Walter Steets Houston Genealogical Forum DNA Interest Group April 7, 2018
|
|
- Clare Powell
- 5 years ago
- Views:
Transcription
1 Ancestry DNA and GEDmatch Walter Steets Houston Genealogical Forum DNA Interest Group April 7, 2018
2 Today s agenda Recent News about DNA Testing DNA Cautions: DNA Data Used for Forensic Purposes New Technology: DNA and Your Next Car GEDmatch Login Registering at GEDmatch Raw Data File Uploads Analyze Your Data Tools - Free Tier 1 Tools Fee based GEDmatch Genesis 2
3 DNA Data Used for Forensic Purposes GEDmatch Database Used by Authorities in a Washington State County to Identify an Unknown Deceased Person Agencies in Grays Harbor County, Washington had not been able to identify an apparent suicide which occurred in A group of volunteers at the DNA Doe project worked with county authorities to obtain a DNA sample for the person and load it into GEDmatch. GEDmatch presented some likely possibilities for his ancestry and provided some closed genetic matches which are being used to try to locate his extended family. Blaine Bettinger and other administrators of the Genetic Genealogy Tips & Techniques Facebook group posted the story with comments about the implications for genetic genealogy. Summary of Blaine Bettinger s Comments Bettinger believes that the Genetic Genealogy Tips & Techniques FB group should educate you, the genealogist using DNA, about all uses of DNA, including those not related to genealogy. For true informed consent, we must recognize that most of our test-takers know nothing about DNA. You as the family genealogist have an ethical obligation to help your potential test-takers be informed so they can give true informed consent. As a practical matter, It may only take a few negative news stories or litigations to cause many restrictions to be placed on DNA testing. There are things you can do to alleviate, but not completely erase, concerns (pseudonyms, new addresses, and so on).
4 LEXUS & 23ANDME: THE FUTURE OF CAR BUYING 4
5 Why Use GEDmatch Analyze Ancestry Segment Data Detailed data on DNA segments shared with your Matches may help identify your shared ancestors AncestryDNA reports total amount of DNA and number of DNA segments shared with your matches but no detailed information about each shared DNA segment GEDmatch provides reports and graphical displays including chromosome browsers about matches shared with Matches Analyze the DNA Your Matches Share with Each Other Ancestry and most other DNA testing companies provide data on DNA you share with your matches but no data on the DNA your Matches share with each other. Do Cross-company Matches Raw DNA files from Ancestry, FamilyTreeDNA, and MyHeritage may be loaded into either GEDmatch Classic and GEDmatch Genesis, the new version of GEDmatch currently completing development DNA files from 23andMe received before August, 2017 may be uploaded and compared in GEDmatch Classic Newer 23andMe data files must be loaded into GEDmatch Genesis GEDMatch Classic contains 1,000,000 DNA kits; Ancestry contains 7,000,000 5
6 DNA Data Transfer Process AncestryDNA.com GEDmatch.com Are Your Parents Related One-to-many matches Autosomal Matrix Comparison 2-D Chromosome Browser One-to-One Comparison DNAPainter.com Paint a New Match using data copied from GEDMatch Ancestry Raw Data File Copy GEDmatch One-to-One Data 6
7 Log Into GEDmatch 7
8 GEDmatch Registration GEDmatch registration is free One GEDmatch account can be used with DNA kits for multiple people Privacy and Security Considerations Optional Alias Use an alias, also called a nick name or a screen name, to avoid use of your real name. Address must be a real address but it can be one you create to use only for DNA contacts Use a free provider (e.g.dna23@gmail.com ) Use your internet provider (e.g.dna23@comcast.net) Password Always use a different, strong password for every online account. 8
9 GEDmatch Tools Selection Page Four Groups of Tools File Uploads Load DNA raw data files from most DNA testing companies Load GEDCOM files from genealogy websites and PC software (e.g. Ancestry) Analyze Your Data Free tools for analyzing DNA data Tier 1 Utilities Fee-based Tools - $10./month More advanced analysis Genesis Beta Accepts raw DNA data from companies previously not compatible with GEDmatch (e.g. newer 23AndMe) New algorithm with lower thresholds and better accuracy 9
10 GEDmatch raw DNA upload utility 10
11 GEDmatch Raw DNA Upload Utility Creates GEDmatch kits GEDmatch kits are uploaded DNA raw data files Your address from your GEDmatch profile Name of DNA file owner real name Alias nick name or screen name for this kit Sex of DNA file owner Mitochondrial haplogroup optional Y haplogroup optional Are you authorized to upload this data? Choose File - Browse to the file on your computer containing the DNA raw data file Upload - Upload the file Upload may take several minutes 11
12 GEDmatch Tool Set: Analyze Your Data Order of Tool Use 1. Are your parents related? detects matching segments within your chromosomes. Unlikely but need to know. 2. One-to-many matches - Similar to Ancestry Matches a. Matrices Autosomal Matrix i. Identifies Shared Matches ii. limited to 5 matches in free version b. Chromosome Browsers 2D Chromosome Browser i. Identifies shared DNA segments c. Tag Groups Combine related matches into a Tag Group 3. Multiple Kit Analysis New Select Chromosome Browser, Matrices, and other tools by Tag Groups 4. People who match one or both of 2 kits i. Alternative to Matrix for identifying Shared Matches ii. Free version displays a large number of shared matches 5. One-to-one compare 12
13 Analyze Your Data: Are Your Parents Related? Effect of Closely Related Parents on Genetic Analysis May not be able to distinguish paternal from maternal cousins. Both chromosomes in a chromosome pair can have segments from the same ancestor. Genealogical paternal cousins can match maternal cousins if they share DNA segments from the ancestor common to the parents. Relationship estimates based on the total amount of shared DNA may be too close Shared DNA may include contributions from more than one ancestral line increasing the amount of shared DNA Are Your Parents Related Tool? Checks whether any of the pairs of chromosomes in your genome have matching segments. 13
14 Analyze Your Data: One-to-many Matches Displays DNA kits matching a base kit. Comparable to Matches in Ancestry. Kit Nbr Identifier for DNA Raw data sets loaded into GEDMatch. First letter indicates testing company List clicking L displays the One-to-many Matches for that Kit Nbr Select clicking allows matches to be selected for chromosome or matrix comparisons Autosomal and X-DNA Details clicking A or X displays one-to-one comparison between base kit and A row kit Total cm total shared cm Largest cm length of single largest shared segment Gen GEDmatche s estimate of the number of generations between MRCA and match Name name or alias of match 14
15 Analyze Your Data: Choosing Visualization Options After Selecting matches and clicking Submit in the One-to-many tool, the following screen will be displayed. Kits included shows the kit numbers of the kits selected on the One-to-many page Chromosome Browsers chooses the Chromosome Browser tools Matrices chooses the Matrix tools. On the screen below, Matrices have been clicked GEDcom Searches for matches within GEDComs. List/CSV used to download your matches or your matches with detailed segment data as Excel files Tag Groups combines the kits selected in One-to-many into a set called a Tag Group and then used in the Chromosome Browsers 15
16 Maternal Paternal Paternal Analyze Your Data: Autosomal Matrix Sharron s Matches Maternal Paternal Maternal Maternal Paternal Maternal Paternal Maternal Maternal Maternal Maternal Maternal Maternal Maternal Paternal Maternal Maternal 17
17 Analyze Your Data: Autosomal Matrix Sharron s Maternal Matches 18
18 The origin of IBD segments is shown using a pedigree chart of 12 individuals. Segments which are Identical by Descent (IBD): Example of 1 st Cousins Each box (male) and circle (female) represents a chromosome pair for the named person. For example, bars could be the chromosome pair for chromosome 1. Due to crossing over, offspring inherit recombinant chromosomes of their parents. The first cousins in the bottom row, Karen and Louis, share one IBD segment (borders marked by grey lines). Both have inherited this IBD segment from the same individual, namely their grandfather Carl (orange colored chromosome in the top row). Albert Bertha Carl Donna Edward Fiona Gregory Helen Ian Janice Karen Louis Adapted from Gklambauer, Wikimedia Commons 19
19 Analyze Your Data: Chromosome Browser Sharron s Maternal Matches Matches IDs 1, 2, 3, 4, 5, & 6 share a segment from a common ancestor who is not an ancestor of Match ID 7 - norapru8 20
20 Analyze Your Data: Chromosome Browser Sharron s Paternal Matches Norapru8 shared this segment from a common ancestor with Sharron s close relatives but not more distant ones. 21
21 Analyze Your Data: People who match both kits, or 1 or 2 kits Equivalent to Ancestry Shared Matches but displays more data Provides a list of all Shared Matches including Match kit number of match Shared total amount of shared DNA Largest length of longest DNA segment Gen GEDmatch s estimate of number of generations to MRCA 23
22 Analyze Your Data: Tag Groups Kits included in Tag Group kits were matches selected in the One-to-many tool For this set of kits, create a Tag Group with Description for example, family name or relationship Color choose a unique color for Tag Group Include First Kit indicate whether the first kit on the kit list, the base kit in the One-to-many selection, should be included in the group
23 GEDMatch One-to-One Comparison Tool Provides detailed information for each DNA segment shared between two kits Chr chromosome number Start Location starting location in megabase pairs (Mb) End Location end location in megabase pairs (Mb) Centimorgans amount of shared DNA in cm SNPs number of single nucleotide polymorphisms contained in segment This data may be copied and pasted into the DNAPainter chromosome browser. Comparing Kit M (Sharron ) and T (SD) 25
24 GEDmatch Tool Set: Tier 1 Utilities Order of Tool Use 1. One-to-many matches New Version! New version of the free One-to-many tool a. Matrices Autosomal Matrix i. Identifies Shared Matches ii. limited to 5 matches in free version b. Chromosome Browsers 2D Chromosome Browser i. Identifies shared DNA segments c. Tag Groups Combine related matches into a Tag Group 2. Triangulation Groups a. Graphic Tree results for each Triangulation Group b. Graphic Bar results for each chromosome 3. Triangulation a. List of triangulated segments, segments shared with base kit and two other kits. List may be cut and pasted into a spreadsheet 26
25 Tier 1: One-to-many Matches New Version! Displays DNA kits matching a base kit. Comparable to Matches in Ancestry. Select clicking allows matches to be selected for chromosome or matrix comparisons Kit identifier for DNA Raw data sets loaded into GEDMatch. Color identifies Tag Group First letter indicates testing company. Clicking on Kit displays one-to-one comparison between base kit and clicked kit Name and name or alias and address for match contact Autosomal and X-DNA Total cm total shared cm Largest length of largest shared segment. Clicking on Largest displays One-to-many tool Gen GEDmatch s estimate of the number of generations between MRCA and match 27
26 Tier 1: Triangulation Groups - Graphic Tree Results Tree representation of Triangulation Groups each box shows Kit number and name of member of Triangulation Group Chromosome number and length of shared DNA Left-most chart shows position of shared segment on genome 28
27 Tier 1: Triangulation Groups Graphic Bar Results Shows Triangulation Groups by Chromosone 29
28 Tier 1: Triangulation Shows Triangulated Segments - all segment matches where the segment is shared between the base kit and two other kits. Several thousand matching segments may be displayed. Most triangulated segments are less than 20 cm so single segment matches are probably 4 th cousin or greater. Hovering over the Kit number with the mouse cursor displays the name and address of the shared match 30
29 GEDmatch Tool Set: Genesis Beta 31
30 GEDmatch Tools Selection Page - Review Four Groups of Tools File Uploads Load DNA raw data files from most DNA testing companies Load GEDCOM files from genealogy websites and PC software (e.g. Ancestry) Analyze Your Data Free tools for analyzing DNA data Tier 1 Utilities Fee-based Tools - $10./month More advanced analysis Genesis Beta Accepts raw DNA data from companies previously not compatible with GEDmatch (e.g. newer 23AndMe) New algorithm with lower thresholds and better accuracy 32
31 Questions? 35
Walter Steets Houston Genealogical Forum DNA Interest Group February 24, 2018
Using Ancestry DNA and Third-Party Tools to Research Your Shared DNA Segments Part 2 Walter Steets Houston Genealogical Forum DNA Interest Group February 24, 2018 1 Today s agenda Brief review of previous
More informationWalter Steets Houston Genealogical Forum DNA Interest Group May 5, 2018
GEDmatch: The Golden State Killer Tier 1 Tools Walter Steets Houston Genealogical Forum DNA Interest Group May 5, 2018 1 Today s agenda Walter s Take on DNA Developments Growth in Number of DNA Testers
More informationWalter Steets Houston Genealogical Forum DNA Interest Group January 27, 2018
Using Ancestry DNA and Third-Party Tools to Research Your Shared DNA Segments Walter Steets Houston Genealogical Forum DNA Interest Group January 27, 2018 1 Today s agenda Brief review of previous DIG
More informationWalter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018
DNA, Ancestry, and Your Genealogical Research- Segments and centimorgans Walter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018 1 Today s agenda Brief review of previous DIG session
More informationGenealogical Research
DNA, Ancestry, and Your Genealogical Research Walter Steets Houston Genealogical Forum DNA Interest Group March 2, 2019 1 Today s Agenda Brief review of basic genetics and terms used in genetic genealogy
More informationAutosomal DNA. What is autosomal DNA? X-DNA
ANGIE BUSH AND PAUL WOODBURY info@thednadetectives.com November 1, 2014 Autosomal DNA What is autosomal DNA? Autosomal DNA consists of all nuclear DNA except for the X and Y sex chromosomes. There are
More informationGEDmatch Home Page The upper left corner of your home page has Information about you and links to lots of helpful information. Check them out!
USING GEDMATCH Created March 2015 GEDmatch is a free, non-profit site that accepts raw autosomal data files from Ancestry, FTDNA, and 23andme. As such, it provides a large autosomal database that spans
More informationIntroduction to Autosomal DNA Tools
GENETIC GENEALOGY JOURNEY Debbie Parker Wayne, CG, CGL Introduction to Autosomal DNA Tools Just as in the old joke about a new genealogist walking into the library and asking for the book that covers my
More informationGenetic Genealogy. Rules and Tools. Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter
Genetic Genealogy Rules and Tools Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter I am NOT this guy! 2 Genealogy s Newest Tool Genealogy research: Study of Family History Identifies
More informationFirst Results: Intro to FamilyTreeDNA s Family Finder. Learn what to do with results of autosomal DNA testing with FamilyTreeDNA (FTDNA).
First Results: Family Tree DNA When You First Get Your FamilyTreeDNA (FTDNA) Results Objective: Learn what to do with results of autosomal DNA testing with FamilyTreeDNA (FTDNA). Tools: familytreedna.com
More informationAdvanced Autosomal DNA Techniques used in Genetic Genealogy
Advanced Autosomal DNA Techniques used in Genetic Genealogy Tim Janzen, MD E-mail: tjanzen@comcast.net Summary of Chromosome Mapping Technique The following are specific instructions on how to map your
More informationPizza and Who do you think you are?
Pizza and Who do you think you are? an overview of one of the newest and possibly more helpful developments in researching genealogy and family history that of using DNA for research What is DNA? Part
More informationCAGGNI s DNA Special Interest Group
CAGGNI s DNA Special Interest Group 10 Jan 2015 Al & Michelle Wilson Agenda Survey Basics in Fan Charts Recombination Exercise Triangulation Overview Survey 1. Have you taken (or sponsored) a DNA test?
More informationA Day Out With Your DNA
A Day Out With Your DNA Diahan Southard www.yourdnaguide.com Your testing company has evaluated around 800,000 locations on your DNA to help them determine your origins and your genetic cousins. While
More informationGetting the Most Out of Your DNA Matches
Helen V. Smith PG Dip Public Health, BMedLabSci, ADCLT, Dip. Fam. Hist. PLCGS 46 Kraft Road, Pallara, Qld, 4110 Email: HVSresearch@DragonGenealogy.com Website: www.dragongenealogy.com Blog: http://www.dragongenealogy.com/blog/
More informationTHE BASICS OF DNA TESTING. By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library
THE BASICS OF DNA TESTING By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library TYPES OF TESTS Mitochondrial DNA (mtdna/mdna) Y-DNA Autosomal DNA (atdna/audna) MITOCHONDRIAL DNA Found
More informationTools: 23andMe.com website and test results; DNAAdoption handouts.
When You First Get Your 23andMe Results Objective: Learn what to do with results of atdna testing with 23andMe. Tools: 23andMe.com website and test results; DNAAdoption handouts. Exercises: Practice Exercises
More informationWalter Steets Houston Genealogical Forum DNA Interest Group November 18, 2017
DNA, Ancestry, and Your Genealogical Research Session 2 Walter Steets Houston Genealogical Forum DNA Interest Group November 18, 2017 1 Today s agenda Brief review of previous DIG session Degrees of Separation
More informationLearn what to do with results of autosomal DNA testing from AncestryDNA.
When You First Get Your AncestryDNA Results Objective: Learn what to do with results of autosomal DNA testing from AncestryDNA. Tools: AncestryDNA results; ancestry.com, genesis.gedmatch.com and familytreedna.com
More informationWhat to Expect When You re Clustering
What to Expect When You re Clustering Walter Steets Houston Genealogical Forum DNA Interest Group January 5, 2018 1 Today s agenda New Ancestry Match Comparison Report Clustering for DNA Matches Describe
More informationApproaching and Connecting with Your DNA Matches
Approaching and Connecting with Your DNA Matches Shannon Stewart Christmas, MCP throughthetreesblog@gmail.com Understand DNA Tests The four types of DNA and the relevant test companies Segment triangulation
More informationTRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter
TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter 1-1: DNA: WHERE DO I START? Definition Genetic genealogy is the application of genetics to traditional genealogy. Genetic genealogy uses genealogical
More informationGetting the Most of Your DNA Test. Friends of Irish Research Richard Reid
Getting the Most of Your DNA Test Friends of Irish Research Richard Reid So You Have Been Tested! The results are back and now is time to explore and see if any of your brick walls can be broken down.
More informationDNA Testing What you need to know first
DNA Testing What you need to know first This article is like the Cliff Notes version of several genetic genealogy classes. It is a basic general primer. The general areas include Project support DNA test
More informationDNA Basics. OLLI: Genealogy 101 October 1, ~ Monique E. Rivera ~
DNA Basics OLLI: Genealogy 101 October 1, 2018 ~ Monique E. Rivera ~ WHAT IS DNA? DNA (deoxyribonucleic acid) is found in every living cell everywhere. It is a long chemical chain that tells our cells
More informationRichard Weiss - Director / Exec VP
Richard Weiss - Director / Exec VP www.dnaadoption.com Welcome to DNAGEDCOM GENETIC GENEALOGY STANDARD NINE ISOGG PRIVATIZE OR REDACT THE NAMES OF LIVING GENETIC MATCHES FROM PRESENTATIONS UNLESS THE GENETIC
More informationLearn what to do with results of autosomal DNA testing from AncestryDNA. Tools: AncestryDNA results; ancestry.com, gedmatch.com and familytreedna.
First Look : AncestryDNA When You First Get Your AncestryDNA Results Objective: Learn what to do with results of autosomal DNA testing from AncestryDNA. Tools: AncestryDNA results; ancestry.com, gedmatch.com
More information[CLIENT] SmithDNA1701 DE January 2017
[CLIENT] SmithDNA1701 DE1704205 11 January 2017 DNA Discovery Plan GOAL Create a research plan to determine how the client s DNA results relate to his family tree as currently constructed. The client s
More informationFind JCD Project Date: Identification-DNA Process Updated:
New Look Investigations Created by: Jack Friess Find JCD Project Date: 04-20-2018 Identification-DNA Process Updated: 05-24-2018 Questions and Answers Identification-DNA (ID-DNA) is a scientific process
More informationTracking Your Roots With DNA
Tracking Your Roots With DNA Genetic Genealogy Lisa R Franklin RN,BSN 31 Oct 2013/27 Jun 2014 Andalusia, Alabama Why DNA test? Determine if two people are related Determine if two people descend from the
More informationUsing Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM
Using Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.
More informationUnderstanding Third Party DNA Analysis Tools. Copyright 2014 James R. Lannin, Jr. aka Jimmy Chromosomes
Understanding Third Party DNA Analysis Tools Copyright 2014 James R. Lannin, Jr. aka Jimmy Chromosomes A Review of the Basics You have 46 chromosomes and they come to you in 23 pairs from your mother and
More informationRobert Warthen
Robert Warthen www.dnagedcom.com GENETIC GENEALOGY STANDARD NINE ISOGG PRIVATIZE OR REDACT THE NAMES OF LIVING GENETIC MATCHES FROM PRESENTATIONS UNLESS THE GENETIC MATCHES HAVE GIVEN THEIR PRIOR PERMISSION
More informationGenetic Genealogy Journey Why Is My Cousin Not on my DNA Match List? Debbie Parker Wayne, CG SM, CGL SM
Genetic Genealogy Journey Why Is My Cousin Not on my DNA Match List? Debbie Parker Wayne, CG SM, CGL SM The CSI television shows have conditioned us to expect exact DNA matches and lead us to think DNA
More informationDNA Testing. February 16, 2018
DNA Testing February 16, 2018 What Is DNA? Double helix ladder structure where the rungs are molecules called nucleotides or bases. DNA contains only four of these nucleotides A, G, C, T The sequence that
More informationMitochondrial DNA (mtdna) JGSGO June 5, 2018
Mitochondrial DNA (mtdna) JGSGO June 5, 2018 MtDNA - outline What is it? What do you do with it? How do you maximize its value? 2 3 mtdna a double-stranded, circular DNA that is stored in mitochondria
More informationDNA Solu)ons for Brick Walls And Adop)on
DNA Solu)ons for Brick Walls And Adop)on "I have not failed. I've just found ten thousand ways that won't work." Thomas Edison Wise Woman Gene+c Genealogy Comments Listen Carefully! 1. DNA is not the be
More informationUsing Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM
Using Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.
More informationDNA: UNLOCKING THE CODE
DNA: UNLOCKING THE CODE Connecting Cousins for Genetic Genealogy Bryant McAllister, PhD Associate Professor of Biology University of Iowa bryant-mcallister@uiowa.edu Iowa Genealogical Society April 9,
More informationUsing X-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM
Using X-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.
More informationDNA for Genealogy Librarians. Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District
DNA for Genealogy Librarians Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District What does DNA do? It replicates itself. It codes for the production
More informationDNA, A Genealogy Tool. The Search for an Expert Genealogist, Photos & Clues
DNA, A Genealogy Tool The Search for an Expert Genealogist, Photos & Clues mydanishancestors.com *Slide Show shared in this class & more web-sites under Toolbar/DNA *One doesn t have to have Danish ancestors
More informationGenetic Genealogy Journey DNA Projects by Debbie Parker Wayne, CG SM, CGL SM
Genetic Genealogy Journey DNA Projects by Debbie Parker Wayne, CG SM, CGL SM Genealogy can be a solitary pursuit. Genealogists sometimes collaborate to work on common lines, but lone researchers can perform
More information! FTDNA! Ancestry. ! 23andMe. ! Medical Considera,ons. ! Iden,fying family medical history. ! Communica,ng with the medical community
by JEFF CARPENTER! Brief Defini,ons about YDNA, XDNA, mtdna, atdna (Covered in Part 1)! Benefits of Tes,ng DNA! Examples of DNA TESTING! FTDNA! Ancestry! 3andMe Jeff Carpenter, 016 jeffcarpenter1939@gmal.com!
More informationDNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016
DNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016 1 What we will cover How testing helps genealogy What is DNA? How do you select from the three testing companies?
More informationVisual Phasing of Chromosome 1
Visual Phasing of Chromosome 1 If you have the possibility to test three full siblings, then the next great thing you could do with your DNA, is to try out the Visual Phasing technique developed by Kathy
More informationClan Galbraith Association Application for or Renewal of Membership
Clan Galbraith Association Application for or Renewal of Membership ELIGIBILITY FOR MEMBERSHIP: Membership in the Clan Galbraith Association is open to any person related by blood or marriage to the Galbraith
More informationThe Structure of DNA Let s take a closer look at how this looks under a microscope.
DNA Basics Adapted from a MyHeritage Blog and the International Society of Genetic Genealogy (ISOGG) Wiki by Earl Cory MyHeritage has started a series to explain DNA, how it works and answer the most common
More informationHalley Family. Mystery? Mystery? Can you solve a. Can you help solve a
Can you solve a Can you help solve a Halley Halley Family Family Mystery? Mystery? Who was the great grandfather of John Bennett Halley? He lived in Maryland around 1797 and might have been born there.
More informationAn O-F3288 Y DNA Discovery for Patrilineal Descendants of James Revell (Accomack) By Marie A. Rundquist, DNA Project Administrator November 2018
Project Scope Rundquist O-F3288 White Paper 11/2018 An O-F3288 Y DNA Discovery for Patrilineal Descendants of James Revell (Accomack) By Marie A. Rundquist, DNA Project Administrator November 2018 The
More informationDNA Opening Doors for Today s s Genealogist
DNA Opening Doors for Today s s Genealogist Presented to JGSI Sunday, March 30, 2008 Presented by Alvin Holtzman Genetic Genealogy Discussion Points What is DNA How can it help genealogists What to expect
More informationDNAGedcom s GWorks Automation Utility using Ancestry.com Results
Developed by Debra Demeester, collaborating genealogist, based on Kitty Cooper's blog post of 26 Sept 2017. PART 1: PARTNER DNAGedcom AND ANCESTRY I. CREATE A PAID ACCOUNT AT DNAGEDCOM 1. Click on the
More informationDiscovering Hard to Find Ancestry DNA Matches Page 1
Discovering Hard To Find Ancestry DNA Matches Alice Kalush 5/15/2018 This document discusses several methods for finding matches to your Ancestry DNA test that do not easily show up for you in the Hints
More informationYour mtdna Full Sequence Results
Congratulations! You are one of the first to have your entire mitochondrial DNA (DNA) sequenced! Testing the full sequence has already become the standard practice used by researchers studying the DNA,
More informationDNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding
DNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding by Dr. Ing. Robert L. Baber 2014 July 26 Rights reserved, see the copyright notice at http://gengen.rlbaber.de
More informationGenetic Genealogy. Using DNA to research your maternal & paternal lines. Ed McGuire. Vermont Genealogy Library 2/24/14
Genetic Genealogy Using DNA to research your maternal & paternal lines Ed McGuire 2/24/14 Introduction Soprano Family Tree 2 2/24/14 Introduction 3 2/24/14 Introduction 4 2/24/14 Introduction Contradictory
More informationUsing Mitochondrial DNA (mtdna) for Genealogy Debbie Parker Wayne, CG, CGL SM
Using Mitochondrial DNA (mtdna) for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical
More informationComputer - aided Genealogy. Rob Drew
Computer - aided Genealogy Rob Drew Topics Building your family tree Off-line tools for your laptop or desktop at home. What s a gedcom file? Building an on-line tree. Research websites Where to get help
More informationY-DNA Genetic Testing
Y-DNA Genetic Testing 50 2/24/14 Y-DNA Genetic Testing Y-DNA flows from fathers to sons intact SNPs define Y-DNA haplogroups Haplogroups (clans) migrated together Timeframe between mutations is 2,000 to
More informationGenealogy: DNA And The Family Tree By James Mayflower READ ONLINE
Genealogy: DNA And The Family Tree By James Mayflower READ ONLINE CeCe Moore's "DNA Testing for Genealogy - Getting Started" series is a Family Tree DNA is currently the only commercial laboratory offering
More informationBefore India: Exploring Your Ancestry With DNA By David G. Mahal
Before India: Exploring Your Ancestry With DNA By David G. Mahal You then receive an email notifying you that your results are ready to explore on utilize your DNA results for family history by Ancestry.com
More informationBig Y-700 White Paper
Big Y-700 White Paper Powering discovery in the field of paternal ancestry Authors: Caleb Davis, Michael Sager, Göran Runfeldt, Elliott Greenspan, Arjan Bormans, Bennett Greenspan, and Connie Bormans Last
More informationMEET YOUR VOLUNTEER PRATER PROJECT ADMINISTRATORS
Prater* Project NEWSLETTER i Vol I, No 1 Click on graphic above to view the latest Prater Project Results Tables using the drop-down menus MEET YOUR VOLUNTEER PRATER PROJECT ADMINISTRATORS Laverne Piatt
More informationUse of DNA information in family research information for IOWFHS members
Use of DNA information in family research information for IOWFHS members What is DNA? Since the discovery of deoxyribonucleic acid (DNA) in the 1950s, we have come to understand more about its role as
More informationRecent Results from the Jackson Brigade DNA Project
Recent Results from the Jackson Brigade DNA Project Dr. Daniel C. Hyde Professor Emeritus of Computer Science Bucknell University Lewisburg, PA Presented at Jackson Brigade Reunion, Horner, WV on August
More informationGenetic Genealogy Journey Tips for Initial Contact with a Match Debbie Parker Wayne, CG SM, CGL SM
Genetic Genealogy Journey Tips for Initial Contact with a Match Debbie Parker Wayne, CG SM, CGL SM Genetic genealogists frequently complain about the low response rate to requests for contact with our
More informationUsing Autosomal DNA to Solve a Family Mystery
Using Autosomal DNA to Solve a Family Mystery W. Jones, Ph.D., CG, CGL, FASG, FUGA, FNGS Tom@JonesResearchServices.com This case study shows how targeted autosomal-dna testing supplemented documentary
More informationIN THIS ISSUE: February From the Administrator Questions/News...1. George Varner of Missouri Direct Line...2
IN THIS ISSUE: From the Administrator..... 1 Questions/News.......1 George Varner of Missouri Direct Line...2 Do the Newtons & Varners Really Both have Riggs DNA?...2 2016 Newton/Varner Reunion. 5 February
More informationAutosomal-DNA. How does the nature of Jewish genealogy make autosomal DNA research more challenging?
Autosomal-DNA How does the nature of Jewish genealogy make autosomal DNA research more challenging? Using Family Finder results for genealogy is more challenging for individuals of Jewish ancestry because
More informationWhat Can I Learn From DNA Testing?
What Can I Learn From DNA Testing? From where did my ancestors migrate? What is my DNA Signature? Was my ancestor a Jewish Cohanim Priest? Was my great great grandmother really an Indian Princes? I was
More informationWhen you have completed your mission, have a consultant review your card and attached hint to receive your reward!
LANDSCAPE TREE ON FAMILYSEARCH Your mission, should you choose to accept it is to add sources to the records of your ancestors, seek out ancestors to research, and look for missing temple ordinances. Sign
More informationThe DNA Case for Bethuel Riggs
The DNA Case for Bethuel Riggs The following was originally intended as an appendix to Alvy Ray Smith, Edwardian Riggses of America I: Elder Bethuel Riggs (1757 1835) of Morris County, New Jersey, and
More informationYour Family 101 Beginning Genealogical Research
Your Family 101 Beginning Genealogical Research What Will We Cover Today? Session 1: Getting Started Session 2: Your Resources Session 3: Common Mistakes and Pitfalls Session 4: DNA Testing and Medical
More informationMyHeritage.com First Look, Page 1 of 35
MyHeritage.com First Look, Page 1 of 35 MyHeritage.com First Look MyHeritage is a comprehensive online genealogy company headquartered in Israel. This document provides a brief overview of features available
More informationDNA TESTING. This is the testing regime for FamilyTreeDNA. Other SNP tests were ordered from Yseq.
DNA & GENEALOGY DNA TESTING This is the testing regime for FamilyTreeDNA. Other SNP tests were ordered from Yseq. Product Date Batch Family Finder 30-May-14 Completed 569 05-Aug-14 Batched 569 05-Jul-14
More informationW H I T E S I D E F A M I L Y A S S O C I A T I O N
WHITESIDE FAMILY ASSOCIATION W H I T E S I D E F A M I L Y A S S O C I A T I O N S AV E T H E DAT E!! SPECIAL POINTS OF INTEREST: ANNUAL MEETING PLANS 2014 Annual Meeting The WFA plans to hold it its 2014
More informationBETTER TOGETHER: MAKING YOUR CASE WITH DOCUMENTS AND DNA BCG-sponsored Webinar (https://bcgcertification.org) Patricia Lee Hobbs, CG
BETTER TOGETHER: MAKING YOUR CASE WITH DOCUMENTS AND DNA BCG-sponsored Webinar (https://bcgcertification.org) Patricia Lee Hobbs, CG LIMITATIONS & BENEFITS OF DNA TESTING DNA test results do not solve
More informationJewish Genealogy Society of NE Florida
Boris Savchuk - Oyfen Pripitchik - Authentic Jewish melody https://www.youtube.com/watch?v=qhk9cuktcpc Jewish Genealogy Society of NE Florida Bernie Grossman Marla Westberg December 19 th, 2018 Agenda:
More informationPedigree Reconstruction using Identity by Descent
Pedigree Reconstruction using Identity by Descent Bonnie Kirkpatrick Electrical Engineering and Computer Sciences University of California at Berkeley Technical Report No. UCB/EECS-2010-43 http://www.eecs.berkeley.edu/pubs/techrpts/2010/eecs-2010-43.html
More informationICMP DNA REPORTS GUIDE
ICMP DNA REPORTS GUIDE Distribution: General Sarajevo, 16 th December 2010 GUIDE TO ICMP DNA REPORTS 1. Purpose of This Document 1. The International Commission on Missing Persons (ICMP) endeavors to secure
More informationcompany does improve its ethnicity estimates, your profile will automatically be updated, too. You won't have to retake the test to get the new
Ancestry dna kit The Y-DNA test is more limited than the ones from Family Tree DNA Does not offer a less expensive 'autosomal DNA-only' test Can't connect with other matches Can't upload raw data from
More informationUnderstanding DNA in Genealogy. Peter Biggins, BY3164 Darien Library, Darien, CT November 18, 2017
Understanding DNA in Genealogy Peter Biggins, BY3164 Darien Library, Darien, CT November 18, 2017 1953: Watson 25, Crick 37, Franklin 33 My BY3164 SNP 1953 paper published on the structure of DNA 1962
More informationSaturday, 23 June
The Genealogical Society of New Jersey 2018 Seminar Saturday, 23 June 2018 www.gsnj.org Raritan Valley Community College, Conference Center 118 Lamington Road Branchburg, New Jersey 08876 Presentations
More informationEvery human cell (except red blood cells and sperm and eggs) has an. identical set of 23 pairs of chromosomes which carry all the hereditary
Introduction to Genetic Genealogy Every human cell (except red blood cells and sperm and eggs) has an identical set of 23 pairs of chromosomes which carry all the hereditary information that is passed
More informationFamily Tree DNA Genetic Genealogy Started Here
Family Tree DNA Genetic Genealogy Started Here With 253,000 samples in our DNA database (the largest of its kind in the world) your genealogical search could become even easier Why Bennett Greenspan founded
More informationEntire Chromosome 21 Inherited from 5 th Great Grandparents Captain Daniel and Elizabeth (Windecker) Young
Entire Chromosome 21 Inherited from 5 th Great Grandparents Captain Daniel and Elizabeth (Windecker) Young The Ancestors: Daniel Young was born about 1755 in the Canajoharie District of the Mohawk Valley
More informationUsing the FamilySearch Family Tree (23 March 2012)
Using the FamilySearch Family Tree (23 March 2012) 2012 by Intellectual Reserve, Inc. All rights reserved Printed in the United States of America Published by FamilySearch, International Salt Lake City,
More informationYour Family Tree Online: How To Trace Your Ancestry From Your Own Computer By Graeme Davis READ ONLINE
Your Family Tree Online: How To Trace Your Ancestry From Your Own Computer By Graeme Davis READ ONLINE Family History Wiki; Ancestry Academy; More; Publish; Download expert advice for tackling your research
More informationDAR POLICY STATEMENT AND BACKGROUND Using DNA Evidence for DAR Applications
Effective January 1, 2014, DAR will begin accepting Y-DNA evidence in support of new member applications and supplemental applications as one element in a structured analysis. This analysis will use a
More informationOrangeburgh District DNA Project. Finding Family Connections with Autosomal DNA Testing
Orangeburgh District DNA Project Finding Family Connections with Autosomal DNA Testing Review some DNA basics Address privacy issues Evidence vs. Proof Look at some specific examples 3 Types of DNA Testing
More informationDNA and Ancestry. An Update on New Tests. Steve Louis. Jewish Genealogical Society of Washington State. January 13, 2014
DNA and Ancestry An Update on New Tests Steve Louis Jewish Genealogical Society of Washington State January 13, 2014 DISCLAIMER This document was prepared as a result of independent work and opinions of
More informationIdentification of the Hypothesized African Ancestry of the Wife of Pvt. Henry Windecker Using Genomic Testing of the Autosomes.
Identification of the Hypothesized African Ancestry of the Wife of Pvt. Henry Windecker Using Genomic Testing of the Autosomes Introduction African Ancestry: The hypothesis, based on considerable circumstantial
More informationTHE KING S SON. (The Evidence) Brad Michael Little. (3 rd Edition) (APPENDIX No.1) (April 2018)
THE KING S SON (The Evidence) (3 rd Edition) (APPENDIX No.1) (April 2018) By Brad Michael Little THE KING S SON (The Evidence) [3 rd Edition] 546 ABOUT THE AUTHOR Brad Michael Little is the youngest grandson
More informationDiscovering Your Family History with MyHeritage Unique Technologies By: Daniel Horowitz - -
Discovering Your Family History with MyHeritage Unique Technologies By: Daniel Horowitz - Daniel@MyHeritage.com - Tweeter: @MyHChiefGen MyHeritage has developed seven powerful technologies to help genealogy
More informationMeek DNA Project Group B Ancestral Signature
Meek DNA Project Group B Ancestral Signature The purpose of this paper is to explore the method and logic used by the author in establishing the Y-DNA ancestral signature for The Meek DNA Project Group
More informationGenetic Identity and
Genetic Identity and GACATGTAGCTCTTCACTTCACCCAGGTTGGGTTGTGTCAACAGGAAACATTGTAACATATCACTTGGATTAGCACCTAGG/TTAT/TTAT/TTA Community DTC Genetic Testing Workshop The National Academies' August 31 September 1,
More informationNew Family Tree By Renee Zamora
New Family Tree By Renee Zamora Several weeks ago I had the privilege of attending a private viewing of FamilySearch s new feature Family Tree. On 29 Dec. 2005 beta testing officially began, which I am
More informationDNA SEGMENT SHARING in DESCENDANTS of ADAM YOUNG ( ) and CATHARINE E. SCHREMLING ( ) David K. Faux
DNA SEGMENT SHARING in DESCENDANTS of ADAM YOUNG (1717-1790) and CATHARINE E. SCHREMLING (1720-1798) By David K. Faux The following manuscript is an interpretive guide to the data from the autosomal and
More informationLegacy FamilySearch Overview
Legacy FamilySearch Overview Legacy Family Tree is "Tree Share" Certified for FamilySearch Family Tree. This means you can now share your Legacy information with FamilySearch Family Tree and of course
More informationReport on the VAN_TUYL Surname Project Y-STR Results 3/11/2013 Rory Van Tuyl
Report on the VAN_TUYL Surname Project Y-STR Results 3/11/2013 Rory Van Tuyl Abstract: Recent data for two descendants of Ott van Tuyl has been added to the project, bringing the total number of Gameren
More information