Analysing data from Illumina BeadArrays
|
|
- Scot Russell
- 5 years ago
- Views:
Transcription
1 The bead Analysing data from Illumina BeadArrays Each silica bead is 3 microns in diameter Matt Ritchie Department of Oncology University of Cambridge, UK 4th September ,000 copies of same probe sequence are covalently attached to each bead for hybridisation & decoding Can have more than one bead for a particular gene * Bead preparation and array production Beads in wells Bead pools produced containing 384 to 4,000 bead types Wells created in either fibre optic bundle (hexagon) or chip (rectangle) Beads self-assemble into wells to form randomly arranged array of beads Average of 30 beads of each type (adds robustness) Each array produced separately SAM - Sentrix Array Matrix Decoding process Beads get assigned random locations on each array. Need to know what type every bead is Decoding is achieved by series of sequential hybridisations* 0 0 Each bead type defined by unique DNA sequence that is recognised by a complementary decoder Process is highly effective (error rate < x 0-4 per bead) * Gunderson et al. Decoding randomly ordered DNA arrays. Genome Research, May arrays processed in parallel each array contains ~ 500 bead types
2 BeadChip Advantages Random placement of beads High number of within array replicates - robustness High throughput studies possible (eg HapMap) RefSeq BeadChip 8 arrays per chip strip = array 4,000 bead types from RefSeq database x 30 reps on each array Whole Genome 6 arrays per chip: strips = array 48,000 bead types on each array (4,000 RefSeq + 4,000 supplementary) Expression, genotyping and methylation variants possible Lower cost Data analysis array.locs files Scanning (BeadScan) Image analysis (BeadScan) Summarisation (BeadScan) Quality assessment (BeadStudio) Normalisation (BeadStudio) Downstream analysis (BeadStudio) TIFFs.txt files.idat files summary.txt Raw data Illumina s scanning software (BeadScan) produces files (.idat,.locs etc) in proprietary format which are read by Illumina s BeadStudio software However, with modifications to BeadScan, you can obtain standard (readable) files for each array on a SAM or strip on a BeadChip - Text file giving the identity and location of each individual bead (~ 50,000 rows for each SAM ~. million for each strip/array on a BeadChip) [required] -TIFF images [optional] We refer to the text and TIFF files as the bead-level data for an array Example: Bead-level text files TIFF images ProbeID Bead Centre Background corrected intensity Information for all* beads on an array Can use bead centres to re-calculate intensities *Sometimes outliers or non-decoded beads are removed
3 Image analysis Foreground signal = average over 9 pixels for each bead Background calculated using a 7 x 7 window around each bead Local background = average of the 5 minimum pixels ( ) within each window Background correction carried out by BeadScan: Foreground - Background For two-colour spotted arrays, background correction in this way can be disastrous! Spike-in data set Mouse 6 version BeadChips Arrays include 33 spike probes Each array hybridised with the same RNA sample + spike 000pM 300pM 00pM 30pM 0pM 3pM x 4 pm 0.3pM 0.pM 0.03pM 0.0pM 0pM x 4 Concentration series Raw data Foreground Background log (intensity) 3pM vs pm pm vs 0.3pM 3
4 Concentration series Quality assessment - image plot scanning problem - values down one edge censored at 0 4-7% of beads affected - successfully detected as outliers Question: How many outliers can Illumina s summarisation method handle before we need to think about removing an array? Simulation of corrupted data Background normalisation bias variance % outliers simulated 3pM vs pm Use of variability in DE analysis Summarise data from replicate beads on the log -scale (mean and variance) Use inverse of bead variances as weights in differential expression (DE) analysis log-odds Assess DE with and without (treat all observations equally) weights 4
5 Recommendations Illumina s local background correction and summarisation methods perform well We do not currently recommend Illumina s background normalisation (now referred to as subtract background option in BeadStudio - not to be confused with local background subtraction refereed to above, which is not optional) We do not recommend exporting gene summary data from BeadStudio, as the results are averaged over (sometimes) misannotated probes. We prefer probe summary output. Access to bead-level data enables - more detailed quality assessment - calculation of means and variances on the appropriate scale The beadarray package from Bioconductor can process bead-level or summary-level data in R. We have used limma for DE analysis. Current and future work improved annotation (for next Bioconductor release) automatic artefact detection and removal tool (BASH) exploring data from two-colour technologies apply crlmm to Illumina Infinium II genotyping data Acknowledgements Tavaré Lab Mark Dunning Andy Lynch Nuno Barbosa-Morais Jonathan Cairns Mike Smith Simon Tavaré Genomics Core James Hadfield Michelle Osborne Illumina (San Diego) Semyon Kruglyak Gary Nunn UCSD (San Diego) Roman Sasik WEHI (Melbourne) Wei Shi Gordon Smyth References. KL Gunderson, S Kruglyak, et al. Decoding randomly ordered DNA arrays. Genome Res, 4(5): , 004. K Kuhn, SC Baker, et al. A novel, high-performance random array platform for quantitative gene expression profiling. Genome Res, 4(): , M Barnes, J Freudenberg, et al. Experimental comparison and cross-validation of the Affymetrix and Illumina gene expression analysis platforms. Nucleic Acids Res, 33(8): , MJ Dunning, ML Smith, et al. beadarray: R classes and methods for Illumina beadbased arrays, Bioinformatics, 3(6):83-4, MJ Dunning, NL Barbosa-Morais, et al. Statistical issues in the analysis of Illumina data. BMC Bioinformatics, 9:85, MJ Dunning, ME Ritchie, et al. Spike-in validation of an Illumina-specific variancestabilizing transformation. BMC Research Notes, :8, Illumina probe reannotation: Accessing bead-level data Bead-level text and tiff files can usually be obtained by modifying the following lines in the settings.xml file used by BeadScan (the entries below are typically be set to their opposites, i.e. true -> false, and false -> true): <SavePerBeadFiles>true</SavePerBeadFiles> <SaveTextFiles>true</SaveTextFiles> <ExcludeOutliers>false</ExcludeOutliers> <IncludeXY>true</IncludeXY> 5
The Bead. beadarray: : An R Package for Illumina BeadArrays. Bead Preparation and Array Production. Beads in Wells. Mark Dunning -
beadarray: : An R Package for Illumina BeadArrays Mark Dunning - md392@cam.ac.uk PhD Student - Computational Biology Group, Department of Oncology - University of Cambridge Address The Bead Probe 23 b
More informationAnalysing Illumina bead-based data using beadarray
Analysing Illumina bead-based data using beadarray Mark Dunning 6th August 2007 The Bead Each silica bead is 3 microns in diameter 700,000 copies of same probe sequence are covalently attached to each
More informationQUALITY CONTROL AND LOW-LEVEL STATIS- TICAL ANALYSIS OF ILLUMINA BEADARRAYS
REVSTAT Statistical Journal Volume 4, Number 1, March 2006, 1 30 QUALITY CONTROL AND LOW-LEVEL STATIS- TICAL ANALYSIS OF ILLUMINA BEADARRAYS Authors: Mark J. Dunning Department of Oncology, University
More informationComputational Genomics. High-throughput experimental biology
Computational Genomics 10-810/02 810/02-710, Spring 2009 Gene Expression Analysis Data pre-processing processing Eric Xing Lecture 15, March 4, 2009 Reading: class assignment Eric Xing @ CMU, 2005-2009
More informationFeature Level Data. Outline. Affymetrix GeneChip Design. Affymetrix GeneChip arrays Two color platforms
Feature Level Data Outline Affymetrix GeneChip arrays Two color platforms Affymetrix GeneChip Design 5 3 Reference sequence TGTGATGGTGCATGATGGGTCAGAAGGCCTCCGATGCGCCGATTGAGAAT GTACTACCCAGTCTTCCGGAGGCTA
More informationQuality control of microarrays
Quality control of microarrays Solveig Mjelstad Angelskår Intoduction to Microarray technology September 2009 Overview of the presentation 1. Image analysis 2. Quality Control (QC) general concepts 3.
More informationSteps involved in microarray analysis after the experiments
Steps involved in microarray analysis after the experiments Scanning slides to create images Conversion of images to numerical data Processing of raw numerical data Further analysis Clustering Integration
More informationMicroarray Data Pre-processing. Ana H. Barragan Lid
Microarray Data Pre-processing Ana H. Barragan Lid Hybridized Microarray Imaged in a microarray scanner Scanner produces fluorescence intensity measurements Intensities correspond to levels of hybridization
More informationAssessments Using Spike-In Experiments
Assessments Using Spike-In Experiments Rafael A Irizarry, Department of Biostatistics JHU rafa@jhu.edu http://www.biostat.jhsph.edu/~ririzarr http://www.bioconductor.org A probe set = 11-20 PM,MM pairs
More informationPackage beadarrayfilter
Type Package Package beadarrayfilter Title Bead filtering for Illumina bead arrays Version 1.1.0 Date 2013-02-04 February 19, 2015 Author Anyiawung Chiara Forcheh, Geert Verbeke, Adetayo Kasim, Dan Lin,
More informationGenePix Application Note
GenePix Application Note Biological Relevance of GenePix Results Shawn Handran, Ph.D. and Jack Y. Zhai, Ph.D. Axon Instruments, Inc. 3280 Whipple Road, Union City, CA 94587 Last Updated: Aug 22, 2003.
More informationProbe set (Affymetrix( Affymetrix) PM MM. Probe pair. cell. Gene sequence PM MM ACCAGATCTGTAGTCCATGCGATGC ACCAGATCTGTAATCCATGCGATGC 08/07/2003 1
Probe set (Affymetrix( Affymetrix) cell Probe pair PM MM Gene sequence PM MM ACCAGATCTGTAGTCCATGCGATGC ACCAGATCTGTAATCCATGCGATGC 08/07/2003 1 MAS 5.0 output Detection p-value which is evaluated against
More informationGALILEO TMA CK 4500 HTS Tissue Microarray Platform
GALILEO TMA CK 4500 HTS Tissue Microarray Platform Tissue Microarray (TMA) A Block Of Samples From Hundreds Of Blocks (S. M. Hewitt, M.D., Ph.D., Tissue Array Research Program, LP, CCR, NCI, NIH) TMA technology
More informationDeveloped by BioDiscovery, Inc. DualChip evaluation software User Manual Version 1.1
Developed by BioDiscovery, Inc. DualChip evaluation software User Manual Version 1.1 1 Table of contents 1. INTRODUCTION...3 2. SCOPE OF DELIVERY...4 3. INSTALLATION PROCEDURES...5 3.1. SYSTEM REQUIREMENTS...
More informationMultiplexing as Essential Tool for Modern Biology
Multiplexing as Essential Tool for Modern Biology Bio-Plex Seminar, Debrecen, 2012. Gyula Csanádi, PhD. The "Age of "-omics" Studying interrelationships at different level of complexity Genes - Unveiling
More informationOverview of NGS Errors Working Group
Overview of s Working Group Or...My Declaration of War on the Bioinformatics Pipeline K. S. Dorman Department of Statistics and Genetics, Development & Cell Biology SAMSI - Beyond Bioinformatics May 11
More informationAutomated cdna microarray image segmentation
Automated cdna microarray image segmentation Author Liew, Alan Wee-Chung, Yan, Hong Published 2007 Conference Title Proceedings of the International Symposium on Computational Models for Life Sciences
More informationDeliverable D3.1 Set of specifications for the selected PGx assays
GA N 668353 H2020 Research and Innovation Deliverable D3.1 Set of specifications for the selected PGx assays WP N and Title: WP3 Genotyping technology for PGx Lead beneficiary: P7 bio.logis Center for
More informationNanoMet Nanoparticle Diameter Example Report
NanoMet Nanoparticle Diameter Example Report For: Customer Name Address Contact Person Analysis runs performed on [DATE] by [USER] FullScaleNANO, Inc. 400 Capital Circle SE, Suite 18227 Tallahassee, FL
More informationWhy Should We Care? Everyone uses plotting But most people ignore or are unaware of simple principles Default plotting tools are not always the best
Elementary Plots Why Should We Care? Everyone uses plotting But most people ignore or are unaware of simple principles Default plotting tools are not always the best More importantly, it is easy to lie
More informationImage Capture TOTALLAB
1 Introduction In order for image analysis to be performed on a gel or Western blot, it must first be converted into digital data. Good image capture is critical to guarantee optimal performance of automated
More informationOptimization of Tile Sets for DNA Self- Assembly
Optimization of Tile Sets for DNA Self- Assembly Joel Gawarecki Department of Computer Science Simpson College Indianola, IA 50125 joel.gawarecki@my.simpson.edu Adam Smith Department of Computer Science
More informationlife s code. uncovered. SEQUENCING + GENOTYPING + GENE EXPRESSION
life s code. uncovered. SEQUENCING + GENOTYPING + GENE EXPRESSION 2008 LETTER TO Shareholders dear fellow shareholders: In 2008 Illumina celebrated its tenth anniversary with record revenues, profits,
More informationProducts - Microarray Scanners - Laser Scanners - InnoScan 900 Series and MAPIX Software
Products - Microarray Scanners - Laser Scanners - InnoScan 900 Series and MAPIX Software Arrayit offers the world s only next generation microarray scanning technology, with proprietary rotary motion control,
More informationADAPTIVE CORRECTION FOR ACOUSTIC IMAGING IN DIFFICULT MATERIALS
ADAPTIVE CORRECTION FOR ACOUSTIC IMAGING IN DIFFICULT MATERIALS I. J. Collison, S. D. Sharples, M. Clark and M. G. Somekh Applied Optics, Electrical and Electronic Engineering, University of Nottingham,
More informationUser Guide. Illumina Infinium HD Technology DNA METHYLATION SERVICES. McGill University and Génome Québec Innovation Centre JULY 11, Version 6.
JULY 11, 2016 DNA METHYLATION SERVICES McGill University and Génome Québec Innovation Centre Illumina Infinium HD Technology User Guide Version 6.0 Copyright 2016 McGill University and Génome Québec Innovation
More informationColony Imaging with powerful Analysis Software
TM Imaging with powerful Analysis Software TM Accurate Compact Fast We re not going to interpret your results, but we ll do everything to get you there From image acquisition to data visualisation, straight
More informationFast Methods for Small Molecules
Fast Methods for Small Molecules Technical Overview Throughput is a key concern in many NMR laboratories, and using faster methods is one way to increase it. Traditionally, multidimensional NMR requires
More informationLow-level Analysis. cdna Microarrays. Lecture 2 Low Level Gene Expression Data Analysis. Stat 697K, CS 691K, Microbio 690K
Lecture 2 Low Level Gene Expression Data nalysis Stat 697K, CS 691K, icrobio 690K Statistical Challenges odel variation of data not related to gene expression Compare expression for the same gene across
More informationRefining Probability Motifs for the Discovery of Existing Patterns of DNA Bachelor Project
Refining Probability Motifs for the Discovery of Existing Patterns of DNA Bachelor Project Susan Laraghy 0584622, Leiden University Supervisors: Hendrik-Jan Hoogeboom and Walter Kosters (LIACS), Kai Ye
More informationInfluence of Dictionary Size on the Lossless Compression of Microarray Images
Influence of Dictionary Size on the Lossless Compression of Microarray Images Robert Bierman 1, Rahul Singh 1 Department of Computer Science, San Francisco State University, San Francisco, CA bierman@sfsu.edu,
More informationImage Extraction using Image Mining Technique
IOSR Journal of Engineering (IOSRJEN) e-issn: 2250-3021, p-issn: 2278-8719 Vol. 3, Issue 9 (September. 2013), V2 PP 36-42 Image Extraction using Image Mining Technique Prof. Samir Kumar Bandyopadhyay,
More informationFast, high-contrast imaging of animal development with scanned light sheet based structured-illumination microscopy
nature methods Fast, high-contrast imaging of animal development with scanned light sheet based structured-illumination microscopy Philipp J Keller, Annette D Schmidt, Anthony Santella, Khaled Khairy,
More informationThe PBM experiments yielded a fluorescence value for each spot on the array. The fifty
Supplemental Experimental Procedures Analyzing the protein binding microarray (PBM) data The PBM experiments yielded a fluorescence value for each spot on the array. The fifty sequences with highest fluorescence
More informationWhy Should We Care? More importantly, it is easy to lie or deceive people with bad plots
Elementary Plots Why Should We Care? Everyone uses plotting But most people ignore or are unaware of simple principles Default plotting tools (or default settings) are not always the best More importantly,
More informationMagnetic Beads, The Needs and The Opportunity
Magnetic Beads, The Needs and The Opportunity The quest for an improved medical care at lower costs is reshaping the whole healthcare business. Coupled with an aging population, the need for solutions
More informationScan slides (Axon Genepix 4200AL)
Page 1 Scan slides (Axon Genepix 4200AL) We need to scan the slides on both channels (Cy3 and Cy5) to obtain a 16-bit grayscale TIFF file for each. Typically these files are about 20-26Mb per channel,
More informationSMART LASER SENSORS SIMPLIFY TIRE AND RUBBER INSPECTION
PRESENTED AT ITEC 2004 SMART LASER SENSORS SIMPLIFY TIRE AND RUBBER INSPECTION Dr. Walt Pastorius LMI Technologies 2835 Kew Dr. Windsor, ON N8T 3B7 Tel (519) 945 6373 x 110 Cell (519) 981 0238 Fax (519)
More informationComparison of FRD (Focal Ratio Degradation) for Optical Fibres with Different Core Sizes By Neil Barrie
Comparison of FRD (Focal Ratio Degradation) for Optical Fibres with Different Core Sizes By Neil Barrie Introduction The purpose of this experimental investigation was to determine whether there is a dependence
More informationColour Profiling Using Multiple Colour Spaces
Colour Profiling Using Multiple Colour Spaces Nicola Duffy and Gerard Lacey Computer Vision and Robotics Group, Trinity College, Dublin.Ireland duffynn@cs.tcd.ie Abstract This paper presents an original
More informationIllumina GenomeStudio Analysis
Illumina GenomeStudio Analysis Paris Veltsos University of St Andrews February 23, 2012 1 Introduction GenomeStudio is software by Illumina used to score SNPs based on the Illumina BeadExpress platform.
More informationCellSpecks: A Software for Automated Detection and Analysis of Calcium
Biophysical Journal, Volume 115 Supplemental Information CellSpecks: A Software for Automated Detection and Analysis of Calcium Channels in Live Cells Syed Islamuddin Shah, Martin Smith, Divya Swaminathan,
More informationYear 1 Objectives: Number 1
Year 1 Objectives: Number 1 Objective 1:Counting: to 1, forwards and backwards, from any given number Count on from to 2 Count on from to 5 Counting: to 1, forwards and backwards, from any given number
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. The schematic of the perceptron. Here m is the index of a pixel of an input pattern and can be defined from 1 to 320, j represents the number of the output
More informationRealSpot: software validating results from DNA microarray data analysis with spot images
Physiol Genomics 21: 284 291, 2005. First published February 1, 2005; doi:10.1152/physiolgenomics.00236.2004. RealSpot: software validating results from DNA microarray data analysis with spot images Zhongming
More informationFourth Quarter and Year End 2001 Conference Call, February 20, 2002 Dr. Metin Colpan, Managing Director and CEO Peer M. Schatz, Managing Director and
Fourth Quarter and Year End 2001 Conference Call, February 20, 2002 Dr. Metin Colpan, Managing Director and CEO Peer M. Schatz, Managing Director and CFO Forward Looking Statements Certain of the statements
More informationNanomechanical Mapping of a High Curvature Polymer Brush Grafted
Supplementary Information Nanomechanical Mapping of a High Curvature Polymer Brush Grafted from a Rigid Nanoparticle Gunnar Dunér 1, Esben Thormann 1, Andra Dėdinaitė 1,2, Per M. Claesson 1,2, Krzysztof
More informationHow to do the Thermal Noise Lab. And also your DNA melting lab report
How to do the Thermal Noise Lab And also your DNA melting lab report Agenda for our Theory Free Day How to put away your DNA melting apparatus DNA melting lab report The teaching AFM Tips for the thermal
More informationISET Selecting a Color Conversion Matrix
ISET Selecting a Color Conversion Matrix Contents How to Calculate a CCM...1 Applying the CCM in the Processor Window...6 This document gives a step-by-step description of using ISET to calculate a color
More informationMultiple Beta t-tests of Differential Transcription of mrnas Between Two Conditions with Small Samples
Multiple Beta t-tests of Differential Transcription of mrnas Between Two Conditions with Small Samples Yuan-De Tan tanyuande@gmail.com May 3, 2016 Abstract A major task in the analysis of count data of
More informationScanArray Overview. Principle of Operation. Instrument Components
ScanArray Overview The GSI Lumonics ScanArrayÒ Microarray Analysis System is a scanning laser confocal fluorescence microscope that is used to determine the fluorescence intensity of a two-dimensional
More informationLASER server: ancestry tracing with genotypes or sequence reads
LASER server: ancestry tracing with genotypes or sequence reads The LASER method Supplementary Data For each ancestry reference panel of N individuals, LASER applies principal components analysis (PCA)
More informationNPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA
LECTURE-31 MICROARRAY WORK-FLOW: IMAGE SACNNING AND DATA PROCESSING TRANSCRIPT Welcome to the proteomics course. In today s lecture we will talk about microarray work-flow the image scanning and processing.
More informationResearch article Microarray image analysis: background estimation using quantile and morphological filters Anders Bengtsson* and Henrik Bengtsson
BMC Bioinformatics BioMed Central Research article Microarray image analysis: background estimation using quantile and morphological filters Anders Bengtsson* and Henrik Bengtsson Open Access Address:
More informationNature Protocols: doi: /nprot Supplementary Figure 1. Read quality score per sequenced base position.
Supplementary Figure 1 Read quality score per sequenced base position. (a) Illumina Q-scores for a normal QiSeq run. Typically, more than 80% of reads reach a quality score higher than 30 across all read
More informationPerformance Evaluation of the VBLAST Algorithm in W-CDMA Systems
erformance Evaluation of the VBLAST Algorithm in W-CDMA Systems Dragan Samardzija, eter Wolniansky, Jonathan Ling Wireless Research Laboratory, Bell Labs, Lucent Technologies, 79 Holmdel-Keyport Road,
More informationDecoding Randomly Ordered DNA Arrays
Methods Decoding Randomly Ordered DNA Arrays Kevin L. Gunderson, 1,3 Semyon Kruglyak, 1,3 Michael S. Graige, 1 Francisco Garcia, 1 Bahram G. Kermani, 1 Chanfeng Zhao, 1 Diping Che, 1 Todd Dickinson, 1
More informationNPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA
HANDOUT LECTURE-31 MICROARRAY WORK-FLOW: IMAGE SCANNING AND DATA PROCESSING Slide 1: This module contains the summary of the discussion with Mr. Pankaj Khanna, an application specialist from Spinco Biotech,
More informationMASSACHUSETTS INSTITUTE OF TECHNOLOGY LINCOLN LABORATORY 244 WOOD STREET LEXINGTON, MASSACHUSETTS
MASSACHUSETTS INSTITUTE OF TECHNOLOGY LINCOLN LABORATORY 244 WOOD STREET LEXINGTON, MASSACHUSETTS 02420-9108 3 February 2017 (781) 981-1343 TO: FROM: SUBJECT: Dr. Joseph Lin (joseph.lin@ll.mit.edu), Advanced
More informationCommon Core State Standard I Can Statements 2 nd Grade
CCSS Key: Operations and Algebraic Thinking (OA) Number and Operations in Base Ten (NBT) Measurement and Data (MD) Geometry (G) Common Core State Standard 2 nd Grade Common Core State Standards for Mathematics
More informationEvaluation of image quality of the compression schemes JPEG & JPEG 2000 using a Modular Colour Image Difference Model.
Evaluation of image quality of the compression schemes JPEG & JPEG 2000 using a Modular Colour Image Difference Model. Mary Orfanidou, Liz Allen and Dr Sophie Triantaphillidou, University of Westminster,
More informationINSTRUMENTATION BREADBOARDING (VERSION 1.3)
Instrumentation Breadboarding, Page 1 INSTRUMENTATION BREADBOARDING (VERSION 1.3) I. BACKGROUND The purpose of this experiment is to provide you with practical experience in building electronic circuits
More informationThermaViz. Operating Manual. The Innovative Two-Wavelength Imaging Pyrometer
ThermaViz The Innovative Two-Wavelength Imaging Pyrometer Operating Manual The integration of advanced optical diagnostics and intelligent materials processing for temperature measurement and process control.
More informationInstructions for easyscan Atomic Force Microscope
UVA's Hands-on Introduction to Nanoscience Instructions for easyscan Atomic Force Microscope (revision 8 November 2012) NOTE: Instructions assume software is pre-configured per "UVA Instructor Guide for
More informationEmbryoCellect. RHS Scanning and Analysis Instructions. for. Genepix Pro Software
EmbryoCellect RHS Scanning and Analysis Instructions for Genepix Pro Software EmbryoCellect Genepix Pro Scanning and Analysis Technical Data Sheet Version 1.0 October 2015 1 Copyright Reproductive Health
More informationImageJ: Introduction to Image Analysis 3 May 2012 Jacqui Ross
Biomedical Imaging Research Unit School of Medical Sciences Faculty of Medical and Health Sciences The University of Auckland Private Bag 92019 Auckland 1142, NZ Ph: 373 7599 ext. 87438 http://www.fmhs.auckland.ac.nz/sms/biru/.
More informationUser Authentication. Goals for Today. My goals with the blog. What You Have. Tadayoshi Kohno
CSE 484 (Winter 2008) User Authentication Tadayoshi Kohno Thanks to Dan Boneh, Dieter Gollmann, John Manferdelli, John Mitchell, Vitaly Shmatikov, Bennet Yee, and many others for sample slides and materials...
More informationAcoustic resolution. photoacoustic Doppler velocimetry. in blood-mimicking fluids. Supplementary Information
Acoustic resolution photoacoustic Doppler velocimetry in blood-mimicking fluids Joanna Brunker 1, *, Paul Beard 1 Supplementary Information 1 Department of Medical Physics and Biomedical Engineering, University
More informationA Kinect-based 3D hand-gesture interface for 3D databases
A Kinect-based 3D hand-gesture interface for 3D databases Abstract. The use of natural interfaces improves significantly aspects related to human-computer interaction and consequently the productivity
More informationUNEQUAL POWER ALLOCATION FOR JPEG TRANSMISSION OVER MIMO SYSTEMS. Muhammad F. Sabir, Robert W. Heath Jr. and Alan C. Bovik
UNEQUAL POWER ALLOCATION FOR JPEG TRANSMISSION OVER MIMO SYSTEMS Muhammad F. Sabir, Robert W. Heath Jr. and Alan C. Bovik Department of Electrical and Computer Engineering, The University of Texas at Austin,
More information4.5.1 Mirroring Gain/Offset Registers GPIO CMV Snapshot Control... 14
Thank you for choosing the MityCAM-C8000 from Critical Link. The MityCAM-C8000 MityViewer Quick Start Guide will guide you through the software installation process and the steps to acquire your first
More informationLaser Surface Authentication TM : biometrics for documents and goods
Laser Surface Authentication TM : biometrics for documents and goods Professor Russell Cowburn Professor of Nanotechnology, Department of Physics, Imperial College London, UK. Chief Technical Officer,
More informationAutomatic gene expression estimation from microarray images. Daniel O. Dantas Adviser: : Junior Barrera
Automatic gene expression estimation from microarray images Daniel O. Dantas Adviser: : Junior Barrera IME-USP Summary Introduction Problem definition Solution strategy Image segmentation Signal estimation
More informationMicroarray Image Analysis: Background Estimation using Region and Filtering Techniques
Microarray Image Analysis: Background Estimation using Region and Filtering Techniques Anders Bengtsson December 9, 2003 Abstract This report examines properties of two main methods used for local background
More informationAnalysis of S-box in Image Encryption Using Root Mean Square Error Method
Analysis of S-box in Image Encryption Using Root Mean Square Error Method Iqtadar Hussain a, Tariq Shah a, Muhammad Asif Gondal b, and Hasan Mahmood c a Department of Mathematics, Quaid-i-Azam University,
More informationComputational Reproducibility in Medical Research:
Computational Reproducibility in Medical Research: Toward Open Code and Data Victoria Stodden School of Information Sciences University of Illinois at Urbana-Champaign R / Medicine Yale University September
More informationAlgorithms for Genetics: Basics of Wright Fisher Model and Coalescent Theory
Algorithms for Genetics: Basics of Wright Fisher Model and Coalescent Theory Vineet Bafna Harish Nagarajan and Nitin Udpa 1 Disclaimer Please note that a lot of the text and figures here are copied from
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:0.038/nature727 Table of Contents S. Power and Phase Management in the Nanophotonic Phased Array 3 S.2 Nanoantenna Design 6 S.3 Synthesis of Large-Scale Nanophotonic Phased
More informationHyperspectral image processing and analysis
Hyperspectral image processing and analysis Lecture 12 www.utsa.edu/lrsg/teaching/ees5083/l12-hyper.ppt Multi- vs. Hyper- Hyper-: Narrow bands ( 20 nm in resolution or FWHM) and continuous measurements.
More informationIllumination Correction tutorial
Illumination Correction tutorial I. Introduction The Correct Illumination Calculate and Correct Illumination Apply modules are intended to compensate for the non uniformities in illumination often present
More informationClassification of Road Images for Lane Detection
Classification of Road Images for Lane Detection Mingyu Kim minkyu89@stanford.edu Insun Jang insunj@stanford.edu Eunmo Yang eyang89@stanford.edu 1. Introduction In the research on autonomous car, it is
More informationPrinceton ELE 201, Spring 2014 Laboratory No. 2 Shazam
Princeton ELE 201, Spring 2014 Laboratory No. 2 Shazam 1 Background In this lab we will begin to code a Shazam-like program to identify a short clip of music using a database of songs. The basic procedure
More informationUniversity Of Lübeck ISNM Presented by: Omar A. Hanoun
University Of Lübeck ISNM 12.11.2003 Presented by: Omar A. Hanoun What Is CCD? Image Sensor: solid-state device used in digital cameras to capture and store an image. Photosites: photosensitive diodes
More informationSupervisors: Rachel Cardell-Oliver Adrian Keating. Program: Bachelor of Computer Science (Honours) Program Dates: Semester 2, 2014 Semester 1, 2015
Supervisors: Rachel Cardell-Oliver Adrian Keating Program: Bachelor of Computer Science (Honours) Program Dates: Semester 2, 2014 Semester 1, 2015 Background Aging population [ABS2012, CCE09] Need to
More informationSECTION I - CHAPTER 2 DIGITAL IMAGING PROCESSING CONCEPTS
RADT 3463 - COMPUTERIZED IMAGING Section I: Chapter 2 RADT 3463 Computerized Imaging 1 SECTION I - CHAPTER 2 DIGITAL IMAGING PROCESSING CONCEPTS RADT 3463 COMPUTERIZED IMAGING Section I: Chapter 2 RADT
More information8. EDITING AND VIEWING COORDINATES, CREATING SCATTERGRAMS AND PRINCIPAL COMPONENTS ANALYSIS
Editing and viewing coordinates, scattergrams and PCA 8. EDITING AND VIEWING COORDINATES, CREATING SCATTERGRAMS AND PRINCIPAL COMPONENTS ANALYSIS Aim: To introduce you to (i) how you can apply a geographical
More informationWeek 4: Experiment 24. Using Nodal or Mesh Analysis to Solve AC Circuits with an addition of Equivalent Impedance
Week 4: Experiment 24 Using Nodal or Mesh Analysis to Solve AC Circuits with an addition of Equivalent Impedance Lab Lectures You have two weeks to complete Experiment 27: Complex Power 2/27/2012 (Pre-Lab
More informationS.R.Taplin, A. Gh.Podoleanu, D.J.Webb, D.A.Jackson AB STRACT. Keywords: fibre optic sensors, white light, channeled spectra, ccd, signal processing.
White-light displacement sensor incorporating signal analysis of channeled spectra S.R.Taplin, A. Gh.Podoleanu, D.J.Webb, D.A.Jackson Applied Optics Group, Physics Department, University of Kent, Canterbury,
More informationGrade 2 Mathematics Scope and Sequence
Grade 2 Mathematics Scope and Sequence Common Core Standards 2.OA.1 I Can Statements Curriculum Materials & (Knowledge & Skills) Resources /Comments Sums and Differences to 20: (Module 1 Engage NY) 100
More informationRapidScan II Application Note General Composite Scanning
RapidScan II Application Note General Composite Scanning RapidScan II General Composite Scanning Application Note Page 1 Applications The RapidScan system has been utilised for a wide range of inspections
More informationElucidating tissue specific genes using the Benford distribution
Karthik et al. BMC Genomics (2016) 17:595 DOI 10.1186/s12864-016-2921-x RESEARCH ARTICLE Open Access Elucidating tissue specific genes using the Benford distribution Deepak Karthik, Gil Stelzer, Sivan
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Supplemental correlative nanomanipulation-fluorescence traces probing nascent RNA and fluorescent Mfd during TCR initiation. Supplemental correlative nanomanipulation-fluorescence
More informationOptimal Narrow Spectral Bands for Precision Weed Detection in Agricultural Fields using Hyperspectral Remote Sensing
Optimal Narrow Spectral Bands for Precision Weed Detection in Agricultural Fields using Hyperspectral Remote Sensing Sam Tittle Seminar Presentation 11/17/2016 Committee Rick Lawrence Kevin Repasky Bruce
More informationGS FLX/Junior Titanium Technology
www.454.com GS FLX/Junior Titanium Technology GS FLX and GS Junior Process Steps Overview gdna 1. DNA Library Construction * 4h 2. empcr 3. Sequencing 8 h 10 h Data output DNA Library Preparation Prepare
More informationSierra Leone - Multiple Indicator Cluster Survey 2017
Microdata Library Sierra Leone - Multiple Indicator Cluster Survey 2017 Statistics Sierra Leone, United Nations Children s Fund Report generated on: September 27, 2018 Visit our data catalog at: http://microdata.worldbank.org
More informationObjective Comparison of Toolmarks from the Cutting Surfaces of Slip-Joint Pliers
Ames Laboratory Publications Ames Laboratory Spring 2014 Objective Comparison of Toolmarks from the Cutting Surfaces of Slip-Joint Pliers Taylor Grieve Iowa State University L. Scott Chumbley Iowa State
More informationFlow-Cell FC200S+ OCCHIO. The best solution for measuring suspensions,emulsions and foams
Y o u n e e d p r e c i s i o n, y o u w a n t m o r p h o l o g y OCCHIO Flow-Cell FC200S+ The best solution for measuring suspensions,emulsions and foams OCCHIO C C H I O Pharma F l o w - C e l l FC200S+
More informationRedefining Gel and Blot Imaging
Redefining Gel and Blot Imaging PXi AND PXi TOUCH Gel and blot imaging made easy Syngene imaging systems are recognised world-wide as high quality, high performance instruments for the capture and analysis
More informationDetecting Heterogeneity in Population Structure Across the Genome in Admixed Populations
Genetics: Early Online, published on July 20, 2016 as 10.1534/genetics.115.184184 GENETICS INVESTIGATION Detecting Heterogeneity in Population Structure Across the Genome in Admixed Populations Caitlin
More informationSupplementary Information for: Immersion Meta-lenses at Visible Wavelengths for Nanoscale Imaging
Supplementary Information for: Immersion Meta-lenses at Visible Wavelengths for Nanoscale Imaging Wei Ting Chen 1,, Alexander Y. Zhu 1,, Mohammadreza Khorasaninejad 1, Zhujun Shi 2, Vyshakh Sanjeev 1,3
More information