DNA Basics. OLLI: Genealogy 101 October 1, ~ Monique E. Rivera ~
|
|
- Avis Carter
- 5 years ago
- Views:
Transcription
1 DNA Basics OLLI: Genealogy 101 October 1, 2018 ~ Monique E. Rivera ~
2 WHAT IS DNA? DNA (deoxyribonucleic acid) is found in every living cell everywhere. It is a long chemical chain that tells our cells how to grow and act. DNA is divided up into chromosomes (major blocks) which are then divided into genes. Humans have 23 pairs of chromosomes (46 in all) arranged in a double helix. We each get 23 chromosomes from our mother and 23 from our father. In humans, the 23rd chromosome is either an X-chromosome or a Y-chromosome, and determines if we are male or female. Women have two X-chromosomes, while men have one X-chromosome and one Y-chromosome.
3
4 When it comes to DNA, there are three types of tests...
5 TYPES OF DNA TESTS Autosomal DNA: DNA that does not contribute to gender; it is the first 22 pairs of chromosomes. Because it does not rely on the 23 rd chromosome, autosomal DNA tests can be done in both men and women with the same results. Main Uses: to determine how closely related you are to someone else and to provide an estimate of your ethnicity, or the regions of the world where your ancestors lived (e.g., over the past few hundred years, or even a thousand years, since people used to move a lot less often).
6 mtdna: Mitochondrial DNA (mtdna) is passed down from your mother; it ignores the main DNA in a cell and looks at the DNA of the mitochondria instead. It tells you about your mother s mother s mother s mother, and so on, back through time. An mtdna test will identify how closely related you are to a haplogroup. A haplogroup is a group of people with a single common ancestor. Historically, everyone living in the same region might belong to the same haplogroup, or very closely related ones. This means that your haplogroup can identify where your maternal line originated.
7 Y-DNA: The 23 rd human chromosome has two versions, the X and the Y. Women have two X-chromosomes, while men have one X and one Y. Y-DNA tests examine only the Y-chromosome. Because you can only get a Y-chromosome from your father, and he from his father, that means it tends to change very little over time. Because the Y-chromosome is only passed down through males, the test can only tell you about your direct paternal line. Y-DNA testing is especially useful for adoptees as well as Jewish ancestry.
8
9 WHICH TEST IS BEST FOR YOU? It all depends on what you want to know.
10 Autosomal DNA For most genealogists, the autosomal DNA test is the winner; it is the one test that every testing company offers. Because your autosomal DNA comes from all of your ancestors, this test is good for finding a range of ancestors and living relatives. It can also provide you with reasonable estimates of the ethnicity of your ancestors, or the regions of the world where they lived. Most of the time, an autosomal DNA test is only useful for about five generations that is, to your great-great-great-grandparents. In terms of living relatives, that means it extends to your third cousins or maybe fourth cousins. Combined with websites that let you connect with close matches, autosomal DNA can provide some great leads on finding others who are researching the same family tree as you. mtdna Because mtdna comes to you only from your mother, and from her mother, it only helps you trace one line. You can use it to prove a common ancestor with someone else, but only in a direct maternal line. It can, however, trace that line back a very long way sometimes 10,000 years or more. That can provide evidence that your mother s maternal line came from a very specific region or ethnicity. But it is less useful when finding living relatives. The mtdna test also tends to be more expensive. Y-DNA The Y-DNA test follows a direct paternal line. A Y-DNA test can tell you about your father s father s father s father, and many generations before that, but not about any of your other ancestors. Y-DNA is most useful if you want to prove a connection to a certain ancestor. Like the mtdna test, Y-DNA may let you trace a line back for dozens of generations. It can also tell you the ethnicity or region of origin of your paternal line. Only males have Y-DNA, so only males can take the test. A woman can still find Y-DNA results by having a close male relative take it for her, such as her brother, father, paternal uncle, or cousin by a paternal uncle (but not her son, since he got his Y-chromosome from his paternal line, not hers). You can also trace other paternal lines by asking an appropriate family member to take the test and share the results with you.
11 Best DNA Tests Updated: September 2018 AncestryDNA: Best for cousin matching, most geographic regions for ethnicity FamilyTree DNA: Best for serious genealogy, YDNA and mtdna tests MyHeritage: Best autosomal test on a budget 23andMe: Best for genetic health screening, not genealogy Living DNA: Best for roots in British Isles
12 How is DNA collected? AncestryDNA: Saliva sample FamilyTree DNA: Cheek swab MyHeritage: Cheek swab 23andMe: Saliva sample Living DNA: Cheek swab
13
14 September 12, 2018 AncestryDNA released updated ethnicity estimates for all customers. The size and makeup of the reference populations grew: ~3,000 reference samples > ~16,000 reference samples The update added 17 new regions to the ethnicity analysis 363 > 380 regions Many regions were redefined or their names were changed to more accurately reflect the region. The method by which AncestryDNA calculates ethnicity changed -- the algorithm now uses stretches of DNA to perform the calculation instead of individual SNPs (small chunks of DNA).
15
16 In this example, several regions were lost, several regions were gained, and several regions were combined together and/or their names were changed.
17 Regions versus Countries DNA tests will often give you a region of origin and not a country WHY? Countries have changed many times throughout human history, in addition to migration and intermarrying across borders. For example, a DNA testing company may not state Germany or France, yet they will state continental Western Europe.
18 Please remember: The accuracy of estimates is constantly improving as more data are collected; there s no clear indication that one company is more accurate than the others. When a company does improve its ethnicity estimates, your profile will automatically be updated, too. You won t have to retake the test to get the new results, but you will have to visit their site. As more and more data get collected, companies update their regions, too. The companies that provide DNA testing divide the world up into regions in different ways. Most companies currently use regions, but the number, location, and names of regions vary from company to company. That means that two different testing companies may give you different ethnicity estimates for the exact same DNA.
19 Let s review an AncestryDNA Summary as an example...
20 GEDMATCH:
THE BASICS OF DNA TESTING. By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library
THE BASICS OF DNA TESTING By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library TYPES OF TESTS Mitochondrial DNA (mtdna/mdna) Y-DNA Autosomal DNA (atdna/audna) MITOCHONDRIAL DNA Found
More informationTRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter
TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter 1-1: DNA: WHERE DO I START? Definition Genetic genealogy is the application of genetics to traditional genealogy. Genetic genealogy uses genealogical
More informationDNA Testing. February 16, 2018
DNA Testing February 16, 2018 What Is DNA? Double helix ladder structure where the rungs are molecules called nucleotides or bases. DNA contains only four of these nucleotides A, G, C, T The sequence that
More informationMitochondrial DNA (mtdna) JGSGO June 5, 2018
Mitochondrial DNA (mtdna) JGSGO June 5, 2018 MtDNA - outline What is it? What do you do with it? How do you maximize its value? 2 3 mtdna a double-stranded, circular DNA that is stored in mitochondria
More informationDNA Opening Doors for Today s s Genealogist
DNA Opening Doors for Today s s Genealogist Presented to JGSI Sunday, March 30, 2008 Presented by Alvin Holtzman Genetic Genealogy Discussion Points What is DNA How can it help genealogists What to expect
More informationDNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016
DNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016 1 What we will cover How testing helps genealogy What is DNA? How do you select from the three testing companies?
More informationAn Introduction. Your DNA. and Your Family Tree. (Mitochondrial DNA) Presentation by: 4/8/17 Page 1 of 10
An Introduction Your DNA and Your Family Tree (Mitochondrial DNA) Presentation by: FredCoffey@aol.com 4/8/17 Page 1 of 10 Coffey Surname, y-dna Project We're now ready to move on and look at the type of
More informationHalley Family. Mystery? Mystery? Can you solve a. Can you help solve a
Can you solve a Can you help solve a Halley Halley Family Family Mystery? Mystery? Who was the great grandfather of John Bennett Halley? He lived in Maryland around 1797 and might have been born there.
More informationPizza and Who do you think you are?
Pizza and Who do you think you are? an overview of one of the newest and possibly more helpful developments in researching genealogy and family history that of using DNA for research What is DNA? Part
More informationYour mtdna Full Sequence Results
Congratulations! You are one of the first to have your entire mitochondrial DNA (DNA) sequenced! Testing the full sequence has already become the standard practice used by researchers studying the DNA,
More informationDNA Testing What you need to know first
DNA Testing What you need to know first This article is like the Cliff Notes version of several genetic genealogy classes. It is a basic general primer. The general areas include Project support DNA test
More informationDNA and Ancestry. An Update on New Tests. Steve Louis. Jewish Genealogical Society of Washington State. January 13, 2014
DNA and Ancestry An Update on New Tests Steve Louis Jewish Genealogical Society of Washington State January 13, 2014 DISCLAIMER This document was prepared as a result of independent work and opinions of
More informationcompany does improve its ethnicity estimates, your profile will automatically be updated, too. You won't have to retake the test to get the new
Ancestry dna kit The Y-DNA test is more limited than the ones from Family Tree DNA Does not offer a less expensive 'autosomal DNA-only' test Can't connect with other matches Can't upload raw data from
More informationGetting the Most Out of Your DNA Matches
Helen V. Smith PG Dip Public Health, BMedLabSci, ADCLT, Dip. Fam. Hist. PLCGS 46 Kraft Road, Pallara, Qld, 4110 Email: HVSresearch@DragonGenealogy.com Website: www.dragongenealogy.com Blog: http://www.dragongenealogy.com/blog/
More informationYour Family 101 Beginning Genealogical Research
Your Family 101 Beginning Genealogical Research What Will We Cover Today? Session 1: Getting Started Session 2: Your Resources Session 3: Common Mistakes and Pitfalls Session 4: DNA Testing and Medical
More informationDNA for Genealogy Librarians. Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District
DNA for Genealogy Librarians Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District What does DNA do? It replicates itself. It codes for the production
More informationAutosomal-DNA. How does the nature of Jewish genealogy make autosomal DNA research more challenging?
Autosomal-DNA How does the nature of Jewish genealogy make autosomal DNA research more challenging? Using Family Finder results for genealogy is more challenging for individuals of Jewish ancestry because
More informationIN THIS ISSUE: February From the Administrator Questions/News...1. George Varner of Missouri Direct Line...2
IN THIS ISSUE: From the Administrator..... 1 Questions/News.......1 George Varner of Missouri Direct Line...2 Do the Newtons & Varners Really Both have Riggs DNA?...2 2016 Newton/Varner Reunion. 5 February
More information[CLIENT] SmithDNA1701 DE January 2017
[CLIENT] SmithDNA1701 DE1704205 11 January 2017 DNA Discovery Plan GOAL Create a research plan to determine how the client s DNA results relate to his family tree as currently constructed. The client s
More informationUsing Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM
Using Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.
More informationUsing X-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM
Using X-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.
More informationAutosomal DNA. What is autosomal DNA? X-DNA
ANGIE BUSH AND PAUL WOODBURY info@thednadetectives.com November 1, 2014 Autosomal DNA What is autosomal DNA? Autosomal DNA consists of all nuclear DNA except for the X and Y sex chromosomes. There are
More informationFirst Results: Intro to FamilyTreeDNA s Family Finder. Learn what to do with results of autosomal DNA testing with FamilyTreeDNA (FTDNA).
First Results: Family Tree DNA When You First Get Your FamilyTreeDNA (FTDNA) Results Objective: Learn what to do with results of autosomal DNA testing with FamilyTreeDNA (FTDNA). Tools: familytreedna.com
More informationDNA Solu)ons for Brick Walls And Adop)on
DNA Solu)ons for Brick Walls And Adop)on "I have not failed. I've just found ten thousand ways that won't work." Thomas Edison Wise Woman Gene+c Genealogy Comments Listen Carefully! 1. DNA is not the be
More informationDAR POLICY STATEMENT AND BACKGROUND Using DNA Evidence for DAR Applications
Effective January 1, 2014, DAR will begin accepting Y-DNA evidence in support of new member applications and supplemental applications as one element in a structured analysis. This analysis will use a
More informationWalter Steets Houston Genealogical Forum DNA Interest Group April 7, 2018
Ancestry DNA and GEDmatch Walter Steets Houston Genealogical Forum DNA Interest Group April 7, 2018 Today s agenda Recent News about DNA Testing DNA Cautions: DNA Data Used for Forensic Purposes New Technology:
More informationDNA, A Genealogy Tool. The Search for an Expert Genealogist, Photos & Clues
DNA, A Genealogy Tool The Search for an Expert Genealogist, Photos & Clues mydanishancestors.com *Slide Show shared in this class & more web-sites under Toolbar/DNA *One doesn t have to have Danish ancestors
More informationUsing Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM
Using Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.
More informationCAGGNI s DNA Special Interest Group
CAGGNI s DNA Special Interest Group 10 Jan 2015 Al & Michelle Wilson Agenda Survey Basics in Fan Charts Recombination Exercise Triangulation Overview Survey 1. Have you taken (or sponsored) a DNA test?
More informationWalter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018
DNA, Ancestry, and Your Genealogical Research- Segments and centimorgans Walter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018 1 Today s agenda Brief review of previous DIG session
More informationLearn what to do with results of autosomal DNA testing from AncestryDNA.
When You First Get Your AncestryDNA Results Objective: Learn what to do with results of autosomal DNA testing from AncestryDNA. Tools: AncestryDNA results; ancestry.com, genesis.gedmatch.com and familytreedna.com
More informationGenetic Genealogy. Rules and Tools. Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter
Genetic Genealogy Rules and Tools Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter I am NOT this guy! 2 Genealogy s Newest Tool Genealogy research: Study of Family History Identifies
More informationRecent Results from the Jackson Brigade DNA Project
Recent Results from the Jackson Brigade DNA Project Dr. Daniel C. Hyde Professor Emeritus of Computer Science Bucknell University Lewisburg, PA Presented at Jackson Brigade Reunion, Horner, WV on August
More informationWhat Can I Learn From DNA Testing?
What Can I Learn From DNA Testing? From where did my ancestors migrate? What is my DNA Signature? Was my ancestor a Jewish Cohanim Priest? Was my great great grandmother really an Indian Princes? I was
More informationThe Structure of DNA Let s take a closer look at how this looks under a microscope.
DNA Basics Adapted from a MyHeritage Blog and the International Society of Genetic Genealogy (ISOGG) Wiki by Earl Cory MyHeritage has started a series to explain DNA, how it works and answer the most common
More informationBefore India: Exploring Your Ancestry With DNA By David G. Mahal
Before India: Exploring Your Ancestry With DNA By David G. Mahal You then receive an email notifying you that your results are ready to explore on utilize your DNA results for family history by Ancestry.com
More informationTools: 23andMe.com website and test results; DNAAdoption handouts.
When You First Get Your 23andMe Results Objective: Learn what to do with results of atdna testing with 23andMe. Tools: 23andMe.com website and test results; DNAAdoption handouts. Exercises: Practice Exercises
More informationUse of DNA information in family research information for IOWFHS members
Use of DNA information in family research information for IOWFHS members What is DNA? Since the discovery of deoxyribonucleic acid (DNA) in the 1950s, we have come to understand more about its role as
More informationGEDmatch Home Page The upper left corner of your home page has Information about you and links to lots of helpful information. Check them out!
USING GEDMATCH Created March 2015 GEDmatch is a free, non-profit site that accepts raw autosomal data files from Ancestry, FTDNA, and 23andme. As such, it provides a large autosomal database that spans
More informationY-DNA Genetic Testing
Y-DNA Genetic Testing 50 2/24/14 Y-DNA Genetic Testing Y-DNA flows from fathers to sons intact SNPs define Y-DNA haplogroups Haplogroups (clans) migrated together Timeframe between mutations is 2,000 to
More informationEller DNA Project. Status Report for Nashville EFA Conference----July 25, Tom Eller, DNA Project Administrator
Eller DNA Project Status Report for Nashville EFA Conference----July 25, 2009 Tom Eller, DNA Project Administrator Eller DNA Project This presentation used material from Family Tree DNA and from World
More information! FTDNA! Ancestry. ! 23andMe. ! Medical Considera,ons. ! Iden,fying family medical history. ! Communica,ng with the medical community
by JEFF CARPENTER! Brief Defini,ons about YDNA, XDNA, mtdna, atdna (Covered in Part 1)! Benefits of Tes,ng DNA! Examples of DNA TESTING! FTDNA! Ancestry! 3andMe Jeff Carpenter, 016 jeffcarpenter1939@gmal.com!
More informationComputer - aided Genealogy. Rob Drew
Computer - aided Genealogy Rob Drew Topics Building your family tree Off-line tools for your laptop or desktop at home. What s a gedcom file? Building an on-line tree. Research websites Where to get help
More informationIntroduction to Autosomal DNA Tools
GENETIC GENEALOGY JOURNEY Debbie Parker Wayne, CG, CGL Introduction to Autosomal DNA Tools Just as in the old joke about a new genealogist walking into the library and asking for the book that covers my
More informationGenealogical Research
DNA, Ancestry, and Your Genealogical Research Walter Steets Houston Genealogical Forum DNA Interest Group March 2, 2019 1 Today s Agenda Brief review of basic genetics and terms used in genetic genealogy
More informationGenetic Genealogy. Using DNA to research your maternal & paternal lines. Ed McGuire. Vermont Genealogy Library 2/24/14
Genetic Genealogy Using DNA to research your maternal & paternal lines Ed McGuire 2/24/14 Introduction Soprano Family Tree 2 2/24/14 Introduction 3 2/24/14 Introduction 4 2/24/14 Introduction Contradictory
More informationGetting the Most of Your DNA Test. Friends of Irish Research Richard Reid
Getting the Most of Your DNA Test Friends of Irish Research Richard Reid So You Have Been Tested! The results are back and now is time to explore and see if any of your brick walls can be broken down.
More informationGenetic Genealogy Journey DNA Projects by Debbie Parker Wayne, CG SM, CGL SM
Genetic Genealogy Journey DNA Projects by Debbie Parker Wayne, CG SM, CGL SM Genealogy can be a solitary pursuit. Genealogists sometimes collaborate to work on common lines, but lone researchers can perform
More informationYoder Doors Opened by DNA Studies
Yoder Doors Opened by DNA Studies A Special Report to the 2012 North Carolina Yoder Reunion By Chris Yoder Yoder Newsletter Oct. 2012 www.yodernewsletter.org Established 1983 BACKGROUND How DNA Testing
More informationUsing Mitochondrial DNA (mtdna) for Genealogy Debbie Parker Wayne, CG, CGL SM
Using Mitochondrial DNA (mtdna) for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical
More informationGenetic Genealogy Journey Why Is My Cousin Not on my DNA Match List? Debbie Parker Wayne, CG SM, CGL SM
Genetic Genealogy Journey Why Is My Cousin Not on my DNA Match List? Debbie Parker Wayne, CG SM, CGL SM The CSI television shows have conditioned us to expect exact DNA matches and lead us to think DNA
More informationAn Introduction to Genetic Genealogy
An Introduction to Genetic Genealogy David A. Pike dapike@math.mun.ca Presented To: Family History Society of Newfoundland and Labrador 24 January 2006 Slide 1 of 21 Overview Genetic Genealogy using genetic
More informationDNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding
DNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding by Dr. Ing. Robert L. Baber 2014 July 26 Rights reserved, see the copyright notice at http://gengen.rlbaber.de
More informationEvery human cell (except red blood cells and sperm and eggs) has an. identical set of 23 pairs of chromosomes which carry all the hereditary
Introduction to Genetic Genealogy Every human cell (except red blood cells and sperm and eggs) has an identical set of 23 pairs of chromosomes which carry all the hereditary information that is passed
More informationFamily Tree DNA Genetic Genealogy Started Here
Family Tree DNA Genetic Genealogy Started Here With 253,000 samples in our DNA database (the largest of its kind in the world) your genealogical search could become even easier Why Bennett Greenspan founded
More informationFREQUENTLY ASKED QUESTIONS ABOUT THE OWSTON/OUSTON DNA PROJECT
FREQUENTLY ASKED QUESTIONS ABOUT THE OWSTON/OUSTON DNA PROJECT 1. What has been discovered thus far and what may be discovered with testing? The Owston/Ouston DNA project grew out of the combined genealogical
More informationUnderstanding DNA in Genealogy. Peter Biggins, BY3164 Darien Library, Darien, CT November 18, 2017
Understanding DNA in Genealogy Peter Biggins, BY3164 Darien Library, Darien, CT November 18, 2017 1953: Watson 25, Crick 37, Franklin 33 My BY3164 SNP 1953 paper published on the structure of DNA 1962
More informationEwing Surname Y-DNA Project Article 8
Ewing Surname Y-DNA Project Article 8 This is the eighth in a series of articles about the Ewing Surname Y-DNA Project. The previous seven articles have appeared in the last seven issues of the Journal
More informationGenealogy: DNA And The Family Tree By James Mayflower READ ONLINE
Genealogy: DNA And The Family Tree By James Mayflower READ ONLINE CeCe Moore's "DNA Testing for Genealogy - Getting Started" series is a Family Tree DNA is currently the only commercial laboratory offering
More informationFind JCD Project Date: Identification-DNA Process Updated:
New Look Investigations Created by: Jack Friess Find JCD Project Date: 04-20-2018 Identification-DNA Process Updated: 05-24-2018 Questions and Answers Identification-DNA (ID-DNA) is a scientific process
More informationA Day Out With Your DNA
A Day Out With Your DNA Diahan Southard www.yourdnaguide.com Your testing company has evaluated around 800,000 locations on your DNA to help them determine your origins and your genetic cousins. While
More informationWalter Steets Houston Genealogical Forum DNA Interest Group May 5, 2018
GEDmatch: The Golden State Killer Tier 1 Tools Walter Steets Houston Genealogical Forum DNA Interest Group May 5, 2018 1 Today s agenda Walter s Take on DNA Developments Growth in Number of DNA Testers
More informationSouhrada Family Reunion U.S.A. #36
Souhrada Family Reunion U.S.A. #36 CEDAR FALLS, IOWA AUGUST 11, 2018 THANKS TO DAVE & CHERIE SOUHRADA AND JANEL STEPHENS! NOTE: SOUHRADA REUNION IN THE CZECH REPUBLIC SEPTEMBER 15, 2018 In memory of Leota
More informationDNA study deals blow to theory of European origins
23 August 2011 Last updated at 23:15 GMT DNA study deals blow to theory of European origins By Paul Rincon Science editor, BBC News website Did Palaeolithic hunters leave a genetic legacy in today's European
More informationWalter Steets Houston Genealogical Forum DNA Interest Group January 27, 2018
Using Ancestry DNA and Third-Party Tools to Research Your Shared DNA Segments Walter Steets Houston Genealogical Forum DNA Interest Group January 27, 2018 1 Today s agenda Brief review of previous DIG
More informationLearn what to do with results of autosomal DNA testing from AncestryDNA. Tools: AncestryDNA results; ancestry.com, gedmatch.com and familytreedna.
First Look : AncestryDNA When You First Get Your AncestryDNA Results Objective: Learn what to do with results of autosomal DNA testing from AncestryDNA. Tools: AncestryDNA results; ancestry.com, gedmatch.com
More informationBig Y-700 White Paper
Big Y-700 White Paper Powering discovery in the field of paternal ancestry Authors: Caleb Davis, Michael Sager, Göran Runfeldt, Elliott Greenspan, Arjan Bormans, Bennett Greenspan, and Connie Bormans Last
More informationAdvanced Autosomal DNA Techniques used in Genetic Genealogy
Advanced Autosomal DNA Techniques used in Genetic Genealogy Tim Janzen, MD E-mail: tjanzen@comcast.net Summary of Chromosome Mapping Technique The following are specific instructions on how to map your
More informationDNA (DeoxyriboNucleic Acid)
Basics of DNA & Sales and Marketing Presented by: Kim Levaggi of Chromosomal Labs DNA (DeoxyriboNucleic Acid) DNA a very long molecule that is essentially the instruction manual to cells and organisms.
More informationWINSLOW HERITAGE SOCIETY ~~~~~~~~~~~~~~~~~~
Newsletter, Vol. 2, No. 1 March, 2015 WINSLOW HERITAGE SOCIETY ~~~~~~~~~~~~~~~~~~ In Vol. 1, No. 1 of the Winslow Heritage Society Newsletter, Kathy Myers, Society Governor, a descendant of Kenelm Winslow,
More informationBasics of DNA & Sales and Marketing
Basics of DNA & Sales and Marketing Presented by: Kim Levaggi of Chromosomal Labs 1 DNA (DeoxyriboNucleic Acid) DNA a very long molecule that is essentially the instruction manual to cells and organisms.
More informationSteve Harding, *Turi King and *Mark Jobling Universities of Nottingham & *Leicester, UK
Viking DNA Steve Harding, *Turi King and *Mark Jobling Universities of Nottingham & *Leicester, UK Viking DNA in Northern England Project Part 1 - Wirral and West Lancashire (2002-2007) Part 2 - North
More informationWalter Steets Houston Genealogical Forum DNA Interest Group February 24, 2018
Using Ancestry DNA and Third-Party Tools to Research Your Shared DNA Segments Part 2 Walter Steets Houston Genealogical Forum DNA Interest Group February 24, 2018 1 Today s agenda Brief review of previous
More informationDNA TESTING. This is the testing regime for FamilyTreeDNA. Other SNP tests were ordered from Yseq.
DNA & GENEALOGY DNA TESTING This is the testing regime for FamilyTreeDNA. Other SNP tests were ordered from Yseq. Product Date Batch Family Finder 30-May-14 Completed 569 05-Aug-14 Batched 569 05-Jul-14
More informationApproaching and Connecting with Your DNA Matches
Approaching and Connecting with Your DNA Matches Shannon Stewart Christmas, MCP throughthetreesblog@gmail.com Understand DNA Tests The four types of DNA and the relevant test companies Segment triangulation
More informationPrimer on Human Pedigree Analysis:
Primer on Human Pedigree Analysis: Criteria for the selection and collection of appropriate Family Reference Samples John V. Planz. Ph.D. UNT Center for Human Identification Successful Missing Person ID
More informationContributed by "Kathy Hallett"
National Geographic: The Genographic Project Name Background The National Geographic Society is undertaking the ambitious process of tracking human migration using genetic technology. By using the latest
More informationVisual Phasing of Chromosome 1
Visual Phasing of Chromosome 1 If you have the possibility to test three full siblings, then the next great thing you could do with your DNA, is to try out the Visual Phasing technique developed by Kathy
More informationTracking Your Roots With DNA
Tracking Your Roots With DNA Genetic Genealogy Lisa R Franklin RN,BSN 31 Oct 2013/27 Jun 2014 Andalusia, Alabama Why DNA test? Determine if two people are related Determine if two people descend from the
More informationDNA Haplogroups Report
DNA Haplogroups Report for Matthew Mayberry Generated and printed on Sep 25 2011, 01:59 pm X This is a mtdna Haplogroup Report This is a mtdna Subclade Report Search criteria used in this report: HVR-1
More informationReport on the VAN_TUYL Surname Project Y-STR Results 3/11/2013 Rory Van Tuyl
Report on the VAN_TUYL Surname Project Y-STR Results 3/11/2013 Rory Van Tuyl Abstract: Recent data for two descendants of Ott van Tuyl has been added to the project, bringing the total number of Gameren
More informationWelcome to this issue of Facts & Genes, the only publication devoted to Genetic Genealogy.
Facts & Genes from Family Tree DNA ================================== March 3, 2004 Volume 3, Issue 2 In This Issue ============= Editor's Corner In the News: Family Tree DNA Announcements Haplogroups:
More informationNextGen Genealogy: The DNA Connection By David R. Dowell
NextGen Genealogy: The DNA Connection By David R. Dowell NextGen Genealogy: The DNA Connection: Amazon.co.uk: David R - Buy NextGen Genealogy: The DNA Connection by David R. Dowell Ph.D (ISBN: 9781610697279)
More informationDiscovering Hard to Find Ancestry DNA Matches Page 1
Discovering Hard To Find Ancestry DNA Matches Alice Kalush 5/15/2018 This document discusses several methods for finding matches to your Ancestry DNA test that do not easily show up for you in the Hints
More informationClan Galbraith Association Application for or Renewal of Membership
Clan Galbraith Association Application for or Renewal of Membership ELIGIBILITY FOR MEMBERSHIP: Membership in the Clan Galbraith Association is open to any person related by blood or marriage to the Galbraith
More informationDNA: UNLOCKING THE CODE
DNA: UNLOCKING THE CODE Connecting Cousins for Genetic Genealogy Bryant McAllister, PhD Associate Professor of Biology University of Iowa bryant-mcallister@uiowa.edu Iowa Genealogical Society April 9,
More informationIntroduction. Looking at Faces
Introduction Looking at Faces Our complete ancestry is within us. The individual is a result of a long chain of ancestors who are still present within us and exert power over us. Men must go inside themselves,
More informationAn O-F3288 Y DNA Discovery for Patrilineal Descendants of James Revell (Accomack) By Marie A. Rundquist, DNA Project Administrator November 2018
Project Scope Rundquist O-F3288 White Paper 11/2018 An O-F3288 Y DNA Discovery for Patrilineal Descendants of James Revell (Accomack) By Marie A. Rundquist, DNA Project Administrator November 2018 The
More informationMEET YOUR VOLUNTEER PRATER PROJECT ADMINISTRATORS
Prater* Project NEWSLETTER i Vol I, No 1 Click on graphic above to view the latest Prater Project Results Tables using the drop-down menus MEET YOUR VOLUNTEER PRATER PROJECT ADMINISTRATORS Laverne Piatt
More informationGenesis and Genetics Matthew Price
Genesis and Genetics Matthew Price Apologetics and Creation Camp 16 June 2018 Karakariki Christian Camp, Waikato, NZ 1 What is Science? 2 What is Science? Hypothesis Theory Start with a hypothesis; a reasonable
More informationThe Jewish Genealogical Society of Great Britain
Edition No. 1-04/2007 (currently under revision) Reformatted and reissued 01/2010 Written by Jill L. Whitehead, M.A. Issued for JGSGB by JGSGB Education & Mentoring JGSGB 33 Seymour Place London W1H 5AP
More informationIdentification of the Hypothesized African Ancestry of the Wife of Pvt. Henry Windecker Using Genomic Testing of the Autosomes.
Identification of the Hypothesized African Ancestry of the Wife of Pvt. Henry Windecker Using Genomic Testing of the Autosomes Introduction African Ancestry: The hypothesis, based on considerable circumstantial
More informationWhat to Expect When You re Clustering
What to Expect When You re Clustering Walter Steets Houston Genealogical Forum DNA Interest Group January 5, 2018 1 Today s agenda New Ancestry Match Comparison Report Clustering for DNA Matches Describe
More informationGenetic Identity and
Genetic Identity and GACATGTAGCTCTTCACTTCACCCAGGTTGGGTTGTGTCAACAGGAAACATTGTAACATATCACTTGGATTAGCACCTAGG/TTAT/TTAT/TTA Community DTC Genetic Testing Workshop The National Academies' August 31 September 1,
More informationGenetic genealogy and my ancestral background
Genetic genealogy and my ancestral background Edward Gelles In recent years DNA tests have become an important part of genealogical research. The commercial availability of these tests, the increase in
More informationW H I T E S I D E F A M I L Y A S S O C I A T I O N
WHITESIDE FAMILY ASSOCIATION W H I T E S I D E F A M I L Y A S S O C I A T I O N S AV E T H E DAT E!! SPECIAL POINTS OF INTEREST: ANNUAL MEETING PLANS 2014 Annual Meeting The WFA plans to hold it its 2014
More informationCreating a Private and Unsearchable Ancestry Family Tree
Creating a Private and Unsearchable Ancestry Family Tree Creating a tree on Ancestry is a step you can take whilst waiting for your DNA results to be processed. You do not have to have a subscription to
More informationGliesianDNA (BETA) atdna Relationships Predictions for cms with no influence factors
GliesianDNA (BETA) atdna Relationships Predictions for 562.3 cms with no influence factors Report generated on: 2018-07-07T13:08:31.511 by Gliesian, LLC's GliesianDNA (beta), version 0.4.1 Introduction
More informationPutting the genes into genealogy
Putting the genes into genealogy DNA testing can help find lost branches of your family tree. Susan C Meates describes how DNA surname projects work DNA testing for genealogy has been available since 2000,
More informationhave to get on the phone or family members for the names of more distant relatives.
Ideas for Teachers: Give each student the family tree worksheet to fill out at home. Explain to them that each family is different and this worksheet is meant to help them plan their family tree. They
More information