Preparation of Sample Hybridization Scanning and Image Analysis

Size: px
Start display at page:

Download "Preparation of Sample Hybridization Scanning and Image Analysis"

Transcription

1 Preparation of Sample Hybridization Scanning and Image Analysis

2 Sample preparation 1. Design experiment 2. Perform experiment Question? Replicates? Test? mutant wild type 3. Precipitate RNA 4. Label RNA Eukaryote/prokaryote? Cell wall? Amplification? Direct or indirect? Label?

3 Sample Preparation - Check quality of RNA Load ng of RNA on the BioAnalyzer eukaryotic: 28S/18S 2.0 prokaryotic: 23S/16S 2.0

4 Sample preparation AAAAAAAAA TTTTTTTTT RNA cdna aa-dutp Revese Transcriptase (RT) oligo dt primer nucleotides (dntp) amino-allyl-dutp (aa-dutp)

5 Sample preparation AAAAAAAAA TTTTTTTTT RNA cdna Hydrolysis (NaOH and EDTA Æ Tris) Clean-up

6 Sample preparation TTTTTTTTT cdna Coupling (Cy3 or Cy5) Quenching Clean-up

7 Sample preparation TTTTTTTTT TTTTTTTTT Combine Hybridize

8 Hybridization

9 Sample Preparation - Eberwine SAMPLE 42 C 2 h + Reverse Transcriptase RNA ssdna T7 70 C 10 min 16 C 2 h + RNase H + Polymerase T7 pol clean up dsdna 37 C 6 h dsdna arna + Biotin-labeled nucleotides

10 Detection of Biotin (Affymetrix) Streptavidin Phycoerythrim = SAPE ( ) anti-sape IgG biotinylated anti-anti IgG

11 Materials and Methods All protocols can be found here: and here:

12 Scanning and image analysis by H. Bjørn Nielsen Scanning -Dyes -Confocal scanner -CCD scanner Image File Formats Image analysis -Locating the spots -Segmentation -Evaluating data quality

13 Hybridization Probe length

14 Microarray technology Scanning Images Washing

15 Labeling dyes and their properties The two most common fluorochromes used are: Cyanine3 (cy3, exicitation = 554, emission = 568) Cyanine5 (cy5, exicitation = 650, emission = 672) But Alexa dyes are also becoming popular Excitation Emission Flourescence

16 Cyanine Dye spectra excitation and emission Excitation Emission Excitation Emission

17 Alexa Dyes comparison of excitation spectra

18 Confocal scanner diagram

19 The confocal scanner scans the slide

20 CCD scanner detects from an area CCD camera Emission filter White light Beamsplitter Excitation filter

21 Microarray image formats The most common file format is 16bit TIFF. A 16bit TIFF file describe each pixel in an image with an intensity ranging from The image resolution is commonly 10mm [currently, max 5mm] Normally two scans in different wavelengths result in two monochrome files that are overlaid Pseudo-color overlay Cy 3 Channel Cy 5 Channel

22 Image analysis overview Locating the spots Segmentation Density Ensuring good data quality (flagging) Intensity

23 Locating the spot features A grid is laid over the image to aid the program in identifying the individual spots Most programs have some automation in this step.

24 Spot Segmentation Overview Fixed circle Adaptive circle Adaptive shape Histogram method ScanAlyze, GenePix, QuantArray GenePix, Dapple Spot, (a R package) ImaGene, QuantArray DeArray Density Intensity

25 Fixed Circle segmentation Fits a circle with a constant diameter to all spots in the image Easy to implement The spots need to be of the same shape and size

26 Adaptive Circle segmentation The circle diameter is estimated separately for each spot Problematic if spot exhibits non-circular shapes

27 Adaptive Shape segmentation Starts by Specifying a starting points (given by the gridding) Regions grow outwards from the starting point according to the difference between a pixel s value and the running mean of values in an adjoining region.

28 Histogram segmentation Uses a target mask chosen to be larger than any spot Foreground and background intensity are determined from the histogram of pixel values for pixels within the masked area Example : Background : mean between 5th and 20th percentile Foreground : mean between 80th and 95th percentile Density Intensity

29 Background Estimation examples Spot ScanAlyze QuantArray

30 Spot Irregularity examples Some spots may be more uncertain than others. This can be caused by: -Dust grains -Background smear -Strange shaped spot (comet tails, etc.) -Donuts shaped spots -Weak signals

31 Quality Measures examples We can pickup most of these irregularities by these measures - Intensity variability measures - Spot size deviation - Circularity deviation - Relative signal to background intensity - Position deviates from a rectangular grid Based on such measurements, a spot can be rejected

32 Feature Intensity calculation The average or median pixel value in the spot and background masks are calculated.

33 Output Example (ImaGene) Field Meta Row Meta Column Row Column Gene_ID Flag Signal Mean Background Mean A ZY A ZY A ZY A ZY A ZY A ZY A ZY A ZY A ZY A ZY A ZY A ZY A ZY

34 Examples of Difficult Images microarray images

35 Book about hybridization Nucleic Acid Hybridization (Introduction to Biotechniques S.) By: M.L.M. Anderson Paperback 256 pages (December 1998) Publisher: BIOS Scientific Publishers ISBN:

Quality control of microarrays

Quality control of microarrays Quality control of microarrays Solveig Mjelstad Angelskår Intoduction to Microarray technology September 2009 Overview of the presentation 1. Image analysis 2. Quality Control (QC) general concepts 3.

More information

Automatic gene expression estimation from microarray images. Daniel O. Dantas Adviser: : Junior Barrera

Automatic gene expression estimation from microarray images. Daniel O. Dantas Adviser: : Junior Barrera Automatic gene expression estimation from microarray images Daniel O. Dantas Adviser: : Junior Barrera IME-USP Summary Introduction Problem definition Solution strategy Image segmentation Signal estimation

More information

Developed by BioDiscovery, Inc. DualChip evaluation software User Manual Version 1.1

Developed by BioDiscovery, Inc. DualChip evaluation software User Manual Version 1.1 Developed by BioDiscovery, Inc. DualChip evaluation software User Manual Version 1.1 1 Table of contents 1. INTRODUCTION...3 2. SCOPE OF DELIVERY...4 3. INSTALLATION PROCEDURES...5 3.1. SYSTEM REQUIREMENTS...

More information

Low-level Analysis. cdna Microarrays. Lecture 2 Low Level Gene Expression Data Analysis. Stat 697K, CS 691K, Microbio 690K

Low-level Analysis. cdna Microarrays. Lecture 2 Low Level Gene Expression Data Analysis. Stat 697K, CS 691K, Microbio 690K Lecture 2 Low Level Gene Expression Data nalysis Stat 697K, CS 691K, icrobio 690K Statistical Challenges odel variation of data not related to gene expression Compare expression for the same gene across

More information

GenePix Application Note

GenePix Application Note GenePix Application Note Determining the Signal-to-Noise Ratio and Optimal Photomultiplier gain setting in the GenePix 4000B Siobhan Pickett, M.S., Sean Carriedo, Ph.D. and Chang Wang, Ph.D. Axon Instruments,

More information

Scanning and Image Processing -by Steve Clough

Scanning and Image Processing -by Steve Clough Scanning and Image Processing -by Steve Clough cdna microarrays use two dyes with well separated emission spectra such as Cy3 and Cy5 to allow direct comparisons on single slide GSI Lumonics Ratio of Expression

More information

Automated cdna microarray image segmentation

Automated cdna microarray image segmentation Automated cdna microarray image segmentation Author Liew, Alan Wee-Chung, Yan, Hong Published 2007 Conference Title Proceedings of the International Symposium on Computational Models for Life Sciences

More information

ScanArray Overview. Principle of Operation. Instrument Components

ScanArray Overview. Principle of Operation. Instrument Components ScanArray Overview The GSI Lumonics ScanArrayÒ Microarray Analysis System is a scanning laser confocal fluorescence microscope that is used to determine the fluorescence intensity of a two-dimensional

More information

Microarray Image Analysis: Background Estimation using Region and Filtering Techniques

Microarray Image Analysis: Background Estimation using Region and Filtering Techniques Microarray Image Analysis: Background Estimation using Region and Filtering Techniques Anders Bengtsson December 9, 2003 Abstract This report examines properties of two main methods used for local background

More information

EmbryoCellect. RHS Scanning and Analysis Instructions. for. Genepix Pro Software

EmbryoCellect. RHS Scanning and Analysis Instructions. for. Genepix Pro Software EmbryoCellect RHS Scanning and Analysis Instructions for Genepix Pro Software EmbryoCellect Genepix Pro Scanning and Analysis Technical Data Sheet Version 1.0 October 2015 1 Copyright Reproductive Health

More information

Microarray Data Pre-processing. Ana H. Barragan Lid

Microarray Data Pre-processing. Ana H. Barragan Lid Microarray Data Pre-processing Ana H. Barragan Lid Hybridized Microarray Imaged in a microarray scanner Scanner produces fluorescence intensity measurements Intensities correspond to levels of hybridization

More information

Computational Genomics. High-throughput experimental biology

Computational Genomics. High-throughput experimental biology Computational Genomics 10-810/02 810/02-710, Spring 2009 Gene Expression Analysis Data pre-processing processing Eric Xing Lecture 15, March 4, 2009 Reading: class assignment Eric Xing @ CMU, 2005-2009

More information

NPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA

NPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA HANDOUT LECTURE-31 MICROARRAY WORK-FLOW: IMAGE SCANNING AND DATA PROCESSING Slide 1: This module contains the summary of the discussion with Mr. Pankaj Khanna, an application specialist from Spinco Biotech,

More information

In our previous lecture, we understood the vital parameters to be taken into consideration before data acquisition and scanning.

In our previous lecture, we understood the vital parameters to be taken into consideration before data acquisition and scanning. Interactomics: Protein Arrays & Label Free Biosensors Professor Sanjeeva Srivastava MOOC NPTEL Course Indian Institute of Technology Bombay Module 7 Lecture No 34 Software for Image scanning and data processing

More information

Products - Microarray Scanners - Laser Scanners - InnoScan 900 Series and MAPIX Software

Products - Microarray Scanners - Laser Scanners - InnoScan 900 Series and MAPIX Software Products - Microarray Scanners - Laser Scanners - InnoScan 900 Series and MAPIX Software Arrayit offers the world s only next generation microarray scanning technology, with proprietary rotary motion control,

More information

Instructions for Mapping * µarray Images using GenePix 5.0

Instructions for Mapping * µarray Images using GenePix 5.0 Instructions for Mapping * µarray Images using GenePix 5.0 Preliminary Information Make sure that the GenePix 5.0 software has been installed on your computer and you have the USB hardware dongle that

More information

Product Information. Introduction

Product Information. Introduction Microarray Scanner Calibration Slide To quantitatively analyze scanners performance and output, adjust and fine-tune scanners, and perform comparative analysis for multiple scanner units. To verify scanners

More information

Mayr lab 3'-seq protocol, October 2013

Mayr lab 3'-seq protocol, October 2013 Mayr lab 3'-seq protocol, October 2013 Time line: Day -1: DNase treat your RNA samples (optional) Day 1: Prepare beads, anneal oligo to beads, 1 st, 2 nd strand synthesis Day 2: Introduce nick (Rnase HII),

More information

GenePix Application Note

GenePix Application Note GenePix Application Note Biological Relevance of GenePix Results Shawn Handran, Ph.D. and Jack Y. Zhai, Ph.D. Axon Instruments, Inc. 3280 Whipple Road, Union City, CA 94587 Last Updated: Aug 22, 2003.

More information

NPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA

NPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA LECTURE-31 MICROARRAY WORK-FLOW: IMAGE SACNNING AND DATA PROCESSING TRANSCRIPT Welcome to the proteomics course. In today s lecture we will talk about microarray work-flow the image scanning and processing.

More information

Donuts, Scratches and Blanks: Robust Model-Based Segmentation of Microarray Images

Donuts, Scratches and Blanks: Robust Model-Based Segmentation of Microarray Images Donuts, Scratches and Blanks: Robust Model-Based Segmentation of Microarray Images Qunhua Li 1,a, Chris Fraley 1,a, Roger E. Bumgarner 2,b, Ka Yee Yeung 2,c, Adrian E. Raftery 1,a Technical Report no.

More information

Stranded mrna-seq Lib Prep Kit for Illumina

Stranded mrna-seq Lib Prep Kit for Illumina Stranded mrna-seq Lib Prep Kit for Illumina RK20301 (10ng-1ug Input Total RNA) (Illumina Compatible) C U G A www.abclonal.com version: N12G13v1.0 Contents 1.Introduction 01 2.Components 02 3.Additional

More information

Figure S1 Figure S1. Wild type IgG and FcRn colocalize in APPL+ TCs.

Figure S1 Figure S1. Wild type IgG and FcRn colocalize in APPL+ TCs. Figure S1 Figure S1. Wild type IgG and FcRn colocalize in APPL+ TCs. HMEC-1 cells were cotransfected with GFP-FcRn and β2m. Transfected cells were incubated with 200 μg/ml Alexa 647-wild type IgG (A) or

More information

MICROARRAY IMAGE ANALYSIS PROGRAM

MICROARRAY IMAGE ANALYSIS PROGRAM Revision submitted for publication to Loyola Schools Review, 13 November 2002 MICROARRAY IMAGE ANALYSIS PROGRAM Paul Ignatius D. Echevarria Jerome C. Punzalan John Paul C. Vergara Department of Information

More information

Procedure & Checklist - Iso-Seq Template Preparation for Sequel Systems

Procedure & Checklist - Iso-Seq Template Preparation for Sequel Systems Procedure & Checklist - Iso-Seq Template Preparation for Sequel Systems Before You Begin The long read lengths of the PacBio System are well-suited for characterizing full-length transcripts produced from

More information

Scan slides (Axon Genepix 4200AL)

Scan slides (Axon Genepix 4200AL) Page 1 Scan slides (Axon Genepix 4200AL) We need to scan the slides on both channels (Cy3 and Cy5) to obtain a 16-bit grayscale TIFF file for each. Typically these files are about 20-26Mb per channel,

More information

We want to thank and acknowledge the authors for sharing this protocol and their contributions to the field.

We want to thank and acknowledge the authors for sharing this protocol and their contributions to the field. We adopted the protocol described in the Extended Experimental Procedures section I.a.1 of the 2014 Cell paper by Rao and Huntley et. al: A 3D Map of the Human Genome at Kilobase Resolution Reveals Principles

More information

Microwell-Seq. High-throughput Single Cell RNA-Seq Kit. Protocol. Index

Microwell-Seq. High-throughput Single Cell RNA-Seq Kit. Protocol. Index Microwell-Seq High-throughput Single Cell RNA-Seq Kit Protocol Index 1 Introduction 2 Kit Reagent 3 Store 4 Application 5 Prepared materials 6 Note 7 Preparation 8 Workflow 1 1 Introduction Microwell-Seq

More information

Abstract. comment reviews reports deposited research refereed research interactions information

Abstract.   comment reviews reports deposited research refereed research interactions information http://genomebiology.com/21/2/11/research/47.1 Research Sources of nonlinearity in cdna microarray expression measurements Latha Ramdas*, Kevin R Coombes, Keith Baggerly, Lynne Abruzzo, W Edward Highsmith,

More information

Enriching Beads Oligo (dt) Magnetic Beads for mrna Purification

Enriching Beads Oligo (dt) Magnetic Beads for mrna Purification Enriching Beads Oligo (dt) Magnetic Beads for mrna Purification Isolate the mrna transcriptome in 15 minutes User Guidance Enriching Biotechnology Rev. 1.0 October 25th. 2018 Why choose Enriching Beads

More information

LSM 780 Confocal Microscope Standard Operation Protocol

LSM 780 Confocal Microscope Standard Operation Protocol LSM 780 Confocal Microscope Standard Operation Protocol Basic Operation Turning on the system 1. Sign on log sheet according to Actual start time 2. Check Compressed Air supply for the air table 3. Switch

More information

Leica_Dye_Finder :53 Uhr Seite 6 Dye Finder LAS AF

Leica_Dye_Finder :53 Uhr Seite 6 Dye Finder LAS AF Dye Finder LAS AF Dye Finder Multicolor live cell fluorescence microscopy is limited by the availability of spectrally separable fluorescent dyes. Fluorescent dyes (or spectral GFP variants) with incongruent

More information

Practical work no. 3: Confocal Live Cell Microscopy

Practical work no. 3: Confocal Live Cell Microscopy Practical work no. 3: Confocal Live Cell Microscopy Course Instructor: Mikko Liljeström (MIU) 1 Background Confocal microscopy: The main idea behind confocality is that it suppresses the signal outside

More information

GS FLX/Junior Titanium Technology

GS FLX/Junior Titanium Technology www.454.com GS FLX/Junior Titanium Technology GS FLX and GS Junior Process Steps Overview gdna 1. DNA Library Construction * 4h 2. empcr 3. Sequencing 8 h 10 h Data output DNA Library Preparation Prepare

More information

Why and How? Daniel Gitler Dept. of Physiology Ben-Gurion University of the Negev. Microscopy course, Michmoret Dec 2005

Why and How? Daniel Gitler Dept. of Physiology Ben-Gurion University of the Negev. Microscopy course, Michmoret Dec 2005 Why and How? Daniel Gitler Dept. of Physiology Ben-Gurion University of the Negev Why use confocal microscopy? Principles of the laser scanning confocal microscope. Image resolution. Manipulating the

More information

Microarray BASICA: Background Adjustment, Segmentation, Image Compression and Analysis of Microarray Images

Microarray BASICA: Background Adjustment, Segmentation, Image Compression and Analysis of Microarray Images EURASIP Journal on Applied Signal Processing 24:1, 92 17 c 24 Hindawi Publishing Corporation Microarray BASICA: Background Adjustment, Segmentation, Image Compression and Analysis of Microarray Images

More information

Spotxel 1.7 Microarray Image and Data Analysis Software User s Guide

Spotxel 1.7 Microarray Image and Data Analysis Software User s Guide Spotxel 1.7 Microarray Image and Data Analysis Software User s Guide 27 April 2017 - Rev 7 Spotxel is only intended for research and not intended or approved for diagnosis of disease in humans or animals.

More information

Bi Imaging. Multicolor Imaging: The Important Question of Co-Localization. Anna Smallcombe Bio-Rad Laboratories, Hemel Hempstead, UK

Bi Imaging. Multicolor Imaging: The Important Question of Co-Localization. Anna Smallcombe Bio-Rad Laboratories, Hemel Hempstead, UK Multicolor Imaging: The Important Question of Co-Localization Anna Smallcombe Bio-Rad Laboratories, Hemel Hempstead, UK The use of specific fluorescent probes, combined with confocal or multiphoton microscopy

More information

Local Adjustment Tools

Local Adjustment Tools PHOTOGRAPHY: TRICKS OF THE TRADE Lightroom CC Local Adjustment Tools Loren Nelson www.naturalphotographyjackson.com Goals for Tricks of the Trade NOT show you the way you should work Demonstrate and discuss

More information

Confocal imaging on the Leica TCS SP8. 1) Turn the system on. 2) Use TCS user account. 3) Start LAS X software:

Confocal imaging on the Leica TCS SP8. 1) Turn the system on. 2) Use TCS user account. 3) Start LAS X software: Confocal imaging on the Leica TCS SP8 1) Turn the system on. 2) Use TCS user account. 3) Start LAS X software: 4) Do not touch the microscope while the software is initializing. Choose your options: Turn

More information

Instructions for Howto Scan µarrays

Instructions for Howto Scan µarrays Instructions for Howto Scan µarrays Introduction After probing the µarray slides with samples, one is now ready to scan them. To scan a µarrays slide is too convert the biological information trapped on

More information

Steps involved in microarray analysis after the experiments

Steps involved in microarray analysis after the experiments Steps involved in microarray analysis after the experiments Scanning slides to create images Conversion of images to numerical data Processing of raw numerical data Further analysis Clustering Integration

More information

Feature Level Data. Outline. Affymetrix GeneChip Design. Affymetrix GeneChip arrays Two color platforms

Feature Level Data. Outline. Affymetrix GeneChip Design. Affymetrix GeneChip arrays Two color platforms Feature Level Data Outline Affymetrix GeneChip arrays Two color platforms Affymetrix GeneChip Design 5 3 Reference sequence TGTGATGGTGCATGATGGGTCAGAAGGCCTCCGATGCGCCGATTGAGAAT GTACTACCCAGTCTTCCGGAGGCTA

More information

NR601. VAHTS TM mrna-seq V2 Library Prep Kit for Illumina

NR601. VAHTS TM mrna-seq V2 Library Prep Kit for Illumina NR601 VAHTS TM mrna-seq V2 Library Prep Kit for Illumina v Vazyme Biotech Co., Ltd Website: www.vazyme.com Order: global@vazyme.com Support: support@vazyme.com Service: service@vazyme.com SYSTEMS www.vazyme.com

More information

Operation Guide for the Leica SP2 Confocal Microscope Bio-Imaging Facility Hunter College October 2009

Operation Guide for the Leica SP2 Confocal Microscope Bio-Imaging Facility Hunter College October 2009 Operation Guide for the Leica SP2 Confocal Microscope Bio-Imaging Facility Hunter College October 2009 Introduction of Fluoresence Confocal Microscopy The first confocal microscope was invented by Princeton

More information

Illumina TruSeq Stranded mrna (LT) Protocol 1

Illumina TruSeq Stranded mrna (LT) Protocol 1 Illumina TruSeq Stranded mrna (LT) Protocol 1 Performed using the TruSeq Stranded mrna Sample Preparation Kit (A cat#fc-122-2101, B cat#fc122-2102) Purify and Fragment mrna NOTE: Use 500ng of Total RNA

More information

Multifluorescence The Crosstalk Problem and Its Solution

Multifluorescence The Crosstalk Problem and Its Solution Multifluorescence The Crosstalk Problem and Its Solution If a specimen is labeled with more than one fluorochrome, each image channel should only show the emission signal of one of them. If, in a specimen

More information

1 Co Localization and Working flow with the lsm700

1 Co Localization and Working flow with the lsm700 1 Co Localization and Working flow with the lsm700 Samples -1 slide = mousse intestine, Dapi / Ki 67 with Cy3/ BrDU with alexa 488. -1 slide = mousse intestine, Dapi / Ki 67 with Cy3/ no BrDU (but with

More information

Additional reagents and materials that are not supplied

Additional reagents and materials that are not supplied sparq PureMag Beads Cat. No. 95196-005 Size: 5 ml Store at 2 C to 8 C 95196-060 60 ml 95196-450 450 ml Description sparq PureMag Beads uses reversible nucleic acid-binding properties of magnetic beads

More information

Development of a Next-Generation Laser-Scanner System for Life Science Research

Development of a Next-Generation Laser-Scanner System for Life Science Research Development of a Next-Generation Laser-Scanner System for Life Science Research Masaki TAKAMATSU* Yasutake TANAKA* Takashi KOBAYASHI* Hiromi ISHIKAWA* and Akira YAMAGUCHI* Abstract We developed a next-generation

More information

Spectral Imaging with the Opterra Multipoint Scanning Confocal

Spectral Imaging with the Opterra Multipoint Scanning Confocal Spectral Imaging with the Opterra Multipoint Scanning Confocal Outline Opterra design overview Scan Modes Light Path Spectral Imaging with Opterra Drosophila larva heart. Opterra Design Overview Supravideo

More information

Procedure & Checklist - cdna Capture Using SeqCap EZ Libraries

Procedure & Checklist - cdna Capture Using SeqCap EZ Libraries Procedure & Checklist - cdna Capture Using SeqCap EZ Libraries Before You Begin This document describes the process for capturing cdna prepared with the SMARTer PCR cdna Synthesis Kit (Clontech) and pulled-down

More information

LSM 710 Confocal Microscope Standard Operation Protocol

LSM 710 Confocal Microscope Standard Operation Protocol LSM 710 Confocal Microscope Standard Operation Protocol Basic Operation Turning on the system 1. Switch on Main power switch 2. Switch on System / PC power button 3. Switch on Components power button 4.

More information

Topic 04 What is a digital image?

Topic 04 What is a digital image? Topic 04 What is a digital image? Exercise 4.1 How is the image represented by the computer - Pixels Images can have 2 or 3 spacial dimensions, a time dimensions and a number of colour-channels. An image

More information

What is a digital image?

What is a digital image? Chapter 4 What is a digital image? 4.1 How is the image represented by the computer? Pixels Images can have 2 or 3 spacial dimensions, a time dimensions and a number of colour-channels. An image is a rectilinear

More information

GALILEO TMA CK 4500 HTS Tissue Microarray Platform

GALILEO TMA CK 4500 HTS Tissue Microarray Platform GALILEO TMA CK 4500 HTS Tissue Microarray Platform Tissue Microarray (TMA) A Block Of Samples From Hundreds Of Blocks (S. M. Hewitt, M.D., Ph.D., Tissue Array Research Program, LP, CCR, NCI, NIH) TMA technology

More information

Leica TCS SP8 Quick Start Guide

Leica TCS SP8 Quick Start Guide Leica TCS SP8 Quick Start Guide Leica TCS SP8 System Overview Start-Up Procedure 1. Turn on the CTR Control Box, Fluorescent Light for the microscope stand. 2. Turn on the Scanner Power (1) on the front

More information

Image Acquisition. Jos J.M. Groote Schaarsberg Center for Image Processing

Image Acquisition. Jos J.M. Groote Schaarsberg Center for Image Processing Image Acquisition Jos J.M. Groote Schaarsberg schaarsberg@tpd.tno.nl Specification and system definition Acquisition systems (camera s) Illumination Theoretical case : noise Additional discussion and questions

More information

Research article Microarray image analysis: background estimation using quantile and morphological filters Anders Bengtsson* and Henrik Bengtsson

Research article Microarray image analysis: background estimation using quantile and morphological filters Anders Bengtsson* and Henrik Bengtsson BMC Bioinformatics BioMed Central Research article Microarray image analysis: background estimation using quantile and morphological filters Anders Bengtsson* and Henrik Bengtsson Open Access Address:

More information

Operating Instructions for Zeiss LSM 510

Operating Instructions for Zeiss LSM 510 Operating Instructions for Zeiss LSM 510 Location: GNL 6.312q (BSL3) Questions? Contact: Maxim Ivannikov, maivanni@utmb.edu 1 Attend A Complementary Training Before Using The Microscope All future users

More information

Image Analysis for Fluorescence

Image Analysis for Fluorescence Image Analysis for Fluorescence Terminology Table Image Analysis Macro Colocalization Intensity Dye AFI The extraction of meaningful information from digital images by means of digital image processing

More information

Enhancing the quality metric of protein microarray image *

Enhancing the quality metric of protein microarray image * Wang et al. / J Zhejiang Univ SCI 2004 5(2):62-628 62 Journal of Zhejiang University SCIENCE ISSN 009-3095 http://www.zju.edu.cn/jzus E-mail: jzus@zju.edu.cn Enhancing the quality metric of protein microarray

More information

Image Capture TOTALLAB

Image Capture TOTALLAB 1 Introduction In order for image analysis to be performed on a gel or Western blot, it must first be converted into digital data. Good image capture is critical to guarantee optimal performance of automated

More information

Sensitive imaging of spectrally overlapping fluorochromes using the LSM 510 META

Sensitive imaging of spectrally overlapping fluorochromes using the LSM 510 META Invited Paper Sensitive imaging of spectrally overlapping fluorochromes using the LSM 510 META Mary E. Dickinson a*, Christopher W. Waters a, Gregory Bearman b, Ralf Wolleschensky c, Sebastian Tille d

More information

Confocal, hyperspectral, spinning disk

Confocal, hyperspectral, spinning disk Confocal, hyperspectral, spinning disk Administrative HW 6 due on Fri Midterm on Wed Covers everything since previous midterm 8.5 x 11 sheet allowed, 1 side Guest lecture by Joe Dragavon on Mon 10/30 Last

More information

illumina TruSeq RNA Sample Prep. (LT) Protocol 1

illumina TruSeq RNA Sample Prep. (LT) Protocol 1 illumina TruSeq RNA Sample Prep. (LT) Protocol 1 Performed using the TruSeq RNA Sample Preparation Kit (A cat#fc-122-1001, B cat#fc122-1002) Purify and Fragment mrna NOTE: Use 3ug of Total RNA to initiate

More information

Confocal Raman Microscopy (WITec Alpha 300R)

Confocal Raman Microscopy (WITec Alpha 300R) Confocal Raman Microscopy (WITec Alpha 300R) Please refer to Witec Alpha300R Confocal Raman Microscope User Manual for the details of the operating procedure. Sample preparation 1. Attach your sample on

More information

Nano-100 Spectrophotometer. Brief introduction

Nano-100 Spectrophotometer. Brief introduction Nano-100 Spectrophotometer Brief introduction Direct and quick measure of DNA, RNA, cell solution concentration Only need volume 0.5 to 2 µl No need cuvette or capillary tube Wavelength range 200-800 nm

More information

We attempted to separate the two dyes by acquiring images using a single excitation wavelength and just two emission wavelengths.

We attempted to separate the two dyes by acquiring images using a single excitation wavelength and just two emission wavelengths. TN437: Spectral Separation of monochrome images using Volocity 4.0 Introduction Spectral Separation is a technique that allows the user to separate images containing data from more than one fluorochrome

More information

Imaging Beyond the Basics: Optimizing Settings on the Leica SP8 Confocal

Imaging Beyond the Basics: Optimizing Settings on the Leica SP8 Confocal Imaging Beyond the Basics: Optimizing Settings on the Leica SP8 Confocal Todays Goal: Introduce some additional functionalities of the Leica SP8 confocal HyD vs. PMT detectors Dye Assistant Scanning By

More information

Image Database and Preprocessing

Image Database and Preprocessing Chapter 3 Image Database and Preprocessing 3.1 Introduction The digital colour retinal images required for the development of automatic system for maculopathy detection are provided by the Department of

More information

Procedure & Checklist - Iso-Seq Template Preparation for Sequel Systems

Procedure & Checklist - Iso-Seq Template Preparation for Sequel Systems Procedure & Checklist - Iso-Seq Template Preparation for Sequel Systems Before You Begin The Sequel System generates long reads that are well-suited for characterizing full-length transcripts produced

More information

長庚大學共軛焦顯微鏡課程 長庚大學共軛焦顯微鏡課程. Spot light 長庚大學

長庚大學共軛焦顯微鏡課程 長庚大學共軛焦顯微鏡課程. Spot light 長庚大學 長庚大學共軛焦顯微鏡課程 Spot light 長庚大學共軛焦顯微鏡課程 20071030 長庚大學 Basic principle of Laser Scanning Confocal Microscopy The application of LSM 510 META detector Multiphoton microscopy basic principle and introduction

More information

Multi-channel imaging cytometry with a single detector

Multi-channel imaging cytometry with a single detector Multi-channel imaging cytometry with a single detector Sarah Locknar 1, John Barton 1, Mark Entwistle 2, Gary Carver 1 and Robert Johnson 1 1 Omega Optical, Brattleboro, VT 05301 2 Philadelphia Lightwave,

More information

FluorChem M MultiFluor System

FluorChem M MultiFluor System FluorChem M MultiFluor System Advancing Effortless Multiplex Western Blot Imaging Multiplex Western Analysis FluorChem M Imaging System FluorChem M sets a new standard for quantitative multiplex Western

More information

Leica TCS SP8 Quick Start Guide

Leica TCS SP8 Quick Start Guide Leica TCS SP8 Quick Start Guide Leica TCS SP8 System Overview Start-Up Procedure 1. Turn on the CTR Control Box, EL6000 fluorescent light source for the microscope stand. 2. Turn on the Scanner Power

More information

Procedure & Checklist cdna Capture Using IDT xgen Lockdown Probes

Procedure & Checklist cdna Capture Using IDT xgen Lockdown Probes Procedure & Checklist cdna Capture Using IDT xgen Lockdown Probes Before You Begin This document describes the process for capturing cdna prepared with the SMARTer PCR cdna Synthesis Kit (Clontech) and

More information

Special Print Quality Problems of Ink Jet Printers

Special Print Quality Problems of Ink Jet Printers Special Print Quality Problems of Ink Jet Printers LUDWIK BUCZYNSKI Warsaw University of Technology, Mechatronic Department, Warsaw, Poland Abstract Rapid development of Ink Jet print technologies has

More information

Opterra II Multipoint Scanning Confocal Microscope. Innovation with Integrity

Opterra II Multipoint Scanning Confocal Microscope. Innovation with Integrity Opterra II Multipoint Scanning Confocal Microscope Enabling 4D Live-Cell Fluorescence Imaging through Speed, Sensitivity, Viability and Simplicity Innovation with Integrity Fluorescence Microscopy The

More information

How is the Digital Image Generated? Image Acquisition Devices

How is the Digital Image Generated? Image Acquisition Devices In order for image analysis to be performed on a 2D gel, it must first be converted into digital data. Good image capture is critical to guarantee optimal performance of automated image analysis packages

More information

Leica SP8 Resonant Confocal. Quick-Start Guide

Leica SP8 Resonant Confocal. Quick-Start Guide Leica SP8 Resonant Confocal Quick-Start Guide Contents Start-up Preparing for Imaging Part 1 On the scope Part 2 Software interface Part 3 Heat & CO2 incubation Part 4 Other hardware options Shut-down

More information

Supplemental Figure 1: Histogram of 63x Objective Lens z axis Calculated Resolutions. Results from the MetroloJ z axis fits for 5 beads from each

Supplemental Figure 1: Histogram of 63x Objective Lens z axis Calculated Resolutions. Results from the MetroloJ z axis fits for 5 beads from each Supplemental Figure 1: Histogram of 63x Objective Lens z axis Calculated Resolutions. Results from the MetroloJ z axis fits for 5 beads from each lens with a 1 Airy unit pinhole setting. Many water lenses

More information

ImageJ: Introduction to Image Analysis 3 May 2012 Jacqui Ross

ImageJ: Introduction to Image Analysis 3 May 2012 Jacqui Ross Biomedical Imaging Research Unit School of Medical Sciences Faculty of Medical and Health Sciences The University of Auckland Private Bag 92019 Auckland 1142, NZ Ph: 373 7599 ext. 87438 http://www.fmhs.auckland.ac.nz/sms/biru/.

More information

(Quantitative Imaging for) Colocalisation Analysis

(Quantitative Imaging for) Colocalisation Analysis (Quantitative Imaging for) Colocalisation Analysis or Why Colour Merge / Overlay Images are EVIL! Special course for DIGS-BB PhD program What is an Image anyway..? An image is a representation of reality

More information

Seishi IKAMI* Takashi KOBAYASHI** Yasutake TANAKA* and Akira YAMAGUCHI* Abstract. 2. System configuration. 1. Introduction

Seishi IKAMI* Takashi KOBAYASHI** Yasutake TANAKA* and Akira YAMAGUCHI* Abstract. 2. System configuration. 1. Introduction Development of a Next-generation CCD Imager for Life Sciences Research Seishi IKAMI* Takashi KOBAYASHI** Yasutake TANAKA* and Akira YAMAGUCHI* Abstract We have developed a next-generation CCD-based imager

More information

AdnaTest EMT-1/StemCellSelect

AdnaTest EMT-1/StemCellSelect AdnaTest EMT-1/StemCellSelect Enrichment of tumor cells from blood for gene expression analysis For research use only Manual T-1-533 Contents Order Information... 3 Purpose... 3 Abbreviations and Symbols...

More information

RealSpot: software validating results from DNA microarray data analysis with spot images

RealSpot: software validating results from DNA microarray data analysis with spot images Physiol Genomics 21: 284 291, 2005. First published February 1, 2005; doi:10.1152/physiolgenomics.00236.2004. RealSpot: software validating results from DNA microarray data analysis with spot images Zhongming

More information

AdnaTest OvarianCancer-2 Select

AdnaTest OvarianCancer-2 Select AdnaTest OvarianCancer-2 Select Enrichment of tumor cells from blood of ovarian cancer patients for gene expression analysis For research use only Manual T-1-538 Contents Order Information... 3 Purpose...

More information

Supplemental Reference Guide

Supplemental Reference Guide Supplemental Reference Guide QuantiGene ViewRNA mirna ISH Cell Assay P/N 19167 Rev.A 120623 For research use only. Not for use in diagnostic procedures. Trademarks Affymetrix and, and QuantiGene are trademarks

More information

Digitizing Film Using the D850 and ES-2 Negative Digitizer

Digitizing Film Using the D850 and ES-2 Negative Digitizer JULY 23, 2018 INTERMEDIATE Digitizing Film Using the D850 and ES-2 Negative Digitizer The ES 2 can be used with both strip film and mounted slides. Digitizing film is the process of creating digital data

More information

Dual-FL. World's Fastest Fluorometer. Measure absorbance spectra and fluorescence simultaneously FLUORESCENCE

Dual-FL. World's Fastest Fluorometer. Measure absorbance spectra and fluorescence simultaneously FLUORESCENCE Dual-FL World's Fastest Fluorometer Measure absorbance spectra and fluorescence simultaneously FLUORESCENCE 100 Times Faster Data Collection The only simultaneous absorbance and fluorescence system available

More information

Aqualog. Water Quality Measurements Made Easy FLUORESCENCE

Aqualog. Water Quality Measurements Made Easy FLUORESCENCE Aqualog Water Quality Measurements Made Easy FLUORESCENCE Water quality measurements made easy The only simultaneous absorbance and fluorescence system for water quality analysis! The new Aqualog is the

More information

Aqualog. CDOM Measurements Made Easy PARTICLE CHARACTERIZATION ELEMENTAL ANALYSIS FLUORESCENCE GRATINGS & OEM SPECTROMETERS OPTICAL COMPONENTS RAMAN

Aqualog. CDOM Measurements Made Easy PARTICLE CHARACTERIZATION ELEMENTAL ANALYSIS FLUORESCENCE GRATINGS & OEM SPECTROMETERS OPTICAL COMPONENTS RAMAN Aqualog CDOM Measurements Made Easy ELEMENTAL ANALYSIS FLUORESCENCE GRATINGS & OEM SPECTROMETERS OPTICAL COMPONENTS PARTICLE CHARACTERIZATION RAMAN SPECTROSCOPIC ELLIPSOMETRY SPR IMAGING CDOM measurements

More information

MAKE SURE YOUR SLIDES ARE CLEAN (TOP & BOTTOM) BEFORE LOADING DO NOT LOAD SLIDES DURING SOFTWARE INITIALIZATION

MAKE SURE YOUR SLIDES ARE CLEAN (TOP & BOTTOM) BEFORE LOADING DO NOT LOAD SLIDES DURING SOFTWARE INITIALIZATION Olympus VS120-L100 Slide Scanner Standard Operating Procedure Startup 1) Red power bar switch (behind monitor) 2) Computer 3) Login: UserVS120 account (no password) 4) Double click: WAIT FOR INITIALIZATION

More information

BIO-RAD TECHNICAL NOTE 11. Written by: Anna Smallcombe and Duncan McMillan, Bio-Rad Microscopy Division, Hemel Hempstead, UK

BIO-RAD TECHNICAL NOTE 11. Written by: Anna Smallcombe and Duncan McMillan, Bio-Rad Microscopy Division, Hemel Hempstead, UK BIO-RAD TECHNICAL NOTE 11 Co-localisation: how is it determined, and how is it analysed with the Bio-Rad LaserPix image analysis software? Written by: Anna Smallcombe and Duncan McMillan, Bio-Rad Microscopy

More information

Things to check before start-up.

Things to check before start-up. Byeong Cha Page 1 11/24/2009 Manual for Leica SP2 Confocal Microscope Enter you name, the date, the time, and the account number in the user log book. Things to check before start-up. Make sure that your

More information

MULTI FLUORESCENCE AND CHEMILUMINESCENCE IMAGING SYSTEM DETECTION WITH A DIFFERENCE

MULTI FLUORESCENCE AND CHEMILUMINESCENCE IMAGING SYSTEM DETECTION WITH A DIFFERENCE MULTI FLUORESCENCE AND CHEMILUMINESCENCE IMAGING SYSTEM DETECTION WITH A DIFFERENCE REAL IMAGING FOR REAL SCIENTISTS Western blot and gel imaging remain the cornerstones of life science research. With

More information

Overview. About other software. Administrator password. 58. UltraVIEW VoX Getting Started Guide

Overview. About other software. Administrator password. 58. UltraVIEW VoX Getting Started Guide Operation 58. UltraVIEW VoX Getting Started Guide Overview This chapter outlines the basic methods used to operate the UltraVIEW VoX system. About other software Volocity places great demands on the computer

More information

The only simultaneous absorbance and f uorescence system for water quality analysis! Aqualog

The only simultaneous absorbance and f uorescence system for water quality analysis! Aqualog The only simultaneous absorbance and fluorescence system for water quality analysis! Aqualog CDOM measurements made easy. The only simultaneous absorbance and fluorescence system for water quality analysis!

More information

Confocal Application Letter No. 13. Sequential Scan for Leica TCS NT/SP systems

Confocal Application Letter No. 13. Sequential Scan for Leica TCS NT/SP systems Confocal Application Letter No. 13 Sequential Scan for Leica TCS NT/SP systems Leica Microsystems Heidelberg GmbH Im Neuenheimer Feld 518 D-69120 Heidelberg Telephone +49 6221 4148 0 Fax +49 6221 414833

More information