HPV E6,E7. Gro wth behavior and metastatic pattern of cervical cancer U14 transfected with human papillomavirus in inbred mouse

Transcription

1 BULL HUNAN MED UNIV 2001,26 (6) 515 U14 1, 2, 1, 1, 2, 1, 1, 3, 3 (1., ; 2., ; 3., ) [ ] : (HPV) U14 : HPV 16 E6,E7 U14, E6,E7 E6 + U14,E7 + U14,, : U14,E6 + U14 E7 + U14, 5 7 d,11 14 d 8 10 d ( P < 0. 05) ; 29 d,43. 3 d 35 d ; 90 %,30 % 40 % ; 60 %,10 % 20 %, d,20. 6 d 18. 3d ; : HPV U14, HPV E6,E7 [ ] ; ; U14 ; ; ; ; ;, ; [ ] R [ ] A [ ] (2001) Gro wth behavior and metastatic pattern of cervical cancer U14 transfected with human papillomavirus in inbred mouse TAO Guang2shi 1, YANG Sheng2bo 2, LIN Qiu2hua 1, et al (1. Department of Obstetrics and Gynecology, The Second Xiangya Hospital, Central South University, Changsha , China ; 2. Department of Pathonology, The Third Xiangya Hospital, Central South University, Changsha, , China) Abstract : Objective To investigate the growth behavior and metastatic pattern of murine cervix cancer U14 transfected with human papillomavirus(hpv) in inbred 6152strain mouse. Methods We transfected HPV 16 E6 and E7 genes into mouse cervix carcinoma cell strain NO. 14 (U14) by electroporation and liposome, re2 spectively. The transfectants were selected by G418, and several high2expressed HPV16 E6 and E7 clonal cell lines ( E6 + U14, E7 + U14) were detected by PCR and by immunohistochemistry. We transplanted those cells in2 to inbred 6152strain mice both subcutaneously and intraperitoneally to observe the growth behavior and metastasis of them. Results The durations of tumor appearance were 5 7 d, d, and 8 10 d after having been transplanted subcutaneously with wild type U14, E6 + U14, and E7 + U14, respectively( P < 0. 05). The mean survival times of mice were 29 d, 43 d, and 35 d, respectively. Metastasis could be found both in lymph nodes (90 %, 30 %, and 40 %, respectively) and lungs (60 %, 10 %, and 20 %, respectively). After intraperitoneal inoculation, the mean survival durations of mice were d,20. 6 d and d. We could not find metasta2 sis both in lymph nodes and lungs. Conclusion Murine cervix cancer U14 cells transfected with HPV16 E6 and E7 have different growth behavior and metastatic patterns after transplanted in inbred mice, which provide useful models for studying their immunotherapy or other strategies for cervical cancer with E6 and E7 as a target. Key words : cervical neoplasms ; cancers ; U14 ; virus ; genes ; transfection ; transplantation ; disease models, animal ; mice [Bull Hunan Med Univ, 2001,26 (6) : ] : : ( ),,,,, : ( )

2 516,2001,26 (6) (Human papillomavirus, HPV) HPV,90 % HPV DNA, 16 ( HPV16 ) 50 % [1 ] HPV,, HPV E6, E7, HPV, [2 ], HPV, HPV 615 U14 ( ) [3 ],, HPV16 E6, E7 U14, HPV U14 HPV U14, HPV ,6 7, g,, H22 H NO. 14 (U14 ) 1987, [3 ], pcb/ HPV16E6 ( pc/ E6),pRC/ CMV/ HPV16E7 ( prc/ E7) HPV16E6,E7 DNA PCR pcb prc/ CMV,pCB,pRC/ CMV, CMV DNA CPG neor [4 ] RPMI 1640 ( G418) GIBCO BRL DNA PCR Promega GIBCOBRL HPV16E6, E7 PCR HPV16E6 GIBCOBRL ABC U14 U14 [5 ] HPV16E6, E7 DNA pc/ E6, prc/ E7 DNA,,,, ;, pc/ E6,pRC/ E7 DNA, DNA E6, E7 pc/ E6, prc/ E7 U14,G418 E6 + U14 E7 + U14, [5 ] pcb,prc/ CMV TE U14 DNA, PCR A, :1 (S) 5 CAAGCAACAGTTACTGCGACG23 ; 2 ( AS ) 5 GACATAGATCGACCGGTCCAC23, HPV bp E6, 315 bp ; B, :1 (S) 5 ATGCATGGAGATA2 CACCTA23 ; 2 (AS) 5 TGGTTTCTCTGAGAACAGATG2 3, HPV bp E7, 293 bp E6 + U14 E7 + U14 U14,,0. 15 %,, HPV16E6, PBS,HPV16,, U14 E6 + U14,E7 + U14, , 16,20,20,, V = 0. 4 ab 2 [3 ] E6 + U14,E7 + U14 35 d 1, U14, U14 E6 + U14,E7 + U14, , 10 4 d,,,,

3 U14, 517, [6 ] [3 ] 1. 3 Fishs ( ) P < U14 DNA A B ( 1) E6 + U14 E7 + U14G418 U14 HPV16 E6, E6 + U14,, + ( 2) E6, E7 U14, G g. ml 21 RPMI , G418 G g. ml 21 RPMI G418 E6 + U14 E7 + U14 G418 DNA A B 315 bp 293 bp, 1 E6, E7 PCR A1 Hind III marker ; B1 U14 A PCR ; C1 U14 B PCR ;D1 E6 + U14 A PCR ; E1 E7 + U14 B PCR ;F1 PCR marker Fig. 1 Electrophoresis map of E6, E7 PCR Lane A. Hind III marker ; Lane B. Primer A PCR in U14 DNA ; Lane C. Primer B PCR in U14 DNA ; Lane D. Primer A PCR in E6 + U14 DNA ; Lane E. Primer B PCR in E7 + U14 DNA ; Lane F. PCR marker 2 E6 HPV16 E6 A. E6 + U14 3 E6 + U14 HPV16 E6 ( 400) ;B. U14 HPV16 E6 (HE 100) ( 400) Fig. 3 Pathological map of primer foci of E6 + U14 transplanted subcutaneous2 Fig. 2 Expression of HPV 16 E6 in E6 + U14 by immunohistochemistry A. ly in inbred mice (HE 100) Positive expression in E6 + U14 cells ; B1 Negative expression in U14 cells ,, 3 U14 21 d, 36 d, 29 d ; E6 + U14 32 d, 49 d, d ; E7 + U14 25 d, 41 d, 35 d, ( P < 0. 05), 100 % 5 7 d, d, 9 10 d ( P < 0. 05),,,,, U14 2,E6 + U14 E7 + U14 4 3, [3 ] ( 3) , 3 5 mm,

4 518,2001,26 (6) ( ) ( 4), E7 + U14 U14, U14 ( P = , P < ), E6 + U14 E % ; E6 + U14 E7 + U14 30 % 40 % U14, (P > 0. 50) Fishs ( ), E6 + U14 4 E6 + U14 ( 5 E6 + U14, ), (HE 100) (HE 100) Fig. 4 Pathological map of metastasis in lymph nodes of E6 + U14 transplanted Fig. 5 Pathological map of metastasis in lungs of E6 + U14 transplanted subcu2 subcutaneously in inbred mice (HE 100) taneously in inbred mice (HE 100) U14 60 %, E6 + U14 E7 + U14 10 % 20 % Fishs ( ), E6 + U14 E7 + U14 U14 E6 + U14 ( P > P > 0. 05),E6 + U14 E7 + U14, ( P > 0. 05), ( 5) 2. 4 E6 + U14 E7 + U14, 10 7 d,, 13 d 10 d, ml ; U14 5 d, 14 d, 6 d U14 [3 ] U14, [3], HPV 90 % HPV, HPV 16,18,, 80 % HPV [7] E6,E7, [8] HPV16 EGF [9],HPV16 E6 E62AP, c2myc n2myc, [10] E7 p48, INF2a, [11] p53, E6 7,,HPV E6 E7,,, E6 HPV16, E6,E7 U14,G418,PCR, E6 + U14 E7 + U14 E6 + U14 E7 + U14, U14 ; U14, ( P < 0. 05) ;,, E6, E7, [8 ], E6, E7 U14, HPV E6, E7

5 U14, 519 : [ 1 ] Borysiewicz LK, Fiander A,Nimako M, et al. A recombinant vaccinia virus encording human papillomavirus types 16 and 18, E6 and E7 pro2 teins as immunotherapy for cervical cancer [J ]. Lancet, 1996, 347 : [2 ] Hines JF1 Prospects for a vaccine against Human papillomavirus[j ]. Obstet Gynocol, 1995 ; 86 : [3 ],,. U14 [J ].,1987, 16 (2) : [4 ] Crook T, Fisher C, Phillip J, et al. Modulation of transcriptional reg2 ulatory properties of p53 by HPV E6[J ]. Oncogene, 1994, 9 : [5 ] Sambrook J, Fritsch EF, Maniatis T,.,, 1 [ T]. :, [6 ],,,. 27 (U27) [J ].,1983,12 (4) : [7 ] Durst M, Kleinheinz A, Hotz M, et al. The physical state of human papillomavirus type 16 DNA in benign and malignant genital tumors [J ]. J Gen Virol, 1985, 66 : [8 ] Beverley PCL, Sadovnikova E, Zhu X, et al. Strategies for studying mouse and human immune response to human papillomavirus type 16 [J ]. Ciba Found Symp, 1994, 187 : [9 ] Peto M, Tolle2Ersu I, Kreysch HG, et al. Epidermal growth factor induction of human papillomavirus type 16 E6/ E7 MRNA in tumor cells involves two AP21 binding sites in the viral enhancer[j ]. J Gen Virol, 1995, 76 ( Pt 8) : [10 ] Gross2Mesilaty S, Reinstein E, Bercovich B, et al. Basal and hu2 man papillomavirus E6 oncoprotein2induced degradation of myc pro2 teins by the ubiquitin pathway[j ]. Proc Natl Acad Sci U S A, : [11 ] Barnard P, McMillan NA. The human papillomavirus E7 oncoprotein abrogates signaling mediated by interferon2alpha[j ]. Virology, 1999, 259 : ( ),, (, ) [ ] ; ; [ ] R65412 [ ] B [ ] (2001) ,, :,,4, , 3,,, 2,3 /, B, Ravitch, 3, 4,,, 16,,,, ( ),, ( ), 40 min,, 2 :,,5, , 3,, 2 3 /,, 1,,,, 12 min, ( 524 ) : : ( ),,,,