Edition No. 1-04/2007 (currently under revision) Reformatted and reissued 01/2010 Written by Jill L. Whitehead, M.A. Issued for JGSGB by JGSGB Education & Mentoring JGSGB 33 Seymour Place London W1H 5AP
Genealogy: DNA And The Family Tree By James Mayflower READ ONLINE
Genealogy: DNA And The Family Tree By James Mayflower READ ONLINE CeCe Moore's "DNA Testing for Genealogy - Getting Started" series is a Family Tree DNA is currently the only commercial laboratory offering
Genealogy Report of Alejandro Lorenzetti Tarabelli
Genealogy Report of Alejandro Lorenzetti Tarabelli My name is Donald Martin Mattos Lorenzetti, Mattos is my paternal surname, and Lorenzetti my maternal surname. For years my maternal family and I have
Genetic Genealogy Resources
Genetic Genealogy Resources ISOGG International Society of Genetic Genealogists ISOGG was formed in 2003 by a group of surname administrators after the first International DNA Conference in Houston. Membership
Eller DNA Project. Status Report for Nashville EFA Conference----July 25, Tom Eller, DNA Project Administrator
Eller DNA Project Status Report for Nashville EFA Conference----July 25, 2009 Tom Eller, DNA Project Administrator Eller DNA Project This presentation used material from Family Tree DNA and from World
Genealogical trees, coalescent theory, and the analysis of genetic polymorphisms
Genealogical trees, coalescent theory, and the analysis of genetic polymorphisms Magnus Nordborg University of Southern California The importance of history Genetic polymorphism data represent the outcome
Entire Chromosome 21 Inherited from 5 th Great Grandparents Captain Daniel and Elizabeth (Windecker) Young
Entire Chromosome 21 Inherited from 5 th Great Grandparents Captain Daniel and Elizabeth (Windecker) Young The Ancestors: Daniel Young was born about 1755 in the Canajoharie District of the Mohawk Valley
Genetic Evidence Relative to the Native American Ancestry of Catharine, the Wife of Lt. John Young ( )
Genetic Evidence Relative to the Native American Ancestry of Catharine, the Wife of Lt. John Young (1742-1812) By David K. Faux While the present author has created a 50 plus page document outlining all
DNA CHARLOTTE COUNTY GENEALOGICAL SOCIETY - MARCH 30, 2013 WALL STREET JOURNAL ARTICLE
DNA CHARLOTTE COUNTY GENEALOGICAL SOCIETY - MARCH 30, 2013 WALL STREET JOURNAL ARTICLE NATIONAL GEOGRAPHIC GENOGRAPHIC PROJECT ABOUT NEWS RESULTS BUY THE KIT RESOURCES Geno 2.0 - Genographic Project
Growing the Family Tree: The Power of DNA in Reconstructing Family Relationships
Growing the Family Tree: The Power of DNA in Reconstructing Family Relationships Luke A. D. Hutchison Natalie M. Myres Scott R. Woodward Sorenson Molecular Genealogy Foundation (www.smgf.org) 2511 South
Genetic genealogy and my ancestral background
Genetic genealogy and my ancestral background Edward Gelles In recent years DNA tests have become an important part of genealogical research. The commercial availability of these tests, the increase in
Steve Harding, *Turi King and *Mark Jobling Universities of Nottingham & *Leicester, UK
Viking DNA Steve Harding, *Turi King and *Mark Jobling Universities of Nottingham & *Leicester, UK Viking DNA in Northern England Project Part 1 - Wirral and West Lancashire (2002-2007) Part 2 - North
Coalescents. Joe Felsenstein. GENOME 453, Autumn Coalescents p.1/48
Coalescents p.1/48 Coalescents Joe Felsenstein GENOME 453, Autumn 2015 Coalescents p.2/48 Cann, Stoneking, and Wilson Becky Cann Mark Stoneking the late Allan Wilson Cann, R. L., M. Stoneking, and A. C.