Preparation of Sample Hybridization Scanning and Image Analysis
|
|
- Della Webb
- 6 years ago
- Views:
Transcription
1 Preparation of Sample Hybridization Scanning and Image Analysis
2 Sample preparation 1. Design experiment 2. Perform experiment Question? Replicates? Test? mutant wild type 3. Precipitate RNA 4. Label RNA Eukaryote/prokaryote? Cell wall? Amplification? Direct or indirect? Label?
3 Sample Preparation - Check quality of RNA Load ng of RNA on the BioAnalyzer eukaryotic: 28S/18S 2.0 prokaryotic: 23S/16S 2.0
4 Sample preparation AAAAAAAAA TTTTTTTTT RNA cdna aa-dutp Revese Transcriptase (RT) oligo dt primer nucleotides (dntp) amino-allyl-dutp (aa-dutp)
5 Sample preparation AAAAAAAAA TTTTTTTTT RNA cdna Hydrolysis (NaOH and EDTA Æ Tris) Clean-up
6 Sample preparation TTTTTTTTT cdna Coupling (Cy3 or Cy5) Quenching Clean-up
7 Sample preparation TTTTTTTTT TTTTTTTTT Combine Hybridize
8 Hybridization
9 Sample Preparation - Eberwine SAMPLE 42 C 2 h + Reverse Transcriptase RNA ssdna T7 70 C 10 min 16 C 2 h + RNase H + Polymerase T7 pol clean up dsdna 37 C 6 h dsdna arna + Biotin-labeled nucleotides
10 Detection of Biotin (Affymetrix) Streptavidin Phycoerythrim = SAPE ( ) anti-sape IgG biotinylated anti-anti IgG
11 Materials and Methods All protocols can be found here: and here:
12 Scanning and image analysis by H. Bjørn Nielsen Scanning -Dyes -Confocal scanner -CCD scanner Image File Formats Image analysis -Locating the spots -Segmentation -Evaluating data quality
13 Hybridization Probe length
14 Microarray technology Scanning Images Washing
15 Labeling dyes and their properties The two most common fluorochromes used are: Cyanine3 (cy3, exicitation = 554, emission = 568) Cyanine5 (cy5, exicitation = 650, emission = 672) But Alexa dyes are also becoming popular Excitation Emission Flourescence
16 Cyanine Dye spectra excitation and emission Excitation Emission Excitation Emission
17 Alexa Dyes comparison of excitation spectra
18 Confocal scanner diagram
19 The confocal scanner scans the slide
20 CCD scanner detects from an area CCD camera Emission filter White light Beamsplitter Excitation filter
21 Microarray image formats The most common file format is 16bit TIFF. A 16bit TIFF file describe each pixel in an image with an intensity ranging from The image resolution is commonly 10mm [currently, max 5mm] Normally two scans in different wavelengths result in two monochrome files that are overlaid Pseudo-color overlay Cy 3 Channel Cy 5 Channel
22 Image analysis overview Locating the spots Segmentation Density Ensuring good data quality (flagging) Intensity
23 Locating the spot features A grid is laid over the image to aid the program in identifying the individual spots Most programs have some automation in this step.
24 Spot Segmentation Overview Fixed circle Adaptive circle Adaptive shape Histogram method ScanAlyze, GenePix, QuantArray GenePix, Dapple Spot, (a R package) ImaGene, QuantArray DeArray Density Intensity
25 Fixed Circle segmentation Fits a circle with a constant diameter to all spots in the image Easy to implement The spots need to be of the same shape and size
26 Adaptive Circle segmentation The circle diameter is estimated separately for each spot Problematic if spot exhibits non-circular shapes
27 Adaptive Shape segmentation Starts by Specifying a starting points (given by the gridding) Regions grow outwards from the starting point according to the difference between a pixel s value and the running mean of values in an adjoining region.
28 Histogram segmentation Uses a target mask chosen to be larger than any spot Foreground and background intensity are determined from the histogram of pixel values for pixels within the masked area Example : Background : mean between 5th and 20th percentile Foreground : mean between 80th and 95th percentile Density Intensity
29 Background Estimation examples Spot ScanAlyze QuantArray
30 Spot Irregularity examples Some spots may be more uncertain than others. This can be caused by: -Dust grains -Background smear -Strange shaped spot (comet tails, etc.) -Donuts shaped spots -Weak signals
31 Quality Measures examples We can pickup most of these irregularities by these measures - Intensity variability measures - Spot size deviation - Circularity deviation - Relative signal to background intensity - Position deviates from a rectangular grid Based on such measurements, a spot can be rejected
32 Feature Intensity calculation The average or median pixel value in the spot and background masks are calculated.
33 Output Example (ImaGene) Field Meta Row Meta Column Row Column Gene_ID Flag Signal Mean Background Mean A ZY A ZY A ZY A ZY A ZY A ZY A ZY A ZY A ZY A ZY A ZY A ZY A ZY
34 Examples of Difficult Images microarray images
35 Book about hybridization Nucleic Acid Hybridization (Introduction to Biotechniques S.) By: M.L.M. Anderson Paperback 256 pages (December 1998) Publisher: BIOS Scientific Publishers ISBN:
Quality control of microarrays
Quality control of microarrays Solveig Mjelstad Angelskår Intoduction to Microarray technology September 2009 Overview of the presentation 1. Image analysis 2. Quality Control (QC) general concepts 3.
More informationAutomatic gene expression estimation from microarray images. Daniel O. Dantas Adviser: : Junior Barrera
Automatic gene expression estimation from microarray images Daniel O. Dantas Adviser: : Junior Barrera IME-USP Summary Introduction Problem definition Solution strategy Image segmentation Signal estimation
More informationDeveloped by BioDiscovery, Inc. DualChip evaluation software User Manual Version 1.1
Developed by BioDiscovery, Inc. DualChip evaluation software User Manual Version 1.1 1 Table of contents 1. INTRODUCTION...3 2. SCOPE OF DELIVERY...4 3. INSTALLATION PROCEDURES...5 3.1. SYSTEM REQUIREMENTS...
More informationLow-level Analysis. cdna Microarrays. Lecture 2 Low Level Gene Expression Data Analysis. Stat 697K, CS 691K, Microbio 690K
Lecture 2 Low Level Gene Expression Data nalysis Stat 697K, CS 691K, icrobio 690K Statistical Challenges odel variation of data not related to gene expression Compare expression for the same gene across
More informationGenePix Application Note
GenePix Application Note Determining the Signal-to-Noise Ratio and Optimal Photomultiplier gain setting in the GenePix 4000B Siobhan Pickett, M.S., Sean Carriedo, Ph.D. and Chang Wang, Ph.D. Axon Instruments,
More informationScanning and Image Processing -by Steve Clough
Scanning and Image Processing -by Steve Clough cdna microarrays use two dyes with well separated emission spectra such as Cy3 and Cy5 to allow direct comparisons on single slide GSI Lumonics Ratio of Expression
More informationAutomated cdna microarray image segmentation
Automated cdna microarray image segmentation Author Liew, Alan Wee-Chung, Yan, Hong Published 2007 Conference Title Proceedings of the International Symposium on Computational Models for Life Sciences
More informationScanArray Overview. Principle of Operation. Instrument Components
ScanArray Overview The GSI Lumonics ScanArrayÒ Microarray Analysis System is a scanning laser confocal fluorescence microscope that is used to determine the fluorescence intensity of a two-dimensional
More informationMicroarray Image Analysis: Background Estimation using Region and Filtering Techniques
Microarray Image Analysis: Background Estimation using Region and Filtering Techniques Anders Bengtsson December 9, 2003 Abstract This report examines properties of two main methods used for local background
More informationEmbryoCellect. RHS Scanning and Analysis Instructions. for. Genepix Pro Software
EmbryoCellect RHS Scanning and Analysis Instructions for Genepix Pro Software EmbryoCellect Genepix Pro Scanning and Analysis Technical Data Sheet Version 1.0 October 2015 1 Copyright Reproductive Health
More informationMicroarray Data Pre-processing. Ana H. Barragan Lid
Microarray Data Pre-processing Ana H. Barragan Lid Hybridized Microarray Imaged in a microarray scanner Scanner produces fluorescence intensity measurements Intensities correspond to levels of hybridization
More informationComputational Genomics. High-throughput experimental biology
Computational Genomics 10-810/02 810/02-710, Spring 2009 Gene Expression Analysis Data pre-processing processing Eric Xing Lecture 15, March 4, 2009 Reading: class assignment Eric Xing @ CMU, 2005-2009
More informationNPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA
HANDOUT LECTURE-31 MICROARRAY WORK-FLOW: IMAGE SCANNING AND DATA PROCESSING Slide 1: This module contains the summary of the discussion with Mr. Pankaj Khanna, an application specialist from Spinco Biotech,
More informationIn our previous lecture, we understood the vital parameters to be taken into consideration before data acquisition and scanning.
Interactomics: Protein Arrays & Label Free Biosensors Professor Sanjeeva Srivastava MOOC NPTEL Course Indian Institute of Technology Bombay Module 7 Lecture No 34 Software for Image scanning and data processing
More informationProducts - Microarray Scanners - Laser Scanners - InnoScan 900 Series and MAPIX Software
Products - Microarray Scanners - Laser Scanners - InnoScan 900 Series and MAPIX Software Arrayit offers the world s only next generation microarray scanning technology, with proprietary rotary motion control,
More informationInstructions for Mapping * µarray Images using GenePix 5.0
Instructions for Mapping * µarray Images using GenePix 5.0 Preliminary Information Make sure that the GenePix 5.0 software has been installed on your computer and you have the USB hardware dongle that
More informationProduct Information. Introduction
Microarray Scanner Calibration Slide To quantitatively analyze scanners performance and output, adjust and fine-tune scanners, and perform comparative analysis for multiple scanner units. To verify scanners
More informationMayr lab 3'-seq protocol, October 2013
Mayr lab 3'-seq protocol, October 2013 Time line: Day -1: DNase treat your RNA samples (optional) Day 1: Prepare beads, anneal oligo to beads, 1 st, 2 nd strand synthesis Day 2: Introduce nick (Rnase HII),
More informationGenePix Application Note
GenePix Application Note Biological Relevance of GenePix Results Shawn Handran, Ph.D. and Jack Y. Zhai, Ph.D. Axon Instruments, Inc. 3280 Whipple Road, Union City, CA 94587 Last Updated: Aug 22, 2003.
More informationNPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA
LECTURE-31 MICROARRAY WORK-FLOW: IMAGE SACNNING AND DATA PROCESSING TRANSCRIPT Welcome to the proteomics course. In today s lecture we will talk about microarray work-flow the image scanning and processing.
More informationDonuts, Scratches and Blanks: Robust Model-Based Segmentation of Microarray Images
Donuts, Scratches and Blanks: Robust Model-Based Segmentation of Microarray Images Qunhua Li 1,a, Chris Fraley 1,a, Roger E. Bumgarner 2,b, Ka Yee Yeung 2,c, Adrian E. Raftery 1,a Technical Report no.
More informationStranded mrna-seq Lib Prep Kit for Illumina
Stranded mrna-seq Lib Prep Kit for Illumina RK20301 (10ng-1ug Input Total RNA) (Illumina Compatible) C U G A www.abclonal.com version: N12G13v1.0 Contents 1.Introduction 01 2.Components 02 3.Additional
More informationFigure S1 Figure S1. Wild type IgG and FcRn colocalize in APPL+ TCs.
Figure S1 Figure S1. Wild type IgG and FcRn colocalize in APPL+ TCs. HMEC-1 cells were cotransfected with GFP-FcRn and β2m. Transfected cells were incubated with 200 μg/ml Alexa 647-wild type IgG (A) or
More informationMICROARRAY IMAGE ANALYSIS PROGRAM
Revision submitted for publication to Loyola Schools Review, 13 November 2002 MICROARRAY IMAGE ANALYSIS PROGRAM Paul Ignatius D. Echevarria Jerome C. Punzalan John Paul C. Vergara Department of Information
More informationProcedure & Checklist - Iso-Seq Template Preparation for Sequel Systems
Procedure & Checklist - Iso-Seq Template Preparation for Sequel Systems Before You Begin The long read lengths of the PacBio System are well-suited for characterizing full-length transcripts produced from
More informationScan slides (Axon Genepix 4200AL)
Page 1 Scan slides (Axon Genepix 4200AL) We need to scan the slides on both channels (Cy3 and Cy5) to obtain a 16-bit grayscale TIFF file for each. Typically these files are about 20-26Mb per channel,
More informationWe want to thank and acknowledge the authors for sharing this protocol and their contributions to the field.
We adopted the protocol described in the Extended Experimental Procedures section I.a.1 of the 2014 Cell paper by Rao and Huntley et. al: A 3D Map of the Human Genome at Kilobase Resolution Reveals Principles
More informationMicrowell-Seq. High-throughput Single Cell RNA-Seq Kit. Protocol. Index
Microwell-Seq High-throughput Single Cell RNA-Seq Kit Protocol Index 1 Introduction 2 Kit Reagent 3 Store 4 Application 5 Prepared materials 6 Note 7 Preparation 8 Workflow 1 1 Introduction Microwell-Seq
More informationAbstract. comment reviews reports deposited research refereed research interactions information
http://genomebiology.com/21/2/11/research/47.1 Research Sources of nonlinearity in cdna microarray expression measurements Latha Ramdas*, Kevin R Coombes, Keith Baggerly, Lynne Abruzzo, W Edward Highsmith,
More informationEnriching Beads Oligo (dt) Magnetic Beads for mrna Purification
Enriching Beads Oligo (dt) Magnetic Beads for mrna Purification Isolate the mrna transcriptome in 15 minutes User Guidance Enriching Biotechnology Rev. 1.0 October 25th. 2018 Why choose Enriching Beads
More informationLSM 780 Confocal Microscope Standard Operation Protocol
LSM 780 Confocal Microscope Standard Operation Protocol Basic Operation Turning on the system 1. Sign on log sheet according to Actual start time 2. Check Compressed Air supply for the air table 3. Switch
More informationLeica_Dye_Finder :53 Uhr Seite 6 Dye Finder LAS AF
Dye Finder LAS AF Dye Finder Multicolor live cell fluorescence microscopy is limited by the availability of spectrally separable fluorescent dyes. Fluorescent dyes (or spectral GFP variants) with incongruent
More informationPractical work no. 3: Confocal Live Cell Microscopy
Practical work no. 3: Confocal Live Cell Microscopy Course Instructor: Mikko Liljeström (MIU) 1 Background Confocal microscopy: The main idea behind confocality is that it suppresses the signal outside
More informationGS FLX/Junior Titanium Technology
www.454.com GS FLX/Junior Titanium Technology GS FLX and GS Junior Process Steps Overview gdna 1. DNA Library Construction * 4h 2. empcr 3. Sequencing 8 h 10 h Data output DNA Library Preparation Prepare
More informationWhy and How? Daniel Gitler Dept. of Physiology Ben-Gurion University of the Negev. Microscopy course, Michmoret Dec 2005
Why and How? Daniel Gitler Dept. of Physiology Ben-Gurion University of the Negev Why use confocal microscopy? Principles of the laser scanning confocal microscope. Image resolution. Manipulating the
More informationMicroarray BASICA: Background Adjustment, Segmentation, Image Compression and Analysis of Microarray Images
EURASIP Journal on Applied Signal Processing 24:1, 92 17 c 24 Hindawi Publishing Corporation Microarray BASICA: Background Adjustment, Segmentation, Image Compression and Analysis of Microarray Images
More informationSpotxel 1.7 Microarray Image and Data Analysis Software User s Guide
Spotxel 1.7 Microarray Image and Data Analysis Software User s Guide 27 April 2017 - Rev 7 Spotxel is only intended for research and not intended or approved for diagnosis of disease in humans or animals.
More informationBi Imaging. Multicolor Imaging: The Important Question of Co-Localization. Anna Smallcombe Bio-Rad Laboratories, Hemel Hempstead, UK
Multicolor Imaging: The Important Question of Co-Localization Anna Smallcombe Bio-Rad Laboratories, Hemel Hempstead, UK The use of specific fluorescent probes, combined with confocal or multiphoton microscopy
More informationLocal Adjustment Tools
PHOTOGRAPHY: TRICKS OF THE TRADE Lightroom CC Local Adjustment Tools Loren Nelson www.naturalphotographyjackson.com Goals for Tricks of the Trade NOT show you the way you should work Demonstrate and discuss
More informationConfocal imaging on the Leica TCS SP8. 1) Turn the system on. 2) Use TCS user account. 3) Start LAS X software:
Confocal imaging on the Leica TCS SP8 1) Turn the system on. 2) Use TCS user account. 3) Start LAS X software: 4) Do not touch the microscope while the software is initializing. Choose your options: Turn
More informationInstructions for Howto Scan µarrays
Instructions for Howto Scan µarrays Introduction After probing the µarray slides with samples, one is now ready to scan them. To scan a µarrays slide is too convert the biological information trapped on
More informationSteps involved in microarray analysis after the experiments
Steps involved in microarray analysis after the experiments Scanning slides to create images Conversion of images to numerical data Processing of raw numerical data Further analysis Clustering Integration
More informationFeature Level Data. Outline. Affymetrix GeneChip Design. Affymetrix GeneChip arrays Two color platforms
Feature Level Data Outline Affymetrix GeneChip arrays Two color platforms Affymetrix GeneChip Design 5 3 Reference sequence TGTGATGGTGCATGATGGGTCAGAAGGCCTCCGATGCGCCGATTGAGAAT GTACTACCCAGTCTTCCGGAGGCTA
More informationNR601. VAHTS TM mrna-seq V2 Library Prep Kit for Illumina
NR601 VAHTS TM mrna-seq V2 Library Prep Kit for Illumina v Vazyme Biotech Co., Ltd Website: www.vazyme.com Order: global@vazyme.com Support: support@vazyme.com Service: service@vazyme.com SYSTEMS www.vazyme.com
More informationOperation Guide for the Leica SP2 Confocal Microscope Bio-Imaging Facility Hunter College October 2009
Operation Guide for the Leica SP2 Confocal Microscope Bio-Imaging Facility Hunter College October 2009 Introduction of Fluoresence Confocal Microscopy The first confocal microscope was invented by Princeton
More informationIllumina TruSeq Stranded mrna (LT) Protocol 1
Illumina TruSeq Stranded mrna (LT) Protocol 1 Performed using the TruSeq Stranded mrna Sample Preparation Kit (A cat#fc-122-2101, B cat#fc122-2102) Purify and Fragment mrna NOTE: Use 500ng of Total RNA
More informationMultifluorescence The Crosstalk Problem and Its Solution
Multifluorescence The Crosstalk Problem and Its Solution If a specimen is labeled with more than one fluorochrome, each image channel should only show the emission signal of one of them. If, in a specimen
More information1 Co Localization and Working flow with the lsm700
1 Co Localization and Working flow with the lsm700 Samples -1 slide = mousse intestine, Dapi / Ki 67 with Cy3/ BrDU with alexa 488. -1 slide = mousse intestine, Dapi / Ki 67 with Cy3/ no BrDU (but with
More informationAdditional reagents and materials that are not supplied
sparq PureMag Beads Cat. No. 95196-005 Size: 5 ml Store at 2 C to 8 C 95196-060 60 ml 95196-450 450 ml Description sparq PureMag Beads uses reversible nucleic acid-binding properties of magnetic beads
More informationDevelopment of a Next-Generation Laser-Scanner System for Life Science Research
Development of a Next-Generation Laser-Scanner System for Life Science Research Masaki TAKAMATSU* Yasutake TANAKA* Takashi KOBAYASHI* Hiromi ISHIKAWA* and Akira YAMAGUCHI* Abstract We developed a next-generation
More informationSpectral Imaging with the Opterra Multipoint Scanning Confocal
Spectral Imaging with the Opterra Multipoint Scanning Confocal Outline Opterra design overview Scan Modes Light Path Spectral Imaging with Opterra Drosophila larva heart. Opterra Design Overview Supravideo
More informationProcedure & Checklist - cdna Capture Using SeqCap EZ Libraries
Procedure & Checklist - cdna Capture Using SeqCap EZ Libraries Before You Begin This document describes the process for capturing cdna prepared with the SMARTer PCR cdna Synthesis Kit (Clontech) and pulled-down
More informationLSM 710 Confocal Microscope Standard Operation Protocol
LSM 710 Confocal Microscope Standard Operation Protocol Basic Operation Turning on the system 1. Switch on Main power switch 2. Switch on System / PC power button 3. Switch on Components power button 4.
More informationTopic 04 What is a digital image?
Topic 04 What is a digital image? Exercise 4.1 How is the image represented by the computer - Pixels Images can have 2 or 3 spacial dimensions, a time dimensions and a number of colour-channels. An image
More informationWhat is a digital image?
Chapter 4 What is a digital image? 4.1 How is the image represented by the computer? Pixels Images can have 2 or 3 spacial dimensions, a time dimensions and a number of colour-channels. An image is a rectilinear
More informationGALILEO TMA CK 4500 HTS Tissue Microarray Platform
GALILEO TMA CK 4500 HTS Tissue Microarray Platform Tissue Microarray (TMA) A Block Of Samples From Hundreds Of Blocks (S. M. Hewitt, M.D., Ph.D., Tissue Array Research Program, LP, CCR, NCI, NIH) TMA technology
More informationLeica TCS SP8 Quick Start Guide
Leica TCS SP8 Quick Start Guide Leica TCS SP8 System Overview Start-Up Procedure 1. Turn on the CTR Control Box, Fluorescent Light for the microscope stand. 2. Turn on the Scanner Power (1) on the front
More informationImage Acquisition. Jos J.M. Groote Schaarsberg Center for Image Processing
Image Acquisition Jos J.M. Groote Schaarsberg schaarsberg@tpd.tno.nl Specification and system definition Acquisition systems (camera s) Illumination Theoretical case : noise Additional discussion and questions
More informationResearch article Microarray image analysis: background estimation using quantile and morphological filters Anders Bengtsson* and Henrik Bengtsson
BMC Bioinformatics BioMed Central Research article Microarray image analysis: background estimation using quantile and morphological filters Anders Bengtsson* and Henrik Bengtsson Open Access Address:
More informationOperating Instructions for Zeiss LSM 510
Operating Instructions for Zeiss LSM 510 Location: GNL 6.312q (BSL3) Questions? Contact: Maxim Ivannikov, maivanni@utmb.edu 1 Attend A Complementary Training Before Using The Microscope All future users
More informationImage Analysis for Fluorescence
Image Analysis for Fluorescence Terminology Table Image Analysis Macro Colocalization Intensity Dye AFI The extraction of meaningful information from digital images by means of digital image processing
More informationEnhancing the quality metric of protein microarray image *
Wang et al. / J Zhejiang Univ SCI 2004 5(2):62-628 62 Journal of Zhejiang University SCIENCE ISSN 009-3095 http://www.zju.edu.cn/jzus E-mail: jzus@zju.edu.cn Enhancing the quality metric of protein microarray
More informationImage Capture TOTALLAB
1 Introduction In order for image analysis to be performed on a gel or Western blot, it must first be converted into digital data. Good image capture is critical to guarantee optimal performance of automated
More informationSensitive imaging of spectrally overlapping fluorochromes using the LSM 510 META
Invited Paper Sensitive imaging of spectrally overlapping fluorochromes using the LSM 510 META Mary E. Dickinson a*, Christopher W. Waters a, Gregory Bearman b, Ralf Wolleschensky c, Sebastian Tille d
More informationConfocal, hyperspectral, spinning disk
Confocal, hyperspectral, spinning disk Administrative HW 6 due on Fri Midterm on Wed Covers everything since previous midterm 8.5 x 11 sheet allowed, 1 side Guest lecture by Joe Dragavon on Mon 10/30 Last
More informationillumina TruSeq RNA Sample Prep. (LT) Protocol 1
illumina TruSeq RNA Sample Prep. (LT) Protocol 1 Performed using the TruSeq RNA Sample Preparation Kit (A cat#fc-122-1001, B cat#fc122-1002) Purify and Fragment mrna NOTE: Use 3ug of Total RNA to initiate
More informationConfocal Raman Microscopy (WITec Alpha 300R)
Confocal Raman Microscopy (WITec Alpha 300R) Please refer to Witec Alpha300R Confocal Raman Microscope User Manual for the details of the operating procedure. Sample preparation 1. Attach your sample on
More informationNano-100 Spectrophotometer. Brief introduction
Nano-100 Spectrophotometer Brief introduction Direct and quick measure of DNA, RNA, cell solution concentration Only need volume 0.5 to 2 µl No need cuvette or capillary tube Wavelength range 200-800 nm
More informationWe attempted to separate the two dyes by acquiring images using a single excitation wavelength and just two emission wavelengths.
TN437: Spectral Separation of monochrome images using Volocity 4.0 Introduction Spectral Separation is a technique that allows the user to separate images containing data from more than one fluorochrome
More informationImaging Beyond the Basics: Optimizing Settings on the Leica SP8 Confocal
Imaging Beyond the Basics: Optimizing Settings on the Leica SP8 Confocal Todays Goal: Introduce some additional functionalities of the Leica SP8 confocal HyD vs. PMT detectors Dye Assistant Scanning By
More informationImage Database and Preprocessing
Chapter 3 Image Database and Preprocessing 3.1 Introduction The digital colour retinal images required for the development of automatic system for maculopathy detection are provided by the Department of
More informationProcedure & Checklist - Iso-Seq Template Preparation for Sequel Systems
Procedure & Checklist - Iso-Seq Template Preparation for Sequel Systems Before You Begin The Sequel System generates long reads that are well-suited for characterizing full-length transcripts produced
More information長庚大學共軛焦顯微鏡課程 長庚大學共軛焦顯微鏡課程. Spot light 長庚大學
長庚大學共軛焦顯微鏡課程 Spot light 長庚大學共軛焦顯微鏡課程 20071030 長庚大學 Basic principle of Laser Scanning Confocal Microscopy The application of LSM 510 META detector Multiphoton microscopy basic principle and introduction
More informationMulti-channel imaging cytometry with a single detector
Multi-channel imaging cytometry with a single detector Sarah Locknar 1, John Barton 1, Mark Entwistle 2, Gary Carver 1 and Robert Johnson 1 1 Omega Optical, Brattleboro, VT 05301 2 Philadelphia Lightwave,
More informationFluorChem M MultiFluor System
FluorChem M MultiFluor System Advancing Effortless Multiplex Western Blot Imaging Multiplex Western Analysis FluorChem M Imaging System FluorChem M sets a new standard for quantitative multiplex Western
More informationLeica TCS SP8 Quick Start Guide
Leica TCS SP8 Quick Start Guide Leica TCS SP8 System Overview Start-Up Procedure 1. Turn on the CTR Control Box, EL6000 fluorescent light source for the microscope stand. 2. Turn on the Scanner Power
More informationProcedure & Checklist cdna Capture Using IDT xgen Lockdown Probes
Procedure & Checklist cdna Capture Using IDT xgen Lockdown Probes Before You Begin This document describes the process for capturing cdna prepared with the SMARTer PCR cdna Synthesis Kit (Clontech) and
More informationSpecial Print Quality Problems of Ink Jet Printers
Special Print Quality Problems of Ink Jet Printers LUDWIK BUCZYNSKI Warsaw University of Technology, Mechatronic Department, Warsaw, Poland Abstract Rapid development of Ink Jet print technologies has
More informationOpterra II Multipoint Scanning Confocal Microscope. Innovation with Integrity
Opterra II Multipoint Scanning Confocal Microscope Enabling 4D Live-Cell Fluorescence Imaging through Speed, Sensitivity, Viability and Simplicity Innovation with Integrity Fluorescence Microscopy The
More informationHow is the Digital Image Generated? Image Acquisition Devices
In order for image analysis to be performed on a 2D gel, it must first be converted into digital data. Good image capture is critical to guarantee optimal performance of automated image analysis packages
More informationLeica SP8 Resonant Confocal. Quick-Start Guide
Leica SP8 Resonant Confocal Quick-Start Guide Contents Start-up Preparing for Imaging Part 1 On the scope Part 2 Software interface Part 3 Heat & CO2 incubation Part 4 Other hardware options Shut-down
More informationSupplemental Figure 1: Histogram of 63x Objective Lens z axis Calculated Resolutions. Results from the MetroloJ z axis fits for 5 beads from each
Supplemental Figure 1: Histogram of 63x Objective Lens z axis Calculated Resolutions. Results from the MetroloJ z axis fits for 5 beads from each lens with a 1 Airy unit pinhole setting. Many water lenses
More informationImageJ: Introduction to Image Analysis 3 May 2012 Jacqui Ross
Biomedical Imaging Research Unit School of Medical Sciences Faculty of Medical and Health Sciences The University of Auckland Private Bag 92019 Auckland 1142, NZ Ph: 373 7599 ext. 87438 http://www.fmhs.auckland.ac.nz/sms/biru/.
More information(Quantitative Imaging for) Colocalisation Analysis
(Quantitative Imaging for) Colocalisation Analysis or Why Colour Merge / Overlay Images are EVIL! Special course for DIGS-BB PhD program What is an Image anyway..? An image is a representation of reality
More informationSeishi IKAMI* Takashi KOBAYASHI** Yasutake TANAKA* and Akira YAMAGUCHI* Abstract. 2. System configuration. 1. Introduction
Development of a Next-generation CCD Imager for Life Sciences Research Seishi IKAMI* Takashi KOBAYASHI** Yasutake TANAKA* and Akira YAMAGUCHI* Abstract We have developed a next-generation CCD-based imager
More informationAdnaTest EMT-1/StemCellSelect
AdnaTest EMT-1/StemCellSelect Enrichment of tumor cells from blood for gene expression analysis For research use only Manual T-1-533 Contents Order Information... 3 Purpose... 3 Abbreviations and Symbols...
More informationRealSpot: software validating results from DNA microarray data analysis with spot images
Physiol Genomics 21: 284 291, 2005. First published February 1, 2005; doi:10.1152/physiolgenomics.00236.2004. RealSpot: software validating results from DNA microarray data analysis with spot images Zhongming
More informationAdnaTest OvarianCancer-2 Select
AdnaTest OvarianCancer-2 Select Enrichment of tumor cells from blood of ovarian cancer patients for gene expression analysis For research use only Manual T-1-538 Contents Order Information... 3 Purpose...
More informationSupplemental Reference Guide
Supplemental Reference Guide QuantiGene ViewRNA mirna ISH Cell Assay P/N 19167 Rev.A 120623 For research use only. Not for use in diagnostic procedures. Trademarks Affymetrix and, and QuantiGene are trademarks
More informationDigitizing Film Using the D850 and ES-2 Negative Digitizer
JULY 23, 2018 INTERMEDIATE Digitizing Film Using the D850 and ES-2 Negative Digitizer The ES 2 can be used with both strip film and mounted slides. Digitizing film is the process of creating digital data
More informationDual-FL. World's Fastest Fluorometer. Measure absorbance spectra and fluorescence simultaneously FLUORESCENCE
Dual-FL World's Fastest Fluorometer Measure absorbance spectra and fluorescence simultaneously FLUORESCENCE 100 Times Faster Data Collection The only simultaneous absorbance and fluorescence system available
More informationAqualog. Water Quality Measurements Made Easy FLUORESCENCE
Aqualog Water Quality Measurements Made Easy FLUORESCENCE Water quality measurements made easy The only simultaneous absorbance and fluorescence system for water quality analysis! The new Aqualog is the
More informationAqualog. CDOM Measurements Made Easy PARTICLE CHARACTERIZATION ELEMENTAL ANALYSIS FLUORESCENCE GRATINGS & OEM SPECTROMETERS OPTICAL COMPONENTS RAMAN
Aqualog CDOM Measurements Made Easy ELEMENTAL ANALYSIS FLUORESCENCE GRATINGS & OEM SPECTROMETERS OPTICAL COMPONENTS PARTICLE CHARACTERIZATION RAMAN SPECTROSCOPIC ELLIPSOMETRY SPR IMAGING CDOM measurements
More informationMAKE SURE YOUR SLIDES ARE CLEAN (TOP & BOTTOM) BEFORE LOADING DO NOT LOAD SLIDES DURING SOFTWARE INITIALIZATION
Olympus VS120-L100 Slide Scanner Standard Operating Procedure Startup 1) Red power bar switch (behind monitor) 2) Computer 3) Login: UserVS120 account (no password) 4) Double click: WAIT FOR INITIALIZATION
More informationBIO-RAD TECHNICAL NOTE 11. Written by: Anna Smallcombe and Duncan McMillan, Bio-Rad Microscopy Division, Hemel Hempstead, UK
BIO-RAD TECHNICAL NOTE 11 Co-localisation: how is it determined, and how is it analysed with the Bio-Rad LaserPix image analysis software? Written by: Anna Smallcombe and Duncan McMillan, Bio-Rad Microscopy
More informationThings to check before start-up.
Byeong Cha Page 1 11/24/2009 Manual for Leica SP2 Confocal Microscope Enter you name, the date, the time, and the account number in the user log book. Things to check before start-up. Make sure that your
More informationMULTI FLUORESCENCE AND CHEMILUMINESCENCE IMAGING SYSTEM DETECTION WITH A DIFFERENCE
MULTI FLUORESCENCE AND CHEMILUMINESCENCE IMAGING SYSTEM DETECTION WITH A DIFFERENCE REAL IMAGING FOR REAL SCIENTISTS Western blot and gel imaging remain the cornerstones of life science research. With
More informationOverview. About other software. Administrator password. 58. UltraVIEW VoX Getting Started Guide
Operation 58. UltraVIEW VoX Getting Started Guide Overview This chapter outlines the basic methods used to operate the UltraVIEW VoX system. About other software Volocity places great demands on the computer
More informationThe only simultaneous absorbance and f uorescence system for water quality analysis! Aqualog
The only simultaneous absorbance and fluorescence system for water quality analysis! Aqualog CDOM measurements made easy. The only simultaneous absorbance and fluorescence system for water quality analysis!
More informationConfocal Application Letter No. 13. Sequential Scan for Leica TCS NT/SP systems
Confocal Application Letter No. 13 Sequential Scan for Leica TCS NT/SP systems Leica Microsystems Heidelberg GmbH Im Neuenheimer Feld 518 D-69120 Heidelberg Telephone +49 6221 4148 0 Fax +49 6221 414833
More information