E5 Proteins of Human Papillomavirus Types 11 and 16 Transactivate the c-fos Promoter through the NF1 Binding Element

Transcription

1 JOURNAL OF VIROLOGY, Dec. 1996, p Vol. 70, No X/96/$ Copyright 1996, American Society for Microbiology E5 Proteins of Human Papillomavirus Types 11 and 16 Transactivate the c-fos Promoter through the NF1 Binding Element SHOW-LI CHEN, 1 * YING-KUANG LIN, 1 LONG-YUAN LI, 1 YEOU-PING TSAO, 1 HSIANG-YUN LO, 1 WON-BO WANG, 2 AND TZUNG-CHIEH TSAI 1 Department of Microbiology & Immunology, National Defense Medical Center, 1 and Graduate Institute of Microbiology, College of Medicine, National Taiwan University, 2 Taipei, Taiwan, Republic of China Received 28 May 1996/Accepted 14 August 1996 Human papillomavirus type 11 (HPV-11) and HPV-16 contain an E5 gene that can induce c-fos gene expression in mouse fibroblasts. This study investigated the human c-fos promoter characteristics by mapping the c-fos promoter sequence with several deletion and point mutants that confer responsiveness to E5 of HPV-11 or HPV-16. The mutant studies show that NF1 binding sequences within the c-fos promoter were crucial for the induction of the c-fos gene by E5, and the gel shift assay study suggested that E5 of both HPV-11 and HPV-16 is associated, perhaps indirectly, with this NF1 element in the transactivation of the human c-fos promoter. Using an inducible system, we demonstrate that increased induction of the HPV-11 E5 gene in cells led to increased transactivation of the NF1 element. In addition, the transactivating activity of a series of HPV-11 E5 mutants on the NF1 element had a strong correlation with their respective transforming activities. * Corresponding author. Mailing address: National Defense Medical Center, Department of Microbiology and Immunology, Taipei, Taiwan, Republic of China. Phone: Fax: Human papillomaviruses (HPVs) are naturally occurring DNA tumor viruses that induce epithelial cell proliferation during the course of a productive infection. There are more than 70 types of HPV. Some, like HPV-6 and HPV-11, are generally associated with benign proliferative lesions, whereas, others, such as HPV-16 and HPV-18, are associated with malignant lesions. The E6 and E7 genes of HPV-16 and HPV-18 are responsible for in vitro immortalizing and transforming activities when assayed on primary cells (23, 38). More recent reports have also identified the E5 gene of HPV-11 and HPV-16 as a transforming oncogene when assayed in immortalized rodent cells and human keratinocytes (8, 27, 28, 36). E5 proteins of HPVs, being highly hydrophobic, are present in the membrane component of the cells (14). Some recent reports demonstrated that E5 of HPV-6 and HPV-16 can bind to the epidermal growth factor receptor (15, 24) and that E5 of HPV-16 can extend the half-life of the epidermal growth factor receptor (35). EGF receptors, along with other tyrosine kinase growth factor receptors, initiate diverse biochemical events and ultimately result in the transcription of a variety of genes, including c-jun and c-fos. Recent reports showed that the gene expression of c-jun and c-fos is constitutively activated by E5 of HPV-11 and HPV-16. Previously, we had shown that E5 induces c-jun gene expression through an AP-1 binding site (11). Hence, in this study, we further investigated the regulation mechanism of c-fos by E5 genes of HPV-11 and HPV-16. The c-fos gene encodes a transcription factor that functions as a heterodimer with members of the Jun family of proteins to control the expression of a number of inducible and repressible genes. A variety experiments have suggested that c-fos plays a critical role in the response of cells to growth factors and that aberrant production of c-fos protein can lead to oncogenesis (for a review, see reference 16). Regulation of c-fos gene expression is highly complex. In many cell types, the steady-state c-fos mrna levels are maintained at very low levels, apparently by several mechanisms. For example, the serum-responsive element, positioned 315 bp upstream of the transcriptional start site, mediates a repression mechanism that maintains a low rate of c-fos transcription (25). Additionally, AU-rich sequences present in the 3 nontranslated portion of the c-fos mrna lead to rapid translationlinked degradation (26). On the other hand, many metabolic and stress-related signals may rapidly and transiently induce the c-fos gene to high levels of transcription. Researchers have identified several regulatory cis-acting elements in the human c-fos promoter and their associated proteins (18, 19). These c-fos promoter-binding elements include the serum-responsive element, AP-1/FAP (fos AP-1-binding site), nuclear factor (NF)-like sequences, DR (direct repeats), and CREB/ATF (cyclic AMP response element). In this study, we have examined the effects of E5 of HPV-11 and HPV-16 on the human c-fos promoter transcription and mapped the regions of the c-fos regulatory sequences required for E5 activity by using a series of deletion and point mutants of the c-fos promoter. The results show that NF1 binding sequences within the c-fos promoter were crucial for the induction of the c-fos gene by E5 of both HPV-11 and HPV-16. We also demonstrated the correlation between the transforming activity and NF1 transactivating effect of HPV-11 E5 by using a series of E5 mutants. MATERIALS AND METHODS DNAs and plasmids. pc11e5 and pc16e5 are pcep4 (Invitrogen, San Diego, Calif.)-based plasmids which contain an HPV-11 E5 and HPV-16 E5 open reading frame (37) and utilize the human cytomegalovirus immediate-early gene promoter to direct HPV-11 and HPV-16 E5 gene expression. Additionally, this study used HPV-11 E5 point and deletion mutants (6, 9), which are briefly described below. Plasmid pc11e5aq was made by changing cysteine at position 73 to serine; pc11e5ac was made by changing cysteine at position 75 to serine; and pc11e5ay was made by changing cysteines at both position 73 and 75 to serines (9). We also used a deletion mutant, pc11e5at, containing only the first 34 amino acids. All these mutant fragments of HPV-11 E5 were cloned into the eucaryotic expression vector pcep4 (Invitrogen) (9). In addition, a series of c-fos promoter plasmids derived from 5 deletions ranging from 700 to 53 (relative to the mrna cap site) in the human c-fos promoter cloned upstream of the bacterial chloramphenicol acetyltransferase (CAT) reporter gene were kindly provided by Ron Prywes (18). Plasmid construction. NF1 enhancer regions were made by synthesizing the 8558

2 VOL. 70, 1996 HUMAN PAPILLOMAVIRUS E5 PROTEINS 8559 FIG. 1. Identification of HPV-11 E5 responsive sequences of the human c-fos promoter. At the top is a structure of the 5 regulatory elements of the human c-fos promoter. The various elements in the 5 regulatory sequences of c-fos are indicated as follows: SRE, serum-responsive element; AP1, fos AP-1 binding site; NF1, NF1-like binding site; DR, direct repeat; ATF, 60 cyclic AMP response element. Modification of pfc700 gave a series of plasmid with 5 deletions and an internal deletion of the human c-fos promoter as described in the text. NIH 3T3 cells were transfected with the different c-fos deletion reporter plasmids (3 g) and internal control pch110 (2 g) in the presence of pc11e5 or pcep4 (5 g). The fold activation is the ratio of the percent conversion in cotransfection experiments with the HPV-11 E5 expression vectors to the percent conversion obtained with the control vector plasmid and is the mean of three different experiments. strands for two 35-bp oligonucleotides on an Applied Biosystems DNA synthesizer. These oligonucleotides included the c-fos sequence from 184 to 162 and BamHI and PstI cohesive ends. One of the oligonucleotides (5 GATCGA ATTCGAGATTAGGACACGCGCCAAGTGCA3 ) consisted of wild-type NF1 consensus sequences (NF1), and the other (5 GATCGAATTCGAGATA CTTTCACGCTTTTTATGCA) contained destructive NF1 binding sequences. These two synthetic oligonucleotides were cloned into the pgup.pa.8 vector (kindly provided by Chen Jeou-Yuan) through their BamHI and PstI sites (see Fig. 2B) separately and resulted in pgp-nf1 and pgp-mnf1, respectively. The pgup.pa.8 vector contains a 70-bp minimal heat shock promoter downstream of a luciferase promoter (4). Sequence analysis shows that pgp-nf1 and pgpmnf1 contained only a single copy of the oligonucleotides. Transfections and CAT assay. NIH 3T3 cells and their derived cells were maintained in Dulbecco s modified Eagle s medium supplemented with 10% bovine calf serum and antibiotics. The NIH 3T3 cells were seeded at a density of 500,000 cells per 100-mm dish 24 h prior to transfection. Transfections were carried out by the calcium phosphate precipitation method with 5 g of plasmid pc11e5 (containing the HPV-11 E5 gene) or pc16e5 (containing the HPV-16 E5 gene) and 3 g of each CAT reporter plasmid. Cells were harvested 44 h after transfection. As an internal control for the variation in transfection efficiency, 2 g of pch110, a plasmid containing the Escherichia coli lacz that was used to monitor -galactosidase activity, was cotransfected with the test plasmids to normalize the CAT assay. Equal amounts of the cell lysates were incubated with 8 Ci of [ 14 C]chloramphenicol and 4 mm acetyl coenzyme A at 37 C for 30 min in a total volume of 200 l. [ 14 C]chloramphenicol and its acetylated products were separated by thin-layer chromatography, and the chromatograms were exposed to X-ray film. The conversion of chloramphenicol to the acetylated form was quantitated by liquid scintillation counting of 14 C spots on the thin-layer chromatography plate. Luciferase assay. NIH 3T3 cells ( cells) were cotransfected with 5 g of pc11e5 or pc16e5 and with 3 g of pgp-nf1 or pgp-mnf1 by the calcium phosphate method. Transfected cells were cultured for 48 h and then lysed with 100 l of1 cell culture lysis reagent (Promega) for 10 min at room temperature. After the cells were centrifuged for 5stopellet large debris, 20 l of supernatant was added to 100 l of luciferase assay reagent (Promega). Light emission was detected in a luminometer (BioOrbit, Finland). Immunoblots. Cellular proteins were extracted in sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-PAGE) loading buffer. After being boiled for 10 min, about 100 g of each crude protein lysate was separated by SDS-PAGE, transferred to a nitrocellulose filter, reacted with rabbit polyclonal antibody which was raised against a peptide corresponding to amino acids 2 to 21 mapping at the amino terminus of NF-1 of human origin (Santa Crutz), and visualized by the enhanced chemiluminescence system (Amersham) as recommended by the manufacturer. Nuclear protein extraction and gel shift assay. Nuclear protein extracts from a monolayer culture of cells were prepared as described previously (33). Sequence-specific DNA binding activity in cell nuclear extracts was assayed by gel shift assays. Assays for binding activity in nuclear extracts of cells were generally carried out in a 10- l volume containing 20 g of protein, 8 g of poly(di-dc) carrier (Pharmacia), 15 mm HEPES (N-2-hydroxyethylpiperazine-N -2-ethanesulfonic acid; ph 7.9), 15% glycerol, 50 mm KCl, 1.5 mm MgCl 2, 2 mm spermidine, 2.5 mm EDTA, and 0.37 mm dithiothreitol. After a short preincubation on ice, the radioactive end-labeled DNA probe was added and the mixture was incubated for 15 min at room temperature and then loaded onto a 6% polyacrylamide gel. In competition experiments, the unlabeled DNA, present in 25-fold molar excess, was added to the preincubation mixture. The competitors were NF1, a double-stranded synthetic oligonucleotide ( 184 to CGA GATTAGGACACGCGCCAA3 ) carrying an optimal binding site for the NF1 homolog, and mnf1 (5 CGAGATACTTTCACGCTTTTTA3 ), which carries a destructive binding site for the NF1 homolog. Complexes and unbound DNA were resolved by electrophoresis at 15 to 20 ma for 5 to 6 h. Gels were dried prior to autoradiography. RESULTS E5 of HPV-11 and HPV-16 can activate the NF1 element in the c-fos promoter. To map the c-fos promoter, we assayed for the inducibility of HPV-11 E5 by using a series of plasmids derived from 5 deletions ranging from 700 to 53 (relative to the mrna cap site) in the human c-fos promoter. Each 3 g of the 5 deletions, containing 700 bp (pfc700), 363 bp (pfc363), 225 bp (pfc225), 99 bp (pfc99), 72 bp (pfc72), or 53 bp (pfc53) of 5 -flanking sequences (19), was cloned upstream of the bacterial CAT reporter gene and cotransfected with either 5 g of pc11e5 or 5 g of pcep4 into NIH 3T3 cells by the calcium phosphate precipitation method. After 44 h, the cells were harvested and assayed for CAT activity. Plasmid pc11e5 is an HPV-11 E5-expressing vector, and pcep4 acts as a control plasmid vector. We included an internal control plasmid pch110 (2 g) in every transfection to allow normalization for transfection efficiency in the subsequent analysis. Basal activities of pfc700, pfc363, pfc225, pfc99, and pfc53 in NIH 3T3 cells transfected with the pcep4 vector were 4.4, 5.2, 5.4, 0.63, 0.53, and 0.36% acetylation, respectively, from three independent experiments (data not shown). The induced activities by the HPV-11 E5 gene for these deletion mutants were 26.8, 31.2, 27.5, 1.1, 0.5, and 0.32% acetylation, respectively (data not shown). Figure 1 summarizes the results. The average inductions by E5 for plasmids pfc700, pfc363, and pfc225 were 6.1-, 6.0-, and 5.1- fold, respectively, whereas the constructs deleted to 99, 72, 53 (pfc99, pfc72, and pfc53) led to a decrease in activity to the basal level. The additional internal deletion mutant pfc , a deletion derivative of pfc700 lacking sequences between 225 and 99, also caused a drop in the basal level of expression. Interestingly, this region contains an

3 8560 CHEN ET AL. J. VIROL. FIG. 2. Effect of HPV-11 and HPV-16 E5 on the c-fos NF1 binding site. (A) The fragment from nucleotides 225 to 99 of the c-fos promoter was cloned upstream of the CAT reporter plasmid containing the adenovirus E2A promoter (pe30). NIH 3T3 cells were transfected with reporter plasmids and internal control in the presence of pc11e5 or pc16e5. The fold activation was calculated as described in the legend to Fig. 1. (B) Plasmids pgp-nf1 and pgp-mnf1 are shown on the left. Double-stranded synthetic oligonucleotides NF1 and mutant NF1 (mnf1) were cloned into the pgup.pa8 vector, which contains a 70-bp minimal heat shock promoter (HSP) downstream of the luciferase gene (LUC). Transactivating effects of HPV-11 and HPV-16 E5 on the NF1 and mutant NF1 elements were calculated as above and are described on the right. The underlines in the NF1 sequence represent consensus NF1 binding sequences, and the underlines in the mnf1 sequence represent destructive NF1 binding sequences. NF1-like binding site (33). Deletion of the NF1 binding site (from pfc225 to pfc99) in the E5-induced and basal activities of the c-fos promoter led to a 27-fold reduction (27.5%/1.1% acetylation) and a 9-fold reduction (5.4%/0.63% acetylation), respectively. This result indicates that the NF1 site of the c-fos promoter can be activated threefold by the E5 gene; hence, the NF1-containing region between bp 225 and 99 was responsible for the induction of the c-fos promoter by E5. Previously, E5 of HPV-16 was shown to induce gene expression of c-fos (2, 27); we also found that the c-fos gene was constitutively activated in the NIH 3T3 cells expressing HPV-16 E5 protein (data not shown). To further examine that the sequences between 225 and 99 were indeed responsive to E5 of HPV-11 and HPV-16, we assayed for the inducibility of E5 by using a series of plasmids containing the upstream region of the c-fos promoter from nucleotides 225 to 99 (containing the NF1 element) linked to the adenovirus E2A promoter (pe30) (29). These plasmids were also cotransfected similarly with control vector or with vectors expressing either HPV-11 E5 or HPV-16 E5. Figure 2A presents the data from three experiments and demonstrates that the average activation of p E30 by E5 of HPV-11 and HPV-16 was 5.0- and 5.6-fold, respectively. To identify that the NF1 element is the only cis-acting element in the human c-fos promoter to be activated by E5, we constructed 35-bp NF1 oligonucleotides carrying an optimal binding site for the NF1 homolog, and mutant 35-bp NF1 oligonucleotides carrying a destructive binding site for NF1 into pgup.pa8, which were named pgp-nf1 and pgp-mnf1, respectively. The pgup.pa8 vector contains a 70-bp minimal heat shock promoter downstream of a luciferase reporter gene. The luciferase assay was performed by cotransfection of the HPV-11 or HPV-16 E5 expression vector with these constructed NF1 or mnf1 reporter genes separately. Figure 2B shows that the element containing the NF1 responsive element was important for the activation of the c-fos promoter by E5 of HPV-11 and HPV-16. The NF1 element can be activated by E5 in a zinc-inducible system. We previously demonstrated that NE5a1 cells (NIH 3T3 fibroblasts containing the HPV-11 E5 gene) have a transformed morphology, exhibit anchorage-independent growth, and are tumorigenic in nude mice (36). NE5a1 cells contain the HPV-11 E5 gene under the control of the mouse metallothionein promoter, in which expression of the E5 gene can be induced by zinc treatment (36). In this system, although a substantial level of E5 gene expression was driven by the metallothionein promoter in NE5a1 cells without zinc treatment, exposure of these cells to zinc led to further augmentation of E5 expression (11). Using this zinc-inducible system, we have shown that the induction of the c-jun gene expression, which is one of the biological effect of E5, is proportional to the concentration of E5 (11). To establish whether E5 of HPV-11 transactivated the NF1 element, we also used this inducible system and assayed the activity of the NF1 element. Plasmid pgp-nf1 DNA (3 g) was transfected into NE5a1 cells; 40 h later, the cells were exposed to 100 M zinc chloride for 3 h, and promoter activity was then determined by the luciferase assay. Results indicate that although baseline expression of HPV-11 E5 driven by the basal metallothionein promoter already transactivated the NF1 element in NE5a1 cells, zinc induction of HPV-11 E5 gene expression led to further transactivation of the NF1 element (Fig. 3). In addition, NF1 element activity was not affected by zinc treatment in the control cells. These kinetic observations provide convincing evidence that HPV-11 E5 can activate NF1 activity. NF1 transactivating activity by E5 is correlated with its transforming activity. To further establish the transactivating activity of NF1 by E5, we investigated the effect of several HPV-11 E5 mutants on NF1 element activity by cotransfection FIG. 3. The NF1 element can be activated by HPV-11 E5 in an inducible system. NE5a1 cells are NIH 3T3 cells containing an HPV-11 E5 gene which is regulated by the mouse metallothionein promoter. The luciferase reporter plasmid (pgp-nf1; 3 g) was transfected into NIH 3T3 cells and NE5a1 cells with or without treatment with 100 M zinc chloride. Luciferase activities were measured in three independent transfection experiments.

4 VOL. 70, 1996 HUMAN PAPILLOMAVIRUS E5 PROTEINS 8561 cells (lane 8), compared with the control cells (lane 2). The gel shift analyses were also performed with a 25-fold molar excess of unlabeled doubled-stranded synthetic NF1 oligonucleotides ( 184 to 162, 5 CGAGATTAGGACACGCGCCAA3 ) (lanes 3, 6, and 9) or mutant NF1 oligonucleotides (5 CGAG ATACTTTCACGCTTTTTA3 ) (lanes 4, 7, and 10) as competitors in Vneo cells (lanes 2 to 4), W11E5 cells (lanes 5 to 7), and W16E5 cells (lanes 8 to 10). The results show that the decrease in the band shift activity was due to the competitive binding of the synthetic NF1 strands (lanes 3, 6, and 9) but not mutant NF1 strands (lanes 4, 7, and 10), suggesting that the NF1 sequence element, the region spanning from 184 to FIG. 4. Transactivation by HPV-11 E5 mutants on the NF1 activity. Luciferase reporter plasmid (pgp-nf1; 3 g) was transiently cotransfected with wild-type HPV-11 E5 or E5 mutants into NIH 3T3 cells. E5a, wild-type HPV-11 E5; V, vector; T, deletion mutant containing the first 34 amino acids of E5; Q, point mutant with a substitution of Ser for Cys-73; C, point mutant with a substitution of Ser for Cys-75; Y, mutant with substitutions of Ser for both Cys-73 and Cys-75. Transforming activities of E5 and E5 mutants are shown at the bottom. of HPV-11 E5 mutants (5 g) and pgp-nf1 constructs (3 g). As shown in Fig. 4, mutant T, an HPV-11 E5 deletion mutant, completely lacks transformation activity (9) and could not activate NF1 element activity. Mutants of HPV-11 E5 with point mutations (such as mutants Q, Y, and C) preserve their transformation activities to different degrees (9). Cotransfecting with pgp-nf1 constructs reveals that activating NF1 by E5 mutants of HPV-11 appeared to be proportional to their transformation activities. This result implies that the mechanism of E5 activation of NF1 element activity may be related to the transformation mechanism of HPV-11 E5. Gel shift assay. The responsiveness of the c-fos promoter to E5 suggests that E5 may act through a mechanism that is not sequence specific and that E5 may influence multiple transcription factors. Since the E5 proteins of HPV are hydrophobic proteins that are probably more closely associated with the membrane, direct binding of E5 to their target sequence is highly unlikely. The indirect effect of E5 proteins on their target sequence further complicated the nature of the interaction between E5 and transcription factors. First, we generated E5-containing NIH 3T3 cells. Plasmids pc11e5 (containing the HPV-11 E5a gene), pc16e5 (containing the HPV-16 E5 gene), and pcep4 vector were separately transfected into NIH 3T3 cells by calcium phosphate transfection, and colonies were selected for resistance to G418 (500 g/ml). After 3 weeks, at least 80 G418-resistant colonies were pooled and stable cell lines were generated; these were generally analyzed within a few passages after their derivation (9, 37). Cells expressing the HPV-11 E5 and HPV-16 E5 genes were named W11E5 and W16E5, respectively. Control cells containing the vector only were named Vneo. To examine if E5 of HPV-11 and HPV-16 can affect the binding of transcription factors to the NF1 sequence, we performed gel shift analyses with nuclear extracts from W11E5 cells, W16E5 cells, and Vneo cells. We also radiolabeled DNA fragments from bp 225 to 99 in the human c-fos promoter. Figure 5A shows (the data are from one of three independent experiments) that there was an increase in the DNA binding activity from nuclear extracts of HPV-11 E5-transformed cells (lane 5) and HPV-16 E5-transformed FIG. 5. Gel shift analysis of NF1 in HPV-11 and HPV-16 E5-transfected cell extracts. The gel shift assay was performed as described in Materials and Methods. (A) Labeled NF1 containing probe (from 225 to 99 of the human c-fos promoter) was incubated with nuclear extracts of Vneo cells (vector-containing cells) (lanes 2 to 4), W11E5 cells (HPV-11 E5-expressing cells) (lanes 5 to 7), and W16E5 (HPV-16 E5-expressing cells) (lanes 8 to 10) or without nuclear extracts (lane 1). In experiments in lanes 3, 6, and 9, a 25-fold molar excess of nonradioactive synthetic oligonucleotides of NF1 was included in the incubation reaction. In experiments in lanes 4, 7, and 10, a 25-fold molar excess of nonradioactive synthetic oligonucleotides of mutant NF1 (see the text) was included in the incubation reaction. (B) Labeled NF1-containing probe (from 225 to 99 of the human c-fos promoter) was incubated with nuclear extracts of Vneo cells (vector-containing cells) (lanes 1 and 2), W11E5 cells (HPV-11 E5-expressing cells) (lanes 3 and 4), and W16E5 (HPV-16 E5-expressing cells) (lanes 5 to 9). In experiments in lanes 2, 4, 6, and 9, cell extracts were preincubated with 4 g of anti-nf1 antibody (Santa Cruz) for 1hat4 C before probes were added. In the experiment in lane 8, cell extracts were preincubated with 4 g of anti-c-jun antibody (Santa Cruz).

5 8562 CHEN ET AL. J. VIROL. FIG. 6. The amounts of NF1 protein do not increase in HPV-11 E5- and HPV-16 E5-transformed cells. NF1 protein was measured by immunoblot analysis with rabbit polyclonal anti-nf1 antibody (Santa Cruz). Lanes: W11E5, NIH 3T3 cells containing the HPV-11 E5 gene; W16E5, NIH 3T3 cells containing the HPV-16 E5 gene; Vneo, NIH 3T3 cells containing vector only. 162, is indirectly associated with E5 and might mediate the transactivation by E5 of HPV-11 and HPV-16. The mean NF1 binding activity by HPV-11 E5 and HPV-16 E5 from these three independent experiments was four- and sixfold, respectively, as quantitated with a Molecular Dynamics densitometer. Figure 5B shows the decreased band shift activities obtained by preincubating anti-nf1 antibody (Santa Cruz) with nuclear extracts of Vneo (lane 2), W11E5 (lane 4), and W16E5 (lanes 6) cells. We also performed a gel shift assay by preincubating nonspecific c-jun antibody (Oncogene Science) with nuclear extracts of W16E5 cells (lane 8). The result indicates that both HPV-11 and HPV-16 E5-induced shifts are actually due to NF1 and not to an unrelated factor that happens to bind to the NF1 site. Moreover, to determine whether the increased NF1 seen on gel shift assays represents an increase in the levels of NF1 protein, we measured the levels of NF1 protein by Western blotting. Figure 6 shows that the amount of NF1 protein did not increase in HPV-11 E5- and HPV-16 E5-transformed cells compared with the control cells. Hence, Figure 5 shows fourand sixfold NF1 binding activity by HPV-11 E5 and HPV-16 E5, respectively, suggesting that E5 of HPV-11 and HPV-16 increases only the activation of DNA binding of NF1, not the levels of protein. DISCUSSION Mutation, in vitro DNA binding assays, and competition analysis demonstrate that the NF1 sequences (bp 184 to 162 of the human c-fos promoter) bound NF1 in both HPV- 11 and HPV-16 E5-transformed nuclear cell extracts. This is the first demonstration that the NF1 sequence element mediates the activation of the human c-fos gene by the E5 of both HPV-11 and HPV-16. Furthermore using an inducible system, we demonstrated that increased induction of the HPV-11 E5 gene in cells led to increased transactivation of the NF1 element. The transactivating activity of a series of HPV-11 E5 mutants on the NF1 element had a strong correlation with their respective transforming activity. NF1 is a sequence-specific DNA binding protein that was originally isolated from nuclear extracts of uninfected HeLa cells and is required for the in vitro replication of adenovirus DNA (5, 20). Also, the NF1 element exists in enhancers and promoters from multiple cellular genes (21) as well as viral genes (1, 31). The carboxyl-terminal portion of NF1 contains a proline-rich transcriptional activation domain that is responsible for increasing transcription initiation when bound to DNA (20, 30). In several inducible systems, the NF1 element contributes to inducible transcriptional activation and is frequently found clustered with binding sites for other transcription factors such as AP-1 and steroid hormone receptors (1). In some cases, such as in Xenopus laevis, the estrogen-induced transcription of the vitellogenin gene requires not only the NF1 site but also the estrogen-responsive element (31). Efficient glucocorticoid induction of the transcription of the mouse mammary tumor virus enhancer is also dependent on an intact NF1 site, which lies between the glucocorticoid-responsive element and other promoter elements (31). The NF1 element seems to cooperate with inducible promoter elements to increase transcriptional efficiency. The importance of NF1 in viral gene expression also emerges from the findings that this protein binds and activates a large fraction of the viral regulatory elements. For example, NF1 activates the hepatitis B virus S promoter (34), the promoter of the cytomegalovirus major immediate-early gene (22), the late promoter of the human polyomavirus BK (3), the feline leukemia virus long terminal repeat (32), and the enhancer of HPV-11 and HPV-16 (13, 17). Several binding sites for ubiquitous transcription factors can activate the enhancer of HPV-11 and HPV-16, such as six or seven of these binding sites for NF1, one or two for AP-1, and one each for the progesterone and the glucocorticoid receptor (12). NF1 in E5-transformed cell extracts may have the same effect on cells as NF1. The E5 gene of HPV-11 and the E5 gene of HPV-16 were previously shown to activate AP-1 molecules (2, 7, 11); the present study demonstrates that E5 of HPV-11 and E5 of HPV-16 could activate NF1. This activation suggests that E5 may have several promoting effects on HPV gene expression. The understanding of the biochemical properties of the E5 protein now extends to its multifunctionality in the interaction between the factors and their binding sites of the HPV-11 or HPV-16 promoter/enhancer. The significance of those interactions on viral transcription during the normal viral life cycle is issues remains to be established. The results reported in our previous papers and in this paper indicate that E5 proteins of HPV-11 and HPV-16 have similar biochemical properties (7, 10, 11, 37); are involved in a complex network that includes the specific activation of c-jun,c-fos, and junb; and can inactivate tumor suppressor gene p21 (37) which could be a step in a cascade of molecular events required for transformation by E5 proteins. ACKNOWLEDGMENTS We thank Chen Jeou-Yuan for providing plasmid pgup.pa8 and Ron Prywes for providing a series of deletion mutants of the human c-fos promoter. This research was supported by the National Science Council (NSC B ), Taipei, Taiwan, Republic of China. REFERENCES 1. Amemiya, K., R. Traub, L. Durham, and E. O. Major Adjacent nuclear factor-1 and activator protein binding sites in the enhancer of the neurotropic JC virus. J. Biol. Chem. 267: Bouvard, V., G. Matlashewski, Z. M. Gu, A. Storey, and L. Banks The human papillomavirus type 16 E5 gene cooperates with the E7 gene to stimulate proliferation of primary cells and increases viral gene expression. Virology 203:73 80.

6 VOL. 70, 1996 HUMAN PAPILLOMAVIRUS E5 PROTEINS Chakraborty, T., and G. C. Das Proteins of the nuclear factor 1 family act as an activator of the late promoter in human polyomavirus BK in vitro. J. Gen. Virol. 72: Chen, J. Y., W. D. Funk, W. E. Wright, J. W. Shay, and J. D. Minna Heterogeneity of transcriptional activity of mutant p53 proteins and p53 DNA target sequences. Oncogene 8: Chen, M., N. Mermod, and M. S. Horwitz Protein-protein interactions between adenovirus DNA polymerase and nuclear factor 1 mediate formation of the DNA replication preinitation complex. J. Biol. Chem. 265: Chen, S. L., C. P. Han, and Y. P. Tsao Construction of site-specific mutants of E5a protein of HPV-11 by polymerase chain reaction and a single mutant primer. J. Virol. Methods 42: Chen, S. L., C. H. Huang, T. C. Tsai, K. Y. Lu, and Y. P. Tsao The regulation mechanism of c-jun and junb by human papillomavirus type 16 E5 oncoprotein. Arch. Virol. 141: Chen, S. L., and P. Mounts Transforming activity of E5a protein of human papillomavirus type 6 in NIH 3T3 cells and C127 cells. J. Virol. 64: Chen, S. L., T. C. Tsai, C. P. Han, and Y. P. Tsao Mutational analysis of human papillomavirus type 11 E5a oncoprotein. J. Virol. 70: Chen, S. L., Y. P. Tsao, J. W. Lee, H. S. Liu, C. M. Yang, and L. T. Tsao E5a gene of human papillomavirus type 11 is required for initiation but not maintenance of transformation in NIH 3T3 cells. J. Gen. Virol. 75: Chen, S. L., Y. P. Tsao, C. M. Yang, Y. K. Lin, C. H. Huang, and S. W. Kuo Differential induction and regulation of c-jun, junb, jund and c-fos by human papillomavirus type 11 E5a oncoprotein. J. Gen. Virol. 76: Chong, T., D. Apt, B. Gloss, M. Isa, and H. U. Bernard The enhancer of human papillomavirus type 16: binding sites for the ubiquitous transcription factor oct-1, NFA, TEF-2, NF1, and AP-1 participate in epithelial cell-specific transcription. J. Virol. 65: Chong, T., W. K. Chan, and H. U. Bernard Transcriptional activation of human papillomvirus type 16 by nuclear factor 1, AP1, steroid receptors and a possibly novel transcription factor, PVF: a model for the composition of genital papillomavirus enhancers. Nucleic Acids Res. 18: Conrad, M., V. J. Bubb, and R. Schlegel The human papillomavirus type 6 and 16 E5 proteins are membrane-associated proteins which associate with the 16-kilodalton pore-forming protein. J. Virol. 67: Conrad, M., D. Goldstein, T. Andresson, and R. Schlegel The E5 protein of HPV-6, but not HPV-16, associates efficiently with cellular growth factor receptors. Virology 200: Curran, T The fos oncogene, p In E. P. Reddy, A. M. Skalka, and T. Curran (ed.), The oncogene handbook. Elsevier Biomedical Press, Amsterdam. 17. Dollard, S. C., T. R. Broker, and L. T. Chow Regulation of the human papillomavirus type 11 E6 promoter by viral and host transcription factors in primary keratinocytes. J. Virol. 67: Fisch, T., R. Prywes, and R. G. Roeder c-fos sequences necessary for basal expression and induction by epidermal growth factor, 12-O-tetradecanoyl phorbol-13-acetate, and the calcium inophore. Mol. Cell. Biol. 9: Gilman, M. Z The c-fos serum response element responds to protein kinase C-dependent and independent signals but not to camp. Genes Dev. 3: Gounari, F., R. de Francesco, J. Schmitt, P. C. van der Vliet, R. Cortese, and H. Stunnenberg Amino-terminal domain of NF-1 binds to DNA as a dimer and activates adenovirus DNA replication. EMBO J. 9: Grewal, T., M. Theisen, U. Borgmeyer, T. Grussenmeyer, R. A. W. Rupp, A. Stief, F. Qian, A. Hecht, and A. E. Sippel The 6.1-kb chicken lysozyme enhancer is a multifactorial complex containing several cell-specific elements. Mol. Cell. Biol. 12: Hennighausen, L., and B. Fleckenstein Nuclear factor 1 interacts with five DNA elements in the promoter region of the human cytomegalovirus major immediate early gene. EMBO J. 5: Howley, P. M Role of the human papillomaviruses in human cancer. Cancer Res. 51(Suppl.):5019s 5022s. 24. Hwang, E. S., T. Nottoli, and D. DiMaio The HPV16 E5 protein: expression, detection, and stable complex formation with transmembrane proteins in COS cells. Virology 211: Konig, H., H. Ponta, U. Rahmsdorf, M. Buscher, A. Schonthal, H. J. Rahmsdorf, and P. Herrlich Autoregulation of fos: the DSE as the major target of repression. EMBO J. 8: Lamb, N. J. C., A. Fernandez, N. Tourkine, P. Jeanteur, and J. M. Blanchard Demonstration in living cells of an intragenic negative regulatory element within the rodent c-fos gene. Cell 61: Leechanachai, P., L. Banks, F. Moreau, and G. Matlashewski The E5 gene from human papillomavirus type 16 is an oncogene which enhances growth factor-mediated signal transduction to the nucleus. Oncogene 7: Leptak, C., S. R. Cajal, R. Kulke, B. H. Horwitz, D. J. Rises II, G. P. Dotto, and D. DiMaio Tumorigenic transformation of murine keratinocytes by the E5 genes of bovine papillomavirus type 1 and human papillomavirus type 16. J. Virol. 65: Loeken, M. R., and J. Brady The adenovirus EIA enhancer. J. Biol. Chem. 264: Mermod, N., E. A. O Neill, T. J. Kelly, and R. Tjian The proline-rich transcriptional activator of CTF/NF-1 is distinct from the replication and DNA binding domain. Cell 58: Nowock, J., U. Borgmeyer, A. W. Püschel, R. A. W. Rupp, and A. E. Sippel The TGGCA protein binds to the MMTV-LTR, the adenovirus origin off replication, and the BK virus enhancer. Nucleic Acids Res. 13: Plumb, M., R. Fulton, L. Breimer, M. Stewart, K. Willison, and J. C. Neil Nuclear factor 1 activates the feline leukemia virus long terminal repeat but is posttranscriptionally down-regulated in leukemia cell lines. J. Virol. 65: Runkel, L., P. E. Shaw, P. E., R. E. Herrera, R. A. Hipskind, and A. Nordheim Multiple basal promoter elements determine the level of human c-fos transcription. Mol. Cell. Biol. 11: Shaul, Y., R. Ben-levy, and T. De Medina High affinity binding site for nuclear factor 1 next to the hepatitis B virus S gene promoter. EMBO J. 5: Straight S. M., P. M. Hinkle, R. J. Jewers, and D. J. McCance The E5 oncoprotein of human papillomavirus type 16 transforms fibroblasts and effects the downregulation of the epidermal growth factor receptor in keratinocytes. J. Virol. 67: Tsao, Y. P., T. Y. Chu, T. M. Chen, Y. F. Yang, and S. L. Chen The effects of E5a and E7 genes of human papillomavirus type 11 on immortalized human epidermal keratinocytes and NIH 3T3 cells. Arch. Virol. 138: Tsao, Y. P., L. Y. Li, T. C. Tsai, and S. L. Chen Human papillomavirus type 11 and 16 E5 represses p21 WafI/SdiI/CipI gene expression in fibroblasts and keratinocytes. J. Virol. 70: zur Hausen, H Human papillomaviruses in the pathogenesis of anogenital cancer. Virology 184:9 13.