Walter Steets Houston Genealogical Forum DNA Interest Group April 7, 2018

Size: px
Start display at page:

Download "Walter Steets Houston Genealogical Forum DNA Interest Group April 7, 2018"

Transcription

1 Ancestry DNA and GEDmatch Walter Steets Houston Genealogical Forum DNA Interest Group April 7, 2018

2 Today s agenda Recent News about DNA Testing DNA Cautions: DNA Data Used for Forensic Purposes New Technology: DNA and Your Next Car GEDmatch Login Registering at GEDmatch Raw Data File Uploads Analyze Your Data Tools - Free Tier 1 Tools Fee based GEDmatch Genesis 2

3 DNA Data Used for Forensic Purposes GEDmatch Database Used by Authorities in a Washington State County to Identify an Unknown Deceased Person Agencies in Grays Harbor County, Washington had not been able to identify an apparent suicide which occurred in A group of volunteers at the DNA Doe project worked with county authorities to obtain a DNA sample for the person and load it into GEDmatch. GEDmatch presented some likely possibilities for his ancestry and provided some closed genetic matches which are being used to try to locate his extended family. Blaine Bettinger and other administrators of the Genetic Genealogy Tips & Techniques Facebook group posted the story with comments about the implications for genetic genealogy. Summary of Blaine Bettinger s Comments Bettinger believes that the Genetic Genealogy Tips & Techniques FB group should educate you, the genealogist using DNA, about all uses of DNA, including those not related to genealogy. For true informed consent, we must recognize that most of our test-takers know nothing about DNA. You as the family genealogist have an ethical obligation to help your potential test-takers be informed so they can give true informed consent. As a practical matter, It may only take a few negative news stories or litigations to cause many restrictions to be placed on DNA testing. There are things you can do to alleviate, but not completely erase, concerns (pseudonyms, new addresses, and so on).

4 LEXUS & 23ANDME: THE FUTURE OF CAR BUYING 4

5 Why Use GEDmatch Analyze Ancestry Segment Data Detailed data on DNA segments shared with your Matches may help identify your shared ancestors AncestryDNA reports total amount of DNA and number of DNA segments shared with your matches but no detailed information about each shared DNA segment GEDmatch provides reports and graphical displays including chromosome browsers about matches shared with Matches Analyze the DNA Your Matches Share with Each Other Ancestry and most other DNA testing companies provide data on DNA you share with your matches but no data on the DNA your Matches share with each other. Do Cross-company Matches Raw DNA files from Ancestry, FamilyTreeDNA, and MyHeritage may be loaded into either GEDmatch Classic and GEDmatch Genesis, the new version of GEDmatch currently completing development DNA files from 23andMe received before August, 2017 may be uploaded and compared in GEDmatch Classic Newer 23andMe data files must be loaded into GEDmatch Genesis GEDMatch Classic contains 1,000,000 DNA kits; Ancestry contains 7,000,000 5

6 DNA Data Transfer Process AncestryDNA.com GEDmatch.com Are Your Parents Related One-to-many matches Autosomal Matrix Comparison 2-D Chromosome Browser One-to-One Comparison DNAPainter.com Paint a New Match using data copied from GEDMatch Ancestry Raw Data File Copy GEDmatch One-to-One Data 6

7 Log Into GEDmatch 7

8 GEDmatch Registration GEDmatch registration is free One GEDmatch account can be used with DNA kits for multiple people Privacy and Security Considerations Optional Alias Use an alias, also called a nick name or a screen name, to avoid use of your real name. Address must be a real address but it can be one you create to use only for DNA contacts Use a free provider (e.g.dna23@gmail.com ) Use your internet provider (e.g.dna23@comcast.net) Password Always use a different, strong password for every online account. 8

9 GEDmatch Tools Selection Page Four Groups of Tools File Uploads Load DNA raw data files from most DNA testing companies Load GEDCOM files from genealogy websites and PC software (e.g. Ancestry) Analyze Your Data Free tools for analyzing DNA data Tier 1 Utilities Fee-based Tools - $10./month More advanced analysis Genesis Beta Accepts raw DNA data from companies previously not compatible with GEDmatch (e.g. newer 23AndMe) New algorithm with lower thresholds and better accuracy 9

10 GEDmatch raw DNA upload utility 10

11 GEDmatch Raw DNA Upload Utility Creates GEDmatch kits GEDmatch kits are uploaded DNA raw data files Your address from your GEDmatch profile Name of DNA file owner real name Alias nick name or screen name for this kit Sex of DNA file owner Mitochondrial haplogroup optional Y haplogroup optional Are you authorized to upload this data? Choose File - Browse to the file on your computer containing the DNA raw data file Upload - Upload the file Upload may take several minutes 11

12 GEDmatch Tool Set: Analyze Your Data Order of Tool Use 1. Are your parents related? detects matching segments within your chromosomes. Unlikely but need to know. 2. One-to-many matches - Similar to Ancestry Matches a. Matrices Autosomal Matrix i. Identifies Shared Matches ii. limited to 5 matches in free version b. Chromosome Browsers 2D Chromosome Browser i. Identifies shared DNA segments c. Tag Groups Combine related matches into a Tag Group 3. Multiple Kit Analysis New Select Chromosome Browser, Matrices, and other tools by Tag Groups 4. People who match one or both of 2 kits i. Alternative to Matrix for identifying Shared Matches ii. Free version displays a large number of shared matches 5. One-to-one compare 12

13 Analyze Your Data: Are Your Parents Related? Effect of Closely Related Parents on Genetic Analysis May not be able to distinguish paternal from maternal cousins. Both chromosomes in a chromosome pair can have segments from the same ancestor. Genealogical paternal cousins can match maternal cousins if they share DNA segments from the ancestor common to the parents. Relationship estimates based on the total amount of shared DNA may be too close Shared DNA may include contributions from more than one ancestral line increasing the amount of shared DNA Are Your Parents Related Tool? Checks whether any of the pairs of chromosomes in your genome have matching segments. 13

14 Analyze Your Data: One-to-many Matches Displays DNA kits matching a base kit. Comparable to Matches in Ancestry. Kit Nbr Identifier for DNA Raw data sets loaded into GEDMatch. First letter indicates testing company List clicking L displays the One-to-many Matches for that Kit Nbr Select clicking allows matches to be selected for chromosome or matrix comparisons Autosomal and X-DNA Details clicking A or X displays one-to-one comparison between base kit and A row kit Total cm total shared cm Largest cm length of single largest shared segment Gen GEDmatche s estimate of the number of generations between MRCA and match Name name or alias of match 14

15 Analyze Your Data: Choosing Visualization Options After Selecting matches and clicking Submit in the One-to-many tool, the following screen will be displayed. Kits included shows the kit numbers of the kits selected on the One-to-many page Chromosome Browsers chooses the Chromosome Browser tools Matrices chooses the Matrix tools. On the screen below, Matrices have been clicked GEDcom Searches for matches within GEDComs. List/CSV used to download your matches or your matches with detailed segment data as Excel files Tag Groups combines the kits selected in One-to-many into a set called a Tag Group and then used in the Chromosome Browsers 15

16 Maternal Paternal Paternal Analyze Your Data: Autosomal Matrix Sharron s Matches Maternal Paternal Maternal Maternal Paternal Maternal Paternal Maternal Maternal Maternal Maternal Maternal Maternal Maternal Paternal Maternal Maternal 17

17 Analyze Your Data: Autosomal Matrix Sharron s Maternal Matches 18

18 The origin of IBD segments is shown using a pedigree chart of 12 individuals. Segments which are Identical by Descent (IBD): Example of 1 st Cousins Each box (male) and circle (female) represents a chromosome pair for the named person. For example, bars could be the chromosome pair for chromosome 1. Due to crossing over, offspring inherit recombinant chromosomes of their parents. The first cousins in the bottom row, Karen and Louis, share one IBD segment (borders marked by grey lines). Both have inherited this IBD segment from the same individual, namely their grandfather Carl (orange colored chromosome in the top row). Albert Bertha Carl Donna Edward Fiona Gregory Helen Ian Janice Karen Louis Adapted from Gklambauer, Wikimedia Commons 19

19 Analyze Your Data: Chromosome Browser Sharron s Maternal Matches Matches IDs 1, 2, 3, 4, 5, & 6 share a segment from a common ancestor who is not an ancestor of Match ID 7 - norapru8 20

20 Analyze Your Data: Chromosome Browser Sharron s Paternal Matches Norapru8 shared this segment from a common ancestor with Sharron s close relatives but not more distant ones. 21

21 Analyze Your Data: People who match both kits, or 1 or 2 kits Equivalent to Ancestry Shared Matches but displays more data Provides a list of all Shared Matches including Match kit number of match Shared total amount of shared DNA Largest length of longest DNA segment Gen GEDmatch s estimate of number of generations to MRCA 23

22 Analyze Your Data: Tag Groups Kits included in Tag Group kits were matches selected in the One-to-many tool For this set of kits, create a Tag Group with Description for example, family name or relationship Color choose a unique color for Tag Group Include First Kit indicate whether the first kit on the kit list, the base kit in the One-to-many selection, should be included in the group

23 GEDMatch One-to-One Comparison Tool Provides detailed information for each DNA segment shared between two kits Chr chromosome number Start Location starting location in megabase pairs (Mb) End Location end location in megabase pairs (Mb) Centimorgans amount of shared DNA in cm SNPs number of single nucleotide polymorphisms contained in segment This data may be copied and pasted into the DNAPainter chromosome browser. Comparing Kit M (Sharron ) and T (SD) 25

24 GEDmatch Tool Set: Tier 1 Utilities Order of Tool Use 1. One-to-many matches New Version! New version of the free One-to-many tool a. Matrices Autosomal Matrix i. Identifies Shared Matches ii. limited to 5 matches in free version b. Chromosome Browsers 2D Chromosome Browser i. Identifies shared DNA segments c. Tag Groups Combine related matches into a Tag Group 2. Triangulation Groups a. Graphic Tree results for each Triangulation Group b. Graphic Bar results for each chromosome 3. Triangulation a. List of triangulated segments, segments shared with base kit and two other kits. List may be cut and pasted into a spreadsheet 26

25 Tier 1: One-to-many Matches New Version! Displays DNA kits matching a base kit. Comparable to Matches in Ancestry. Select clicking allows matches to be selected for chromosome or matrix comparisons Kit identifier for DNA Raw data sets loaded into GEDMatch. Color identifies Tag Group First letter indicates testing company. Clicking on Kit displays one-to-one comparison between base kit and clicked kit Name and name or alias and address for match contact Autosomal and X-DNA Total cm total shared cm Largest length of largest shared segment. Clicking on Largest displays One-to-many tool Gen GEDmatch s estimate of the number of generations between MRCA and match 27

26 Tier 1: Triangulation Groups - Graphic Tree Results Tree representation of Triangulation Groups each box shows Kit number and name of member of Triangulation Group Chromosome number and length of shared DNA Left-most chart shows position of shared segment on genome 28

27 Tier 1: Triangulation Groups Graphic Bar Results Shows Triangulation Groups by Chromosone 29

28 Tier 1: Triangulation Shows Triangulated Segments - all segment matches where the segment is shared between the base kit and two other kits. Several thousand matching segments may be displayed. Most triangulated segments are less than 20 cm so single segment matches are probably 4 th cousin or greater. Hovering over the Kit number with the mouse cursor displays the name and address of the shared match 30

29 GEDmatch Tool Set: Genesis Beta 31

30 GEDmatch Tools Selection Page - Review Four Groups of Tools File Uploads Load DNA raw data files from most DNA testing companies Load GEDCOM files from genealogy websites and PC software (e.g. Ancestry) Analyze Your Data Free tools for analyzing DNA data Tier 1 Utilities Fee-based Tools - $10./month More advanced analysis Genesis Beta Accepts raw DNA data from companies previously not compatible with GEDmatch (e.g. newer 23AndMe) New algorithm with lower thresholds and better accuracy 32

31 Questions? 35

Walter Steets Houston Genealogical Forum DNA Interest Group February 24, 2018

Walter Steets Houston Genealogical Forum DNA Interest Group February 24, 2018 Using Ancestry DNA and Third-Party Tools to Research Your Shared DNA Segments Part 2 Walter Steets Houston Genealogical Forum DNA Interest Group February 24, 2018 1 Today s agenda Brief review of previous

More information

Walter Steets Houston Genealogical Forum DNA Interest Group May 5, 2018

Walter Steets Houston Genealogical Forum DNA Interest Group May 5, 2018 GEDmatch: The Golden State Killer Tier 1 Tools Walter Steets Houston Genealogical Forum DNA Interest Group May 5, 2018 1 Today s agenda Walter s Take on DNA Developments Growth in Number of DNA Testers

More information

Walter Steets Houston Genealogical Forum DNA Interest Group January 27, 2018

Walter Steets Houston Genealogical Forum DNA Interest Group January 27, 2018 Using Ancestry DNA and Third-Party Tools to Research Your Shared DNA Segments Walter Steets Houston Genealogical Forum DNA Interest Group January 27, 2018 1 Today s agenda Brief review of previous DIG

More information

Walter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018

Walter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018 DNA, Ancestry, and Your Genealogical Research- Segments and centimorgans Walter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018 1 Today s agenda Brief review of previous DIG session

More information

Genealogical Research

Genealogical Research DNA, Ancestry, and Your Genealogical Research Walter Steets Houston Genealogical Forum DNA Interest Group March 2, 2019 1 Today s Agenda Brief review of basic genetics and terms used in genetic genealogy

More information

Autosomal DNA. What is autosomal DNA? X-DNA

Autosomal DNA. What is autosomal DNA? X-DNA ANGIE BUSH AND PAUL WOODBURY info@thednadetectives.com November 1, 2014 Autosomal DNA What is autosomal DNA? Autosomal DNA consists of all nuclear DNA except for the X and Y sex chromosomes. There are

More information

GEDmatch Home Page The upper left corner of your home page has Information about you and links to lots of helpful information. Check them out!

GEDmatch Home Page The upper left corner of your home page has Information about you and links to lots of helpful information. Check them out! USING GEDMATCH Created March 2015 GEDmatch is a free, non-profit site that accepts raw autosomal data files from Ancestry, FTDNA, and 23andme. As such, it provides a large autosomal database that spans

More information

Introduction to Autosomal DNA Tools

Introduction to Autosomal DNA Tools GENETIC GENEALOGY JOURNEY Debbie Parker Wayne, CG, CGL Introduction to Autosomal DNA Tools Just as in the old joke about a new genealogist walking into the library and asking for the book that covers my

More information

Genetic Genealogy. Rules and Tools. Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter

Genetic Genealogy. Rules and Tools. Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter Genetic Genealogy Rules and Tools Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter I am NOT this guy! 2 Genealogy s Newest Tool Genealogy research: Study of Family History Identifies

More information

First Results: Intro to FamilyTreeDNA s Family Finder. Learn what to do with results of autosomal DNA testing with FamilyTreeDNA (FTDNA).

First Results: Intro to FamilyTreeDNA s Family Finder. Learn what to do with results of autosomal DNA testing with FamilyTreeDNA (FTDNA). First Results: Family Tree DNA When You First Get Your FamilyTreeDNA (FTDNA) Results Objective: Learn what to do with results of autosomal DNA testing with FamilyTreeDNA (FTDNA). Tools: familytreedna.com

More information

Advanced Autosomal DNA Techniques used in Genetic Genealogy

Advanced Autosomal DNA Techniques used in Genetic Genealogy Advanced Autosomal DNA Techniques used in Genetic Genealogy Tim Janzen, MD E-mail: tjanzen@comcast.net Summary of Chromosome Mapping Technique The following are specific instructions on how to map your

More information

Pizza and Who do you think you are?

Pizza and Who do you think you are? Pizza and Who do you think you are? an overview of one of the newest and possibly more helpful developments in researching genealogy and family history that of using DNA for research What is DNA? Part

More information

CAGGNI s DNA Special Interest Group

CAGGNI s DNA Special Interest Group CAGGNI s DNA Special Interest Group 10 Jan 2015 Al & Michelle Wilson Agenda Survey Basics in Fan Charts Recombination Exercise Triangulation Overview Survey 1. Have you taken (or sponsored) a DNA test?

More information

A Day Out With Your DNA

A Day Out With Your DNA A Day Out With Your DNA Diahan Southard www.yourdnaguide.com Your testing company has evaluated around 800,000 locations on your DNA to help them determine your origins and your genetic cousins. While

More information

Getting the Most Out of Your DNA Matches

Getting the Most Out of Your DNA Matches Helen V. Smith PG Dip Public Health, BMedLabSci, ADCLT, Dip. Fam. Hist. PLCGS 46 Kraft Road, Pallara, Qld, 4110 Email: HVSresearch@DragonGenealogy.com Website: www.dragongenealogy.com Blog: http://www.dragongenealogy.com/blog/

More information

THE BASICS OF DNA TESTING. By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library

THE BASICS OF DNA TESTING. By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library THE BASICS OF DNA TESTING By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library TYPES OF TESTS Mitochondrial DNA (mtdna/mdna) Y-DNA Autosomal DNA (atdna/audna) MITOCHONDRIAL DNA Found

More information

Tools: 23andMe.com website and test results; DNAAdoption handouts.

Tools: 23andMe.com website and test results; DNAAdoption handouts. When You First Get Your 23andMe Results Objective: Learn what to do with results of atdna testing with 23andMe. Tools: 23andMe.com website and test results; DNAAdoption handouts. Exercises: Practice Exercises

More information

Walter Steets Houston Genealogical Forum DNA Interest Group November 18, 2017

Walter Steets Houston Genealogical Forum DNA Interest Group November 18, 2017 DNA, Ancestry, and Your Genealogical Research Session 2 Walter Steets Houston Genealogical Forum DNA Interest Group November 18, 2017 1 Today s agenda Brief review of previous DIG session Degrees of Separation

More information

Learn what to do with results of autosomal DNA testing from AncestryDNA.

Learn what to do with results of autosomal DNA testing from AncestryDNA. When You First Get Your AncestryDNA Results Objective: Learn what to do with results of autosomal DNA testing from AncestryDNA. Tools: AncestryDNA results; ancestry.com, genesis.gedmatch.com and familytreedna.com

More information

What to Expect When You re Clustering

What to Expect When You re Clustering What to Expect When You re Clustering Walter Steets Houston Genealogical Forum DNA Interest Group January 5, 2018 1 Today s agenda New Ancestry Match Comparison Report Clustering for DNA Matches Describe

More information

Approaching and Connecting with Your DNA Matches

Approaching and Connecting with Your DNA Matches Approaching and Connecting with Your DNA Matches Shannon Stewart Christmas, MCP throughthetreesblog@gmail.com Understand DNA Tests The four types of DNA and the relevant test companies Segment triangulation

More information

TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter

TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter 1-1: DNA: WHERE DO I START? Definition Genetic genealogy is the application of genetics to traditional genealogy. Genetic genealogy uses genealogical

More information

Getting the Most of Your DNA Test. Friends of Irish Research Richard Reid

Getting the Most of Your DNA Test. Friends of Irish Research Richard Reid Getting the Most of Your DNA Test Friends of Irish Research Richard Reid So You Have Been Tested! The results are back and now is time to explore and see if any of your brick walls can be broken down.

More information

DNA Testing What you need to know first

DNA Testing What you need to know first DNA Testing What you need to know first This article is like the Cliff Notes version of several genetic genealogy classes. It is a basic general primer. The general areas include Project support DNA test

More information

DNA Basics. OLLI: Genealogy 101 October 1, ~ Monique E. Rivera ~

DNA Basics. OLLI: Genealogy 101 October 1, ~ Monique E. Rivera ~ DNA Basics OLLI: Genealogy 101 October 1, 2018 ~ Monique E. Rivera ~ WHAT IS DNA? DNA (deoxyribonucleic acid) is found in every living cell everywhere. It is a long chemical chain that tells our cells

More information

Richard Weiss - Director / Exec VP

Richard Weiss - Director / Exec VP Richard Weiss - Director / Exec VP www.dnaadoption.com Welcome to DNAGEDCOM GENETIC GENEALOGY STANDARD NINE ISOGG PRIVATIZE OR REDACT THE NAMES OF LIVING GENETIC MATCHES FROM PRESENTATIONS UNLESS THE GENETIC

More information

Learn what to do with results of autosomal DNA testing from AncestryDNA. Tools: AncestryDNA results; ancestry.com, gedmatch.com and familytreedna.

Learn what to do with results of autosomal DNA testing from AncestryDNA. Tools: AncestryDNA results; ancestry.com, gedmatch.com and familytreedna. First Look : AncestryDNA When You First Get Your AncestryDNA Results Objective: Learn what to do with results of autosomal DNA testing from AncestryDNA. Tools: AncestryDNA results; ancestry.com, gedmatch.com

More information

[CLIENT] SmithDNA1701 DE January 2017

[CLIENT] SmithDNA1701 DE January 2017 [CLIENT] SmithDNA1701 DE1704205 11 January 2017 DNA Discovery Plan GOAL Create a research plan to determine how the client s DNA results relate to his family tree as currently constructed. The client s

More information

Find JCD Project Date: Identification-DNA Process Updated:

Find JCD Project Date: Identification-DNA Process Updated: New Look Investigations Created by: Jack Friess Find JCD Project Date: 04-20-2018 Identification-DNA Process Updated: 05-24-2018 Questions and Answers Identification-DNA (ID-DNA) is a scientific process

More information

Tracking Your Roots With DNA

Tracking Your Roots With DNA Tracking Your Roots With DNA Genetic Genealogy Lisa R Franklin RN,BSN 31 Oct 2013/27 Jun 2014 Andalusia, Alabama Why DNA test? Determine if two people are related Determine if two people descend from the

More information

Using Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM

Using Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM Using Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.

More information

Understanding Third Party DNA Analysis Tools. Copyright 2014 James R. Lannin, Jr. aka Jimmy Chromosomes

Understanding Third Party DNA Analysis Tools. Copyright 2014 James R. Lannin, Jr. aka Jimmy Chromosomes Understanding Third Party DNA Analysis Tools Copyright 2014 James R. Lannin, Jr. aka Jimmy Chromosomes A Review of the Basics You have 46 chromosomes and they come to you in 23 pairs from your mother and

More information

Robert Warthen

Robert Warthen Robert Warthen www.dnagedcom.com GENETIC GENEALOGY STANDARD NINE ISOGG PRIVATIZE OR REDACT THE NAMES OF LIVING GENETIC MATCHES FROM PRESENTATIONS UNLESS THE GENETIC MATCHES HAVE GIVEN THEIR PRIOR PERMISSION

More information

Genetic Genealogy Journey Why Is My Cousin Not on my DNA Match List? Debbie Parker Wayne, CG SM, CGL SM

Genetic Genealogy Journey Why Is My Cousin Not on my DNA Match List? Debbie Parker Wayne, CG SM, CGL SM Genetic Genealogy Journey Why Is My Cousin Not on my DNA Match List? Debbie Parker Wayne, CG SM, CGL SM The CSI television shows have conditioned us to expect exact DNA matches and lead us to think DNA

More information

DNA Testing. February 16, 2018

DNA Testing. February 16, 2018 DNA Testing February 16, 2018 What Is DNA? Double helix ladder structure where the rungs are molecules called nucleotides or bases. DNA contains only four of these nucleotides A, G, C, T The sequence that

More information

Mitochondrial DNA (mtdna) JGSGO June 5, 2018

Mitochondrial DNA (mtdna) JGSGO June 5, 2018 Mitochondrial DNA (mtdna) JGSGO June 5, 2018 MtDNA - outline What is it? What do you do with it? How do you maximize its value? 2 3 mtdna a double-stranded, circular DNA that is stored in mitochondria

More information

DNA Solu)ons for Brick Walls And Adop)on

DNA Solu)ons for Brick Walls And Adop)on DNA Solu)ons for Brick Walls And Adop)on "I have not failed. I've just found ten thousand ways that won't work." Thomas Edison Wise Woman Gene+c Genealogy Comments Listen Carefully! 1. DNA is not the be

More information

Using Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM

Using Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM Using Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.

More information

DNA: UNLOCKING THE CODE

DNA: UNLOCKING THE CODE DNA: UNLOCKING THE CODE Connecting Cousins for Genetic Genealogy Bryant McAllister, PhD Associate Professor of Biology University of Iowa bryant-mcallister@uiowa.edu Iowa Genealogical Society April 9,

More information

Using X-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM

Using X-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM Using X-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.

More information

DNA for Genealogy Librarians. Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District

DNA for Genealogy Librarians. Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District DNA for Genealogy Librarians Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District What does DNA do? It replicates itself. It codes for the production

More information

DNA, A Genealogy Tool. The Search for an Expert Genealogist, Photos & Clues

DNA, A Genealogy Tool. The Search for an Expert Genealogist, Photos & Clues DNA, A Genealogy Tool The Search for an Expert Genealogist, Photos & Clues mydanishancestors.com *Slide Show shared in this class & more web-sites under Toolbar/DNA *One doesn t have to have Danish ancestors

More information

Genetic Genealogy Journey DNA Projects by Debbie Parker Wayne, CG SM, CGL SM

Genetic Genealogy Journey DNA Projects by Debbie Parker Wayne, CG SM, CGL SM Genetic Genealogy Journey DNA Projects by Debbie Parker Wayne, CG SM, CGL SM Genealogy can be a solitary pursuit. Genealogists sometimes collaborate to work on common lines, but lone researchers can perform

More information

! FTDNA! Ancestry. ! 23andMe. ! Medical Considera,ons. ! Iden,fying family medical history. ! Communica,ng with the medical community

! FTDNA! Ancestry. ! 23andMe. ! Medical Considera,ons. ! Iden,fying family medical history. ! Communica,ng with the medical community by JEFF CARPENTER! Brief Defini,ons about YDNA, XDNA, mtdna, atdna (Covered in Part 1)! Benefits of Tes,ng DNA! Examples of DNA TESTING! FTDNA! Ancestry! 3andMe Jeff Carpenter, 016 jeffcarpenter1939@gmal.com!

More information

DNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016

DNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016 DNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016 1 What we will cover How testing helps genealogy What is DNA? How do you select from the three testing companies?

More information

Visual Phasing of Chromosome 1

Visual Phasing of Chromosome 1 Visual Phasing of Chromosome 1 If you have the possibility to test three full siblings, then the next great thing you could do with your DNA, is to try out the Visual Phasing technique developed by Kathy

More information

Clan Galbraith Association Application for or Renewal of Membership

Clan Galbraith Association Application for or Renewal of Membership Clan Galbraith Association Application for or Renewal of Membership ELIGIBILITY FOR MEMBERSHIP: Membership in the Clan Galbraith Association is open to any person related by blood or marriage to the Galbraith

More information

The Structure of DNA Let s take a closer look at how this looks under a microscope.

The Structure of DNA Let s take a closer look at how this looks under a microscope. DNA Basics Adapted from a MyHeritage Blog and the International Society of Genetic Genealogy (ISOGG) Wiki by Earl Cory MyHeritage has started a series to explain DNA, how it works and answer the most common

More information

Halley Family. Mystery? Mystery? Can you solve a. Can you help solve a

Halley Family. Mystery? Mystery? Can you solve a. Can you help solve a Can you solve a Can you help solve a Halley Halley Family Family Mystery? Mystery? Who was the great grandfather of John Bennett Halley? He lived in Maryland around 1797 and might have been born there.

More information

An O-F3288 Y DNA Discovery for Patrilineal Descendants of James Revell (Accomack) By Marie A. Rundquist, DNA Project Administrator November 2018

An O-F3288 Y DNA Discovery for Patrilineal Descendants of James Revell (Accomack) By Marie A. Rundquist, DNA Project Administrator November 2018 Project Scope Rundquist O-F3288 White Paper 11/2018 An O-F3288 Y DNA Discovery for Patrilineal Descendants of James Revell (Accomack) By Marie A. Rundquist, DNA Project Administrator November 2018 The

More information

DNA Opening Doors for Today s s Genealogist

DNA Opening Doors for Today s s Genealogist DNA Opening Doors for Today s s Genealogist Presented to JGSI Sunday, March 30, 2008 Presented by Alvin Holtzman Genetic Genealogy Discussion Points What is DNA How can it help genealogists What to expect

More information

DNAGedcom s GWorks Automation Utility using Ancestry.com Results

DNAGedcom s GWorks Automation Utility using Ancestry.com Results Developed by Debra Demeester, collaborating genealogist, based on Kitty Cooper's blog post of 26 Sept 2017. PART 1: PARTNER DNAGedcom AND ANCESTRY I. CREATE A PAID ACCOUNT AT DNAGEDCOM 1. Click on the

More information

Discovering Hard to Find Ancestry DNA Matches Page 1

Discovering Hard to Find Ancestry DNA Matches Page 1 Discovering Hard To Find Ancestry DNA Matches Alice Kalush 5/15/2018 This document discusses several methods for finding matches to your Ancestry DNA test that do not easily show up for you in the Hints

More information

Your mtdna Full Sequence Results

Your mtdna Full Sequence Results Congratulations! You are one of the first to have your entire mitochondrial DNA (DNA) sequenced! Testing the full sequence has already become the standard practice used by researchers studying the DNA,

More information

DNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding

DNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding DNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding by Dr. Ing. Robert L. Baber 2014 July 26 Rights reserved, see the copyright notice at http://gengen.rlbaber.de

More information

Genetic Genealogy. Using DNA to research your maternal & paternal lines. Ed McGuire. Vermont Genealogy Library 2/24/14

Genetic Genealogy. Using DNA to research your maternal & paternal lines. Ed McGuire. Vermont Genealogy Library 2/24/14 Genetic Genealogy Using DNA to research your maternal & paternal lines Ed McGuire 2/24/14 Introduction Soprano Family Tree 2 2/24/14 Introduction 3 2/24/14 Introduction 4 2/24/14 Introduction Contradictory

More information

Using Mitochondrial DNA (mtdna) for Genealogy Debbie Parker Wayne, CG, CGL SM

Using Mitochondrial DNA (mtdna) for Genealogy Debbie Parker Wayne, CG, CGL SM Using Mitochondrial DNA (mtdna) for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical

More information

Computer - aided Genealogy. Rob Drew

Computer - aided Genealogy. Rob Drew Computer - aided Genealogy Rob Drew Topics Building your family tree Off-line tools for your laptop or desktop at home. What s a gedcom file? Building an on-line tree. Research websites Where to get help

More information

Y-DNA Genetic Testing

Y-DNA Genetic Testing Y-DNA Genetic Testing 50 2/24/14 Y-DNA Genetic Testing Y-DNA flows from fathers to sons intact SNPs define Y-DNA haplogroups Haplogroups (clans) migrated together Timeframe between mutations is 2,000 to

More information

Genealogy: DNA And The Family Tree By James Mayflower READ ONLINE

Genealogy: DNA And The Family Tree By James Mayflower READ ONLINE Genealogy: DNA And The Family Tree By James Mayflower READ ONLINE CeCe Moore's "DNA Testing for Genealogy - Getting Started" series is a Family Tree DNA is currently the only commercial laboratory offering

More information

Before India: Exploring Your Ancestry With DNA By David G. Mahal

Before India: Exploring Your Ancestry With DNA By David G. Mahal Before India: Exploring Your Ancestry With DNA By David G. Mahal You then receive an email notifying you that your results are ready to explore on utilize your DNA results for family history by Ancestry.com

More information

Big Y-700 White Paper

Big Y-700 White Paper Big Y-700 White Paper Powering discovery in the field of paternal ancestry Authors: Caleb Davis, Michael Sager, Göran Runfeldt, Elliott Greenspan, Arjan Bormans, Bennett Greenspan, and Connie Bormans Last

More information

MEET YOUR VOLUNTEER PRATER PROJECT ADMINISTRATORS

MEET YOUR VOLUNTEER PRATER PROJECT ADMINISTRATORS Prater* Project NEWSLETTER i Vol I, No 1 Click on graphic above to view the latest Prater Project Results Tables using the drop-down menus MEET YOUR VOLUNTEER PRATER PROJECT ADMINISTRATORS Laverne Piatt

More information

Use of DNA information in family research information for IOWFHS members

Use of DNA information in family research information for IOWFHS members Use of DNA information in family research information for IOWFHS members What is DNA? Since the discovery of deoxyribonucleic acid (DNA) in the 1950s, we have come to understand more about its role as

More information

Recent Results from the Jackson Brigade DNA Project

Recent Results from the Jackson Brigade DNA Project Recent Results from the Jackson Brigade DNA Project Dr. Daniel C. Hyde Professor Emeritus of Computer Science Bucknell University Lewisburg, PA Presented at Jackson Brigade Reunion, Horner, WV on August

More information

Genetic Genealogy Journey Tips for Initial Contact with a Match Debbie Parker Wayne, CG SM, CGL SM

Genetic Genealogy Journey Tips for Initial Contact with a Match Debbie Parker Wayne, CG SM, CGL SM Genetic Genealogy Journey Tips for Initial Contact with a Match Debbie Parker Wayne, CG SM, CGL SM Genetic genealogists frequently complain about the low response rate to requests for contact with our

More information

Using Autosomal DNA to Solve a Family Mystery

Using Autosomal DNA to Solve a Family Mystery Using Autosomal DNA to Solve a Family Mystery W. Jones, Ph.D., CG, CGL, FASG, FUGA, FNGS Tom@JonesResearchServices.com This case study shows how targeted autosomal-dna testing supplemented documentary

More information

IN THIS ISSUE: February From the Administrator Questions/News...1. George Varner of Missouri Direct Line...2

IN THIS ISSUE: February From the Administrator Questions/News...1. George Varner of Missouri Direct Line...2 IN THIS ISSUE: From the Administrator..... 1 Questions/News.......1 George Varner of Missouri Direct Line...2 Do the Newtons & Varners Really Both have Riggs DNA?...2 2016 Newton/Varner Reunion. 5 February

More information

Autosomal-DNA. How does the nature of Jewish genealogy make autosomal DNA research more challenging?

Autosomal-DNA. How does the nature of Jewish genealogy make autosomal DNA research more challenging? Autosomal-DNA How does the nature of Jewish genealogy make autosomal DNA research more challenging? Using Family Finder results for genealogy is more challenging for individuals of Jewish ancestry because

More information

What Can I Learn From DNA Testing?

What Can I Learn From DNA Testing? What Can I Learn From DNA Testing? From where did my ancestors migrate? What is my DNA Signature? Was my ancestor a Jewish Cohanim Priest? Was my great great grandmother really an Indian Princes? I was

More information

When you have completed your mission, have a consultant review your card and attached hint to receive your reward!

When you have completed your mission, have a consultant review your card and attached hint to receive your reward! LANDSCAPE TREE ON FAMILYSEARCH Your mission, should you choose to accept it is to add sources to the records of your ancestors, seek out ancestors to research, and look for missing temple ordinances. Sign

More information

The DNA Case for Bethuel Riggs

The DNA Case for Bethuel Riggs The DNA Case for Bethuel Riggs The following was originally intended as an appendix to Alvy Ray Smith, Edwardian Riggses of America I: Elder Bethuel Riggs (1757 1835) of Morris County, New Jersey, and

More information

Your Family 101 Beginning Genealogical Research

Your Family 101 Beginning Genealogical Research Your Family 101 Beginning Genealogical Research What Will We Cover Today? Session 1: Getting Started Session 2: Your Resources Session 3: Common Mistakes and Pitfalls Session 4: DNA Testing and Medical

More information

MyHeritage.com First Look, Page 1 of 35

MyHeritage.com First Look, Page 1 of 35 MyHeritage.com First Look, Page 1 of 35 MyHeritage.com First Look MyHeritage is a comprehensive online genealogy company headquartered in Israel. This document provides a brief overview of features available

More information

DNA TESTING. This is the testing regime for FamilyTreeDNA. Other SNP tests were ordered from Yseq.

DNA TESTING. This is the testing regime for FamilyTreeDNA. Other SNP tests were ordered from Yseq. DNA & GENEALOGY DNA TESTING This is the testing regime for FamilyTreeDNA. Other SNP tests were ordered from Yseq. Product Date Batch Family Finder 30-May-14 Completed 569 05-Aug-14 Batched 569 05-Jul-14

More information

W H I T E S I D E F A M I L Y A S S O C I A T I O N

W H I T E S I D E F A M I L Y A S S O C I A T I O N WHITESIDE FAMILY ASSOCIATION W H I T E S I D E F A M I L Y A S S O C I A T I O N S AV E T H E DAT E!! SPECIAL POINTS OF INTEREST: ANNUAL MEETING PLANS 2014 Annual Meeting The WFA plans to hold it its 2014

More information

BETTER TOGETHER: MAKING YOUR CASE WITH DOCUMENTS AND DNA BCG-sponsored Webinar (https://bcgcertification.org) Patricia Lee Hobbs, CG

BETTER TOGETHER: MAKING YOUR CASE WITH DOCUMENTS AND DNA BCG-sponsored Webinar (https://bcgcertification.org) Patricia Lee Hobbs, CG BETTER TOGETHER: MAKING YOUR CASE WITH DOCUMENTS AND DNA BCG-sponsored Webinar (https://bcgcertification.org) Patricia Lee Hobbs, CG LIMITATIONS & BENEFITS OF DNA TESTING DNA test results do not solve

More information

Jewish Genealogy Society of NE Florida

Jewish Genealogy Society of NE Florida Boris Savchuk - Oyfen Pripitchik - Authentic Jewish melody https://www.youtube.com/watch?v=qhk9cuktcpc Jewish Genealogy Society of NE Florida Bernie Grossman Marla Westberg December 19 th, 2018 Agenda:

More information

Pedigree Reconstruction using Identity by Descent

Pedigree Reconstruction using Identity by Descent Pedigree Reconstruction using Identity by Descent Bonnie Kirkpatrick Electrical Engineering and Computer Sciences University of California at Berkeley Technical Report No. UCB/EECS-2010-43 http://www.eecs.berkeley.edu/pubs/techrpts/2010/eecs-2010-43.html

More information

ICMP DNA REPORTS GUIDE

ICMP DNA REPORTS GUIDE ICMP DNA REPORTS GUIDE Distribution: General Sarajevo, 16 th December 2010 GUIDE TO ICMP DNA REPORTS 1. Purpose of This Document 1. The International Commission on Missing Persons (ICMP) endeavors to secure

More information

company does improve its ethnicity estimates, your profile will automatically be updated, too. You won't have to retake the test to get the new

company does improve its ethnicity estimates, your profile will automatically be updated, too. You won't have to retake the test to get the new Ancestry dna kit The Y-DNA test is more limited than the ones from Family Tree DNA Does not offer a less expensive 'autosomal DNA-only' test Can't connect with other matches Can't upload raw data from

More information

Understanding DNA in Genealogy. Peter Biggins, BY3164 Darien Library, Darien, CT November 18, 2017

Understanding DNA in Genealogy. Peter Biggins, BY3164 Darien Library, Darien, CT November 18, 2017 Understanding DNA in Genealogy Peter Biggins, BY3164 Darien Library, Darien, CT November 18, 2017 1953: Watson 25, Crick 37, Franklin 33 My BY3164 SNP 1953 paper published on the structure of DNA 1962

More information

Saturday, 23 June

Saturday, 23 June The Genealogical Society of New Jersey 2018 Seminar Saturday, 23 June 2018 www.gsnj.org Raritan Valley Community College, Conference Center 118 Lamington Road Branchburg, New Jersey 08876 Presentations

More information

Every human cell (except red blood cells and sperm and eggs) has an. identical set of 23 pairs of chromosomes which carry all the hereditary

Every human cell (except red blood cells and sperm and eggs) has an. identical set of 23 pairs of chromosomes which carry all the hereditary Introduction to Genetic Genealogy Every human cell (except red blood cells and sperm and eggs) has an identical set of 23 pairs of chromosomes which carry all the hereditary information that is passed

More information

Family Tree DNA Genetic Genealogy Started Here

Family Tree DNA Genetic Genealogy Started Here Family Tree DNA Genetic Genealogy Started Here With 253,000 samples in our DNA database (the largest of its kind in the world) your genealogical search could become even easier Why Bennett Greenspan founded

More information

Entire Chromosome 21 Inherited from 5 th Great Grandparents Captain Daniel and Elizabeth (Windecker) Young

Entire Chromosome 21 Inherited from 5 th Great Grandparents Captain Daniel and Elizabeth (Windecker) Young Entire Chromosome 21 Inherited from 5 th Great Grandparents Captain Daniel and Elizabeth (Windecker) Young The Ancestors: Daniel Young was born about 1755 in the Canajoharie District of the Mohawk Valley

More information

Using the FamilySearch Family Tree (23 March 2012)

Using the FamilySearch Family Tree (23 March 2012) Using the FamilySearch Family Tree (23 March 2012) 2012 by Intellectual Reserve, Inc. All rights reserved Printed in the United States of America Published by FamilySearch, International Salt Lake City,

More information

Your Family Tree Online: How To Trace Your Ancestry From Your Own Computer By Graeme Davis READ ONLINE

Your Family Tree Online: How To Trace Your Ancestry From Your Own Computer By Graeme Davis READ ONLINE Your Family Tree Online: How To Trace Your Ancestry From Your Own Computer By Graeme Davis READ ONLINE Family History Wiki; Ancestry Academy; More; Publish; Download expert advice for tackling your research

More information

DAR POLICY STATEMENT AND BACKGROUND Using DNA Evidence for DAR Applications

DAR POLICY STATEMENT AND BACKGROUND Using DNA Evidence for DAR Applications Effective January 1, 2014, DAR will begin accepting Y-DNA evidence in support of new member applications and supplemental applications as one element in a structured analysis. This analysis will use a

More information

Orangeburgh District DNA Project. Finding Family Connections with Autosomal DNA Testing

Orangeburgh District DNA Project. Finding Family Connections with Autosomal DNA Testing Orangeburgh District DNA Project Finding Family Connections with Autosomal DNA Testing Review some DNA basics Address privacy issues Evidence vs. Proof Look at some specific examples 3 Types of DNA Testing

More information

DNA and Ancestry. An Update on New Tests. Steve Louis. Jewish Genealogical Society of Washington State. January 13, 2014

DNA and Ancestry. An Update on New Tests. Steve Louis. Jewish Genealogical Society of Washington State. January 13, 2014 DNA and Ancestry An Update on New Tests Steve Louis Jewish Genealogical Society of Washington State January 13, 2014 DISCLAIMER This document was prepared as a result of independent work and opinions of

More information

Identification of the Hypothesized African Ancestry of the Wife of Pvt. Henry Windecker Using Genomic Testing of the Autosomes.

Identification of the Hypothesized African Ancestry of the Wife of Pvt. Henry Windecker Using Genomic Testing of the Autosomes. Identification of the Hypothesized African Ancestry of the Wife of Pvt. Henry Windecker Using Genomic Testing of the Autosomes Introduction African Ancestry: The hypothesis, based on considerable circumstantial

More information

THE KING S SON. (The Evidence) Brad Michael Little. (3 rd Edition) (APPENDIX No.1) (April 2018)

THE KING S SON. (The Evidence) Brad Michael Little. (3 rd Edition) (APPENDIX No.1) (April 2018) THE KING S SON (The Evidence) (3 rd Edition) (APPENDIX No.1) (April 2018) By Brad Michael Little THE KING S SON (The Evidence) [3 rd Edition] 546 ABOUT THE AUTHOR Brad Michael Little is the youngest grandson

More information

Discovering Your Family History with MyHeritage Unique Technologies By: Daniel Horowitz - -

Discovering Your Family History with MyHeritage Unique Technologies By: Daniel Horowitz - - Discovering Your Family History with MyHeritage Unique Technologies By: Daniel Horowitz - Daniel@MyHeritage.com - Tweeter: @MyHChiefGen MyHeritage has developed seven powerful technologies to help genealogy

More information

Meek DNA Project Group B Ancestral Signature

Meek DNA Project Group B Ancestral Signature Meek DNA Project Group B Ancestral Signature The purpose of this paper is to explore the method and logic used by the author in establishing the Y-DNA ancestral signature for The Meek DNA Project Group

More information

Genetic Identity and

Genetic Identity and Genetic Identity and GACATGTAGCTCTTCACTTCACCCAGGTTGGGTTGTGTCAACAGGAAACATTGTAACATATCACTTGGATTAGCACCTAGG/TTAT/TTAT/TTA Community DTC Genetic Testing Workshop The National Academies' August 31 September 1,

More information

New Family Tree By Renee Zamora

New Family Tree By Renee Zamora New Family Tree By Renee Zamora Several weeks ago I had the privilege of attending a private viewing of FamilySearch s new feature Family Tree. On 29 Dec. 2005 beta testing officially began, which I am

More information

DNA SEGMENT SHARING in DESCENDANTS of ADAM YOUNG ( ) and CATHARINE E. SCHREMLING ( ) David K. Faux

DNA SEGMENT SHARING in DESCENDANTS of ADAM YOUNG ( ) and CATHARINE E. SCHREMLING ( ) David K. Faux DNA SEGMENT SHARING in DESCENDANTS of ADAM YOUNG (1717-1790) and CATHARINE E. SCHREMLING (1720-1798) By David K. Faux The following manuscript is an interpretive guide to the data from the autosomal and

More information

Legacy FamilySearch Overview

Legacy FamilySearch Overview Legacy FamilySearch Overview Legacy Family Tree is "Tree Share" Certified for FamilySearch Family Tree. This means you can now share your Legacy information with FamilySearch Family Tree and of course

More information

Report on the VAN_TUYL Surname Project Y-STR Results 3/11/2013 Rory Van Tuyl

Report on the VAN_TUYL Surname Project Y-STR Results 3/11/2013 Rory Van Tuyl Report on the VAN_TUYL Surname Project Y-STR Results 3/11/2013 Rory Van Tuyl Abstract: Recent data for two descendants of Ott van Tuyl has been added to the project, bringing the total number of Gameren

More information