Free Online Training
|
|
- Louisa Riley
- 6 years ago
- Views:
Transcription
1 Using DNA and CODIS to Resolve Missing and Unidentified Person Cases B.J. Spamer NamUs Training and Analysis Division Office: Cell: Free Online Training Click Online Training 1
2 DNA Profiles Used in MP and UP Cases Three types of profiles used in missing and unidentified person investigations: STR Profiles Short Tandem Repeats Also commonly referred to as Nuclear DNA profiles Y-STR Profiles Y-Chromosome Short Tandem Repeats Mitochondrial (mtdna) Profiles Short Tandem Repeat (STR) Profiles STR profiles (also called NUCLEAR DNA PROFILES) are passed down to a child by both the mother and father 50% from each parent. Mother Father Daughter Son 2
3 Short Tandem Repeat (STR) Profiles STR profiles (also called NUCLEAR DNA PROFILES) are passed down to a child by both the mother and father 50% from each parent. Mother Father Daughter Son Short Tandem Repeat (STR) Profiles STR profiles (also called NUCLEAR DNA PROFILES) are passed down to a child by both the mother and father 50% from each parent. Mother Father Daughter Son 3
4 Short Tandem Repeat (STR) Profiles 13 specific STR loci serve as the standard for CODIS, to ensure uniformity and the ability to share DNA information between laboratories. Advantages of STR Profiles Most discriminating of the three DNA profiles The likelihood of two individuals (except identical twins) having the same 13-loci DNA profile can be 1 in 1 billion or higher. Most comparisons between convicted offender/arrestee profiles and suspect profiles from crime scenes are performed with STR profiles 4
5 Disadvantages of STR Profiles Particularly in degraded and/or skeletal remains cases, complete or even partial STR profiles may no longer be obtainable. This may severely limit CODIS searching. Closely related family references (mother, father, sister) may not be available for missing persons the more distant a relative, the less useful their STR profile is for comparisons. For Example: Juvenile missing in the 1980 s. Skeletal remains were found in the 1990 s but were not identified as the missing juvenile. DNA was collected from one sibling and an STR profile only was uploaded to CODIS in the early 2000 s. No associations were made, despite the fact that both the MP and UP were represented in CODIS with STR profiles. When an additional family reference sample was profiled and uploaded to CODIS, the association was made. 5
6 How Does That Happen? 11, 17 12, 14 Mother Father 11, 12 11, 14 17, 12 17, 14 Daughter Son 11, 12 11, 14 17, 12 17, 14 How Does That Happen? 11, 17 12, 14 Mother Father 11, 12 11, 14 17, 12 17, 14 Daughter Son 11, 12 11, 14 17, 12 17, 14 6
7 Y-Chromosome (Y-STR) Profiles Y-STR profiles are passed only to a MALE child and only by the FATHER. Mother Father Daughter Son Y-Chromosome (Y-STR) Profiles All males sharing the same paternal lineage will share the same Y-STR profile. Missing Person 7
8 Disadvantages: Y-STR Profiles Not unique to an individual Only applicable to missing/unidentified males May not be obtainable in decomposed/skeletal remains cases Advantages: Distant paternal relatives can provide a Y-STR profile for comparison purposes when close relatives are not available for STRs and/or a maternal relative is not available for mitochondrial DNA. Mitochondrial DNA (mtdna) mtdna profiles are passed to MALE and FEMALE children, but only from the MOTHER. Mother Father Daughter Son 8
9 Mitochondrial (mtdna) Profiles All females sharing the same maternal lineage will share the same mtdna profile. All males from the same mother will also share the same mtdna profile. Missing Person The Importance of mtdna mtdna is more resilient to degradation Skeletal remains may no longer yield a full STR or Y-STR profile, but still yield a mtdna profile If we can only develop a mtdna profile for skeletal remains and there is no mtdna profile available for the missing person, we can never make an association between the two cases 9
10 Mitochondrial (mtdna) Profiles Disadvantages: Not unique to an individual associations will not report out of CODIS unless they meet a certain probability threshold. Advantages: More resilient to degradation. Distant maternal relatives can provide a mtdna profile for comparison purposes when close relates are not available for STRs and/or Y- STRs are not applicable. CODIS Mito Laboratories MN Bureau of Criminal Apprehension Connecticut State Police Lab New York Office of the Chief ME California Dept of Justice Arizona Dept. of Public Safety New Jersey State Police Lab FBI Virginia Dept. of Forensic Sciences UNT Center for Human ID 10
11 From Whom To Collect DNA Samples You must collect AT LEAST TWO family reference samples for proper CODIS searching to take place: Mother Father Offspring of Missing Person Collect second parent to exclude their STR profile Full Sibling Half Sibling Consider grandparents, aunts, uncles, etc. for Y- STRs and mtdna profiles if closer blood relatives are not available Family Reference Collection Kits Kits can be ordered through the NamUs DNA screen or from:
12 Family Reference Collection Kits Chain of custody form Consent form Donor Relationship Fax Back form Latex gloves Buccal swab collectors Return envelope These materials ensure proper documentation, collection, and chain of custody on each collected sample Direct References Direct reference samples for the Missing Person will have added value in CODIS searches: Blood/tissue samples from prior medical procedures Toothbrush used prior to disappearance Guthrie cards (also known as PKU cards) Articles of unlaundered clothing worn prior to disappearance Baby teeth Only if parent is certain tooth belongs to MP and not a sibling These samples may not yield profiles due to open root Do NOT collect cut hair unless no other mtdna donor exists cut hair will yield only a mtdna profile 12
13 DNA Index System Terminology CODIS CODIS is an acronym that stands for Combined DNA Index System. CODIS is the software that compares DNA profiles and is the backbone of the DNA Index System. Index : CODIS is a system of pointers, which point back to the originating agency; the system does not contain names or other case-related information, only the information necessary to make associations and notify agencies:» Specimen identifier» Laboratory s identifier» The actual DNA characteristics (profiles) DNA Index System Three Levels to the DNA Index System: National DNA Index System (NDIS) State DNA Index System (SDIS) Local DNA Index System (LDIS) NDIS FBI SDIS Texas Dept. of Public Safety Headquarters Laboratory LDIS UNT Center for Human Identification 13
14 DNA Index System NDIS SDIS Ohio Bureau of Criminal Investigation SDIS California DOJ - Richmond Jan Bashinski DNA Lab LDIS Miami Valley Regional Crime Lab LDIS Cuyahoga County Coroner s Office LDIS Los Angeles Regional Crime Lab LDIS San Bernardino County S.O. Degraded Samples Degraded DNA Samples (e.g., Low Copy Number) Samples may be degraded to the point where traditional techniques do not yield a DNA profile Low Copy Number (LCN) samples can be amplified a greater number of times to produce an STR profile where none could be obtained before Profiles developed using these techniques are not yet accepted into the National DNA Index System (NDIS) - only into the local and state systems, meaning NATIONAL searches will not take place 14
15 DNA Index System LCN STR Profile for UP X SDIS Texas Dept. of Public Safety Headquarters Laboratory NDIS STR Profile for MP SDIS California DOJ - Richmond Jan Bashinski DNA Lab LDIS UNT Center for Human Identification LDIS Dallas Police Department LDIS Los Angeles Regional Crime Lab LDIS San Bernardino County S.O. Partial STR profiles ARE searched at the national level of CODIS (NDIS) HOWEVER: Degraded Samples CODIS hits are dependent upon statistical probabilities of an association, so even if your partial profile is being searched at NDIS, you may not receive a CODIS hit. 15
16 The NamUs DNA Screen Complete mitochondrial DNA profile uploaded to NDIS along with marginal STR profile (4/13). Nearly complete LOW COPY STR profile (10/13) available at UNT for comparison. DNA Index System Most Commonly Used Indexes Within Each Level of CODIS: Convicted Offender Index Arrestee Index Forensic Unknown Index Missing Person Index Family Reference Index Unidentified Human Index NDIS SDIS LDIS 16
17 Family Reference Samples Reference samples provided by family members of missing persons can only be searched against the unidentified human index. Missing Person Index Family Reference Index X X X Convicted Offender Index Arrestee Index Forensic Index Unidentified Human Index Direct Reference Samples Direct reference samples for missing persons are entered into the Missing Person Index and can be searched against ALL other indexes (unidentified humans, offender profiles, and forensic unknown profiles). Missing Person Index Family Reference Index Convicted Offender Index Arrestee Index Forensic Index Unidentified Human Index 17
18 Take-Home Points Collect DNA samples from two or more family members of each missing person. The more closely related the donor, the more useful the STR profiles will be for comparisons. Make sure profiles are developed using two or more DNA technologies for every missing person case (STR + mtdna) Know when your cases have incomplete profiles to be cognizant of NDIS search issues and to know when a potential match from an investigative lead might require a manual DNA comparison. Direct references enable more comprehensive CODIS searching against offender and suspect profiles. DNA Statistics From NamUs Missing Person Cases: Complete and Uploaded to CODIS: 4,973 DNA Submitted, Pending Completion: 599 DNA Available, Not Yet Submitted: 366 Unidentified Person Cases: Complete and Uploaded to CODIS: 4,426 DNA Submitted, Pending Completion: 706 DNA Available, Not Yet Submitted: 682 No profile obtained:
19 Why Be Proactive? Missing person last seen in the 1990 s Removed from NCIC shortly after initial disappearance DNA collected from family and uploaded to CODIS after the NCIC entry was cancelled because subject was still missing law enforcement declined to make a new NCIC entry No DNA associations were made No NamUs entry was made Why Be Proactive? Unidentified remains were found in the same state where the missing person was last seen, in the same year the subject was last seen date of last contact for MP was incorrect in NCIC. No NCIC entry was made on the UP case NamUs entry was made in the late 2000 s but no DNA was processed NamUs entry prompted tip that led to DNA processing and identification over 10 years after the body had been recovered 19
20 Contact Information B.J. Spamer Director, Training and Analysis Division UNT Health Science Center Office: BJ.Spamer@unthsc.edu
1/8/2013. Free Online Training. Using DNA and CODIS to Resolve Missing and Unidentified Person Cases. Click Online Training
Free Online Training Using DNA and CODIS to Resolve Missing and Unidentified Person Cases B.J. Spamer NamUs Training and Analysis Division Office: 817-735-5473 Cell: 817-964-1879 Email: BJ.Spamer@unthsc.edu
More informationPrimer on Human Pedigree Analysis:
Primer on Human Pedigree Analysis: Criteria for the selection and collection of appropriate Family Reference Samples John V. Planz. Ph.D. UNT Center for Human Identification Successful Missing Person ID
More informationFind JCD Project Date: Identification-DNA Process Updated:
New Look Investigations Created by: Jack Friess Find JCD Project Date: 04-20-2018 Identification-DNA Process Updated: 05-24-2018 Questions and Answers Identification-DNA (ID-DNA) is a scientific process
More informationNon-Paternity: Implications and Resolution
Non-Paternity: Implications and Resolution Michelle Beckwith PTC Labs 2006 AABB HITA Meeting October 8, 2006 Considerations when identifying victims using relatives Identification requires knowledge of
More informationLarge scale kinship:familial Searching and DVI. Seoul, ISFG workshop
Large scale kinship:familial Searching and DVI Seoul, ISFG workshop 29 August 2017 Large scale kinship Familial Searching: search for a relative of an unidentified offender whose profile is available in
More informationYour mtdna Full Sequence Results
Congratulations! You are one of the first to have your entire mitochondrial DNA (DNA) sequenced! Testing the full sequence has already become the standard practice used by researchers studying the DNA,
More informationFinally, should you have any questions, queries or issues with regard to the service our company provides, us at
Dear Sir / Madam, To complete the enclosed registration form, please follow the procedure below: 1. Choose a sampler. To comply with current legislation, samples must be taken by a medically qualified
More information50/50. Accreditations 4/13/2016 A B A B A B. Mother. Father. Child. Everything you ever wanted to know about DNA collections and MORE!
Everything you ever wanted to know about DNA collections and MORE! Presented by: Kim Levaggi Accreditations 1 50/50 Half of your DNA comes from your mother Half of your DNA comes from your father Mother
More information4/13/2016. Everything you ever wanted to know about DNA collections and MORE! Presented by: Kim Levaggi
Everything you ever wanted to know about DNA collections and MORE! Presented by: Kim Levaggi 1 Accreditations 1 2 50/50 Half of your DNA comes from your mother Half of your DNA comes from your father Mother
More informationICMP DNA REPORTS GUIDE
ICMP DNA REPORTS GUIDE Distribution: General Sarajevo, 16 th December 2010 GUIDE TO ICMP DNA REPORTS 1. Purpose of This Document 1. The International Commission on Missing Persons (ICMP) endeavors to secure
More informationDNA (DeoxyriboNucleic Acid)
Basics of DNA & Sales and Marketing Presented by: Kim Levaggi of Chromosomal Labs DNA (DeoxyriboNucleic Acid) DNA a very long molecule that is essentially the instruction manual to cells and organisms.
More informationThe Mismatch Between Probable Cause and Partial Matching
natalie ram The Mismatch Between Probable Cause and Partial Matching In mid-december, as one of the outgoing Bush Administration s last minute regulations, the Department of Justice radically expanded
More informationBasics of DNA & Sales and Marketing
Basics of DNA & Sales and Marketing Presented by: Kim Levaggi of Chromosomal Labs 1 DNA (DeoxyriboNucleic Acid) DNA a very long molecule that is essentially the instruction manual to cells and organisms.
More informationDNA PATERNITY TESTING YOUR QUESTIONS ANSWERED. Need some advice on testing? Call us free on:
DNA PATERNITY TESTING YOUR QUESTIONS ANSWERED Need some advice on testing? Call us free on: 0800 036 2522 Introduction Since 1987 Cellmark has conducted over half a million DNA relationship tests and is
More informationTHE BASICS OF DNA TESTING. By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library
THE BASICS OF DNA TESTING By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library TYPES OF TESTS Mitochondrial DNA (mtdna/mdna) Y-DNA Autosomal DNA (atdna/audna) MITOCHONDRIAL DNA Found
More informationDNA Basics. OLLI: Genealogy 101 October 1, ~ Monique E. Rivera ~
DNA Basics OLLI: Genealogy 101 October 1, 2018 ~ Monique E. Rivera ~ WHAT IS DNA? DNA (deoxyribonucleic acid) is found in every living cell everywhere. It is a long chemical chain that tells our cells
More informationDAR POLICY STATEMENT AND BACKGROUND Using DNA Evidence for DAR Applications
Effective January 1, 2014, DAR will begin accepting Y-DNA evidence in support of new member applications and supplemental applications as one element in a structured analysis. This analysis will use a
More informationDNA Testing What you need to know first
DNA Testing What you need to know first This article is like the Cliff Notes version of several genetic genealogy classes. It is a basic general primer. The general areas include Project support DNA test
More informationHalley Family. Mystery? Mystery? Can you solve a. Can you help solve a
Can you solve a Can you help solve a Halley Halley Family Family Mystery? Mystery? Who was the great grandfather of John Bennett Halley? He lived in Maryland around 1797 and might have been born there.
More informationDNA: Statistical Guidelines
Frequency calculations for STR analysis When a probative association between an evidence profile and a reference profile is made, a frequency estimate is calculated to give weight to the association. Frequency
More informationIntroduction to Autosomal DNA Tools
GENETIC GENEALOGY JOURNEY Debbie Parker Wayne, CG, CGL Introduction to Autosomal DNA Tools Just as in the old joke about a new genealogist walking into the library and asking for the book that covers my
More informationhave to get on the phone or family members for the names of more distant relatives.
Ideas for Teachers: Give each student the family tree worksheet to fill out at home. Explain to them that each family is different and this worksheet is meant to help them plan their family tree. They
More informationFinding a Male Hodge(s) Descendant for Y-Chromosome DNA Testing. Prepared by Jan Alpert
Finding a Male Hodge(s) Descendant for Y-Chromosome DNA Testing Prepared by Jan Alpert Why Test Male Y-Chromosome DNA All males carry the Y-Chromosome of their fathers As a result the same DNA markers
More informationDNA Opening Doors for Today s s Genealogist
DNA Opening Doors for Today s s Genealogist Presented to JGSI Sunday, March 30, 2008 Presented by Alvin Holtzman Genetic Genealogy Discussion Points What is DNA How can it help genealogists What to expect
More informationPopstats Parentage Statistics Strength of Genetic Evidence In Parentage Testing
Popstats Parentage Statistics Strength of Genetic Evidence In Parentage Testing Arthur J. Eisenberg, Ph.D. Director DNA Identity Laboratory UNT-Health Science Center eisenber@hsc.unt.edu PATERNITY TESTING
More informationPizza and Who do you think you are?
Pizza and Who do you think you are? an overview of one of the newest and possibly more helpful developments in researching genealogy and family history that of using DNA for research What is DNA? Part
More informationDNA Parentage Test No Summary Report
Collaborative Testing Services, Inc FORENSIC TESTING PROGRAM DNA Parentage Test No. 16-5870 Summary Report This proficiency test was sent to 27 participants. Each participant received a sample pack consisting
More informationAn Introduction. Your DNA. and Your Family Tree. (Mitochondrial DNA) Presentation by: 4/8/17 Page 1 of 10
An Introduction Your DNA and Your Family Tree (Mitochondrial DNA) Presentation by: FredCoffey@aol.com 4/8/17 Page 1 of 10 Coffey Surname, y-dna Project We're now ready to move on and look at the type of
More informationDNA Testing. February 16, 2018
DNA Testing February 16, 2018 What Is DNA? Double helix ladder structure where the rungs are molecules called nucleotides or bases. DNA contains only four of these nucleotides A, G, C, T The sequence that
More informationUsing X-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM
Using X-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.
More informationDNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding
DNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding by Dr. Ing. Robert L. Baber 2014 July 26 Rights reserved, see the copyright notice at http://gengen.rlbaber.de
More informationAFDAA 2012 WINTER MEETING Population Statistics Refresher Course - Lecture 3: Statistics of Kinship Analysis
AFDAA 2012 WINTER MEETING Population Statistics Refresher Course - Lecture 3: Statistics of Kinship Analysis Ranajit Chakraborty, PhD Center for Computational Genomics Institute of Applied Genetics Department
More informationPositive paternity test results letter
Buscar... Positive paternity test results letter Sequenom (NASDAQ: SQNM) is an American company based in San Diego, California. It develops enabling molecular technologies, and highly sensitive laboratory
More informationTRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter
TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter 1-1: DNA: WHERE DO I START? Definition Genetic genealogy is the application of genetics to traditional genealogy. Genetic genealogy uses genealogical
More informationDNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016
DNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016 1 What we will cover How testing helps genealogy What is DNA? How do you select from the three testing companies?
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1122655/dc1 Supporting Online Material for Finding Criminals Through DNA of Their Relatives Frederick R. Bieber,* Charles H. Brenner, David Lazer *Author for correspondence.
More information1) Using the sightings data, determine who moved from one area to another and fill this data in on the data sheet.
Parentage and Geography 5. The Life of Lulu the Lioness: A Heroine s Story Name: Objective Using genotypes from many individuals, determine maternity, paternity, and relatedness among a group of lions.
More informationChromosome X haplotyping in deficiency paternity testing principles and case report
International Congress Series 1239 (2003) 815 820 Chromosome X haplotyping in deficiency paternity testing principles and case report R. Szibor a, *, I. Plate a, J. Edelmann b, S. Hering c, E. Kuhlisch
More informationUnit 2: THE CRIME SCENE
Unit 2: THE CRIME SCENE Oh, how simple it would all have been had I been here before they came like a herd of buffalo and wallowed all over it. A. Conan Doyle, in The Boscombe Valley Mystery, 1892 CORPUS
More informationWalter Steets Houston Genealogical Forum DNA Interest Group April 7, 2018
Ancestry DNA and GEDmatch Walter Steets Houston Genealogical Forum DNA Interest Group April 7, 2018 Today s agenda Recent News about DNA Testing DNA Cautions: DNA Data Used for Forensic Purposes New Technology:
More informationEwing Surname Y-DNA Project Article 8
Ewing Surname Y-DNA Project Article 8 This is the eighth in a series of articles about the Ewing Surname Y-DNA Project. The previous seven articles have appeared in the last seven issues of the Journal
More informationDNA for Genealogy Librarians. Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District
DNA for Genealogy Librarians Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District What does DNA do? It replicates itself. It codes for the production
More informationAutosomal DNA. What is autosomal DNA? X-DNA
ANGIE BUSH AND PAUL WOODBURY info@thednadetectives.com November 1, 2014 Autosomal DNA What is autosomal DNA? Autosomal DNA consists of all nuclear DNA except for the X and Y sex chromosomes. There are
More informationUsing Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM
Using Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.
More informationSan Joaquin County First Families Certificate Program
San Joaquin County First Families Certificate Program The San Joaquin Genealogical Society and The San Joaquin County Historical Society have partnered to offer the First Families of San Joaquin County
More informationMix & match: Getting comfortable with DNA reporting. Elmira, New York. Cybergenetics People of New York v Casey Wilson
Mix & match: Getting comfortable with DNA reporting What s in a Match? How to read a forensic DNA report Duquesne University October, 2015 Pittsburgh, PA Mark W Perlin, PhD, MD, PhD Cybergenetics, Pittsburgh,
More information4 / GENERAL. Processing minor crime scenes - Patrol Officer:
Laurel Police Department General Order Section 4/700 Criminal Investigation 4 / 705 Collection / Preservation of Evidence 8/25/98 Rev 3/08/09 Accreditation Standards 1.2.4/43.1.4/61.2.3/83.1.1/83.2.1/83.2.2/
More informationPrincess Margaret Cancer Centre Familial Breast and Ovarian Cancer Clinic. Family History Questionnaire
Princess Margaret Cancer Centre Familial Breast and Ovarian Cancer Clinic Family History Questionnaire How to complete this questionnaire The information in this questionnaire will be used to determine
More informationForensic Photographer II
HARRIS COUNTY Human Resource & Risk Management Houston, TX 77002 https://agency.governmentjobs.com//harriscountytx/default.cfm invites applications for the position of: Forensic Photographer II An Equal
More informationDNA Parentage Test No Summary Report
Collaborative Testing Services, Inc FORENSIC TESTING PROGRAM DNA Parentage Test No. 165871 Summary Report This proficiency test was sent to 45 participants. Each participant received a sample pack consisting
More informationWalter Steets Houston Genealogical Forum DNA Interest Group May 5, 2018
GEDmatch: The Golden State Killer Tier 1 Tools Walter Steets Houston Genealogical Forum DNA Interest Group May 5, 2018 1 Today s agenda Walter s Take on DNA Developments Growth in Number of DNA Testers
More informationGenealogical Research
DNA, Ancestry, and Your Genealogical Research Walter Steets Houston Genealogical Forum DNA Interest Group March 2, 2019 1 Today s Agenda Brief review of basic genetics and terms used in genetic genealogy
More informationPuzzling Pedigrees. Essential Question: How can pedigrees be used to study the inheritance of human traits?
Name: Puzzling Pedigrees Essential Question: How can pedigrees be used to study the inheritance of human traits? Studying inheritance in humans is more difficult than studying inheritance in fruit flies
More informationFAMILY HISTORY QUESTIONNAIRE
FAMILY HISTORY QUESTIONNAIRE This form helps us to evaluate if you might have a higher risk of cancer because of your family history. Please complete this form to the best of your ability. If you are unsure
More information[CLIENT] SmithDNA1701 DE January 2017
[CLIENT] SmithDNA1701 DE1704205 11 January 2017 DNA Discovery Plan GOAL Create a research plan to determine how the client s DNA results relate to his family tree as currently constructed. The client s
More informationKINSHIP ANALYSIS AND HUMAN IDENTIFICATION IN MASS DISASTERS: THE USE OF MDKAP FOR THE WORLD TRADE CENTER TRAGEDY
1 KINSHIP ANALYSIS AND HUMAN IDENTIFICATION IN MASS DISASTERS: THE USE OF MDKAP FOR THE WORLD TRADE CENTER TRAGEDY Benoît Leclair 1, Steve Niezgoda 2, George R. Carmody 3 and Robert C. Shaler 4 1 Myriad
More informationWhat Can I Learn From DNA Testing?
What Can I Learn From DNA Testing? From where did my ancestors migrate? What is my DNA Signature? Was my ancestor a Jewish Cohanim Priest? Was my great great grandmother really an Indian Princes? I was
More informationDNA SPECIMEN COLLECTION PROCEDURE
PATERNITY TESTING CORPORATION DNA SPECIMEN COLLECTION PROCEDURE Legal Private Case CAUTION: If an individual appearing for specimen collection is one of your friends or relatives, please call PTC before
More informationPlease complete the information in this packet and return it PRIOR to your appointment with the Familial Cancer Risk Assessment Center.
Please complete the information in this packet and return it PRIOR to your appointment with the Familial Risk Assessment Center. The information gathered from these questionnaires will be used to assess
More informationDetermining Relatedness from a Pedigree Diagram
Kin structure & relatedness Francis L. W. Ratnieks Aims & Objectives Aims 1. To show how to determine regression relatedness among individuals using a pedigree diagram. Social Insects: C1139 2. To show
More informationDNA SPECIMEN COLLECTION PROCEDURE
PATERNITY TESTING CORPORATION DNA SPECIMEN COLLECTION PROCEDURE Legal Private Case (Prenatal Paternity Amnio) CAUTION: If an individual appearing for specimen collection is one of your friends or relatives,
More informationA Day Out With Your DNA
A Day Out With Your DNA Diahan Southard www.yourdnaguide.com Your testing company has evaluated around 800,000 locations on your DNA to help them determine your origins and your genetic cousins. While
More informationAPPLICATION FOR ENROLLMENT
CTGR-9615 Grand Ronde Rd.; Grand Ronde OR 97347 1-800-422-0232 ext.2253 APPLICATION FOR ENROLLMENT Name: First Middle Last Maiden Gender Female. Male Date of Birth Social security Number Address: Mailing
More informationFairfield Public Schools Science Curriculum. Draft Forensics I: Never Gone Without a Trace Forensics II: You Can t Fake the Prints.
Fairfield Public Schools Science Curriculum Draft Forensics I: Never Gone Without a Trace Forensics II: You Can t Fake the Prints March 12, 2018 Forensics I and Forensics II: Description Forensics I: Never
More informationVIP Personal Information
Page of 8 If FemaleMaiden DOB Race Social Security # Birth City StateCountry Birth Hospital MM DD YYYY Address Apt # City State Zip County Country Inside City Limits Religious Preference Education: level
More informationDeveloping Conclusions About Different Modes of Inheritance
Pedigree Analysis Introduction A pedigree is a diagram of family relationships that uses symbols to represent people and lines to represent genetic relationships. These diagrams make it easier to visualize
More informationAn O-F3288 Y DNA Discovery for Patrilineal Descendants of James Revell (Accomack) By Marie A. Rundquist, DNA Project Administrator November 2018
Project Scope Rundquist O-F3288 White Paper 11/2018 An O-F3288 Y DNA Discovery for Patrilineal Descendants of James Revell (Accomack) By Marie A. Rundquist, DNA Project Administrator November 2018 The
More informationStatistical Interpretation in Making DNA-based Identification of Mass Victims
Statistical Interretation in Making DNAbased Identification of Mass Victims KyoungJin Shin wan Young Lee Woo Ick Yang Eunho a Det. of Forensic Medicine Yonsei University College of Medicine Det. of Information
More informationDigital Forensics Lecture 11. Evidence, Reporting, and Action
Digital Forensics Lecture 11 Evidence, Reporting, and Action This Week s Presentations Certifications Risk Analysis Normal (non-it) Parents Keeping Their Children Safe and Happy Encase Sleuth Kit Next
More informationUsing Mitochondrial DNA (mtdna) for Genealogy Debbie Parker Wayne, CG, CGL SM
Using Mitochondrial DNA (mtdna) for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical
More informationCDIB/Membership Card FAQ and Instructions
CDIB/Membership Card FAQ and Instructions WHAT IS THE CDIB/MEMBERSHIP CARD? The CDIB/Membership is a new card that combines the Certificate of Degree of Indian Blood (CDIB), Membership, and Photo ID (if
More informationUsing Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM
Using Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.
More informationFirst Results: Intro to FamilyTreeDNA s Family Finder. Learn what to do with results of autosomal DNA testing with FamilyTreeDNA (FTDNA).
First Results: Family Tree DNA When You First Get Your FamilyTreeDNA (FTDNA) Results Objective: Learn what to do with results of autosomal DNA testing with FamilyTreeDNA (FTDNA). Tools: familytreedna.com
More information2. The most common tool for collecting evidence is/are: a. tweezers. b. computers. c. Q-Tips. d. tape. Day 1
Day 1 1. Which of the items below is NOT evidence? a. A scrap of clothing b. Mud from a footprint c. A fingerprint d. The investigator s birthplace 2. The term Forensic has to do with a(n): a. shoelace.
More informationHFSC Creates Group Dedicated to Lean Six Sigma, Leadership Building
HOUSTON FORENSIC SCIENCE CENTER. JANUARY 2018 INSIDE THIS EDITION HFSC Creates Group Dedicated to Lean Six Sigma, Leadership Building 2 4 5 6 Dr. Peter Stout addresses the importance of a new LIMS HFSC
More informationVital Statistics Registration Act
Issuer: Riigikogu Type: act In force from: 29.12.2012 In force until: 31.12.2013 Translation published: 30.10.2013 Amended by the following acts Passed 20.05.2009 RT I 2009, 30, 177 Entry into force 01.07.2010,
More informationYour Family 101 Beginning Genealogical Research
Your Family 101 Beginning Genealogical Research What Will We Cover Today? Session 1: Getting Started Session 2: Your Resources Session 3: Common Mistakes and Pitfalls Session 4: DNA Testing and Medical
More informationFamily Tree DNA Genetic Genealogy Started Here
Family Tree DNA Genetic Genealogy Started Here With 253,000 samples in our DNA database (the largest of its kind in the world) your genealogical search could become even easier Why Bennett Greenspan founded
More informationDNA Parentage Test No Summary Report
Collaborative Testing Services, Inc FORENSIC TESTING PROGRAM DNA Parentage Test No. 175871 Summary Report This proficiency test was sent to 45 participants. Each participant received a sample pack consisting
More informationEvery human cell (except red blood cells and sperm and eggs) has an. identical set of 23 pairs of chromosomes which carry all the hereditary
Introduction to Genetic Genealogy Every human cell (except red blood cells and sperm and eggs) has an identical set of 23 pairs of chromosomes which carry all the hereditary information that is passed
More informationGetting the Most Out of Your DNA Matches
Helen V. Smith PG Dip Public Health, BMedLabSci, ADCLT, Dip. Fam. Hist. PLCGS 46 Kraft Road, Pallara, Qld, 4110 Email: HVSresearch@DragonGenealogy.com Website: www.dragongenealogy.com Blog: http://www.dragongenealogy.com/blog/
More informationGEDmatch Home Page The upper left corner of your home page has Information about you and links to lots of helpful information. Check them out!
USING GEDMATCH Created March 2015 GEDmatch is a free, non-profit site that accepts raw autosomal data files from Ancestry, FTDNA, and 23andme. As such, it provides a large autosomal database that spans
More informationInternational Forensic Services
International Forensic Services Right People. Delivering Results. Experienced scientists delivering forensic effectiveness, unquestionable integrity, focused customer service and value for money. Strengthening
More information4. Kinship Paper Challenge
4. António Amorim (aamorim@ipatimup.pt) Nádia Pinto (npinto@ipatimup.pt) 4.1 Approach After a woman dies her child claims for a paternity test of the man who is supposed to be his father. The test is carried
More informationThe Meek Family of Allegheny Co., PA Meek Group A Introduction
Meek Group A Introduction In the 1770's a significant number of families named Meek(s) lived in S. W. Pennsylvania and they can be identified in the records of Westmoreland, Allegheny and Washington Counties.
More informationAn Introduction to Genetic Genealogy
An Introduction to Genetic Genealogy David A. Pike dapike@math.mun.ca Presented To: Family History Society of Newfoundland and Labrador 24 January 2006 Slide 1 of 21 Overview Genetic Genealogy using genetic
More informationWINSLOW HERITAGE SOCIETY ~~~~~~~~~~~~~~~~~~
Newsletter, Vol. 2, No. 1 March, 2015 WINSLOW HERITAGE SOCIETY ~~~~~~~~~~~~~~~~~~ In Vol. 1, No. 1 of the Winslow Heritage Society Newsletter, Kathy Myers, Society Governor, a descendant of Kenelm Winslow,
More informationDNA Parentage Test No Summary Report
Collaborative Testing Services, Inc FORENSIC TESTING PROGRAM DNA Parentage Test No. 155872 Summary Report This proficiency test was sent to 38 participants. Each participant received a sample pack consisting
More informationDAN L. VOGEL POB 5862 Edmond, OK
DAN L. VOGEL POB 5862 Edmond, OK 73083-5862 405-282-0704 dvogel1@cox.net EDUCATION Bachelor Degree (Business Administration), Miami University, Oxford, Ohio (1970). Masters Degree (Administration of Justice),
More informationINDIAN RIVER CRIME LABORATORY
03166 INDIAN RIVER CRIME LABORATORY at INDIAN RIVER STATE COLLEGE 4602 KIRBY LOOP ROAD FT. PIERCE, FL 34981 August 2, 2016 The Honorable Sheriff Ken Mascara St. Lucie County Sheriffs Office 4700 W. Midway
More informationCASE STUDY. Montgomery County Sheriff s Office. ADAMS Software Chosen for Managing Photos, Physical Evidence
Montgomery County Sheriff s Office gains efficiency, cost savings with ADAMS Software for managing physical evidence, digital and latent assets CASE STUDY Montgomery County Sheriff s Office Crime laboratories
More informationOHIO STATE UNIVERSITY EXTENSION
Cloverbud Investigators: Career Detectives November Background: When we think of crime scene investigation, we may think of famous fictional characters like Sherlock Holmes, the Hardy Boys, Nancy Drew
More informationSioux Falls Police Department Partnering with the community to serve, protect, and promote quality of life!
Sioux Falls Police Department Partnering with the community to serve, protect, and promote quality of life! Policy: Evidence Preservation Related Policies: Section #: 1200 Evidence Policy #: 1201 Effective:
More informationHOUSTON FORENSIC SCIENCE CENTER
HOUSTON FORENSIC SCIENCE CENTER INSIDE THIS EDITION 4 DNA database is a powerful tool when it is properly resourced 6 Texas works to implement rape kit tracking software 8 HFSC s CSU starts using 3D scanning
More informationUNIVERSITY OF CENTRAL FLORIDA FRONTIERS IN INFORMATION TECHNOLOGY COP 4910 CLASS FINAL REPORT
UNIVERSITY OF CENTRAL FLORIDA FRONTIERS IN INFORMATION TECHNOLOGY COP 4910 CLASS FINAL REPORT Abstract This report brings together the final papers presented by the students in the Frontiers in Information
More informationPedigree Charts. The family tree of genetics
Pedigree Charts The family tree of genetics Pedigree Charts I II III What is a Pedigree? A pedigree is a chart of the genetic history of family over several generations. Scientists or a genetic counselor
More informationGenetic Identity and
Genetic Identity and GACATGTAGCTCTTCACTTCACCCAGGTTGGGTTGTGTCAACAGGAAACATTGTAACATATCACTTGGATTAGCACCTAGG/TTAT/TTAT/TTA Community DTC Genetic Testing Workshop The National Academies' August 31 September 1,
More informationWalter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018
DNA, Ancestry, and Your Genealogical Research- Segments and centimorgans Walter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018 1 Today s agenda Brief review of previous DIG session
More informationLONDONDERRY POLICE DEPARTMENT POLICIES AND PROCEDURES
POLICY NO: S-301-A LONDONDERRY POLICE DEPARTMENT POLICIES AND PROCEDURES DATE OF ISSUE: December 1, 1997 EFFECTIVE DATE: December 1, 1997 REVISED DATE: January 10, 2016 SUBJECT: COLLECTION AND PRESERVATIONOF
More informationVisual Phasing of Chromosome 1
Visual Phasing of Chromosome 1 If you have the possibility to test three full siblings, then the next great thing you could do with your DNA, is to try out the Visual Phasing technique developed by Kathy
More information