DNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding

Size: px
Start display at page:

Download "DNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding"

Transcription

1 DNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding by Dr. Ing. Robert L. Baber 2014 July 26 Rights reserved, see the copyright notice at Robert L. Baber 0

2 Topics 1. DNA Basics types of DNA and their inheritance DNA structure, STR, SNP Haplogroups 2. Y DNA Marker Tables 3. Ancestral Trees paternal only vs. both parents all vs. only branching ancestors (MRCAs) 4. Properties of Ancestral Trees usual assumptions 5. Mutation Graphs 6. Comparison of Marker Tables, Ancestral Trees and Mutation Graphs differences, similarities, correspondence 7. Summary Robert L. Baber 1

3 1. DNA Basics: Types of DNA Each cell in the human body contains many copies of mitrochondrial DNA (mtdna) outside the nucleus and 23 pairs of chromosomes in the nucleus. The 23rd pair consists of either o one X and one Y chromosome (male) or o two X chromosomes (female) Robert L. Baber 2

4 1. DNA Basics: Inheritance of the Types of DNA Y DNA (the Y chromosome) is passed from father to son unchanged except for occasional mutations. mtdna is passed from mother to each child, son or daughter, unchanged except for rare mutations. Each male receives mtdna from his mother but does not pass it on to his children. The rest of the DNA (22 chromosome pairs and the X chromosomes) is called autosomal DNA. Random selections from the autosomal DNA of the two parents are combined and passed down to the child. Robert L. Baber 3

5 1. DNA Basics: DNA Structure DNA has a helical structure, that is, the structure of a twisted or spiral ladder. Each rung in the ladder consists of a pair of submolecules, each called a nucleobase or simply base. I.e. each rung in the ladder is a base pair. There are four different types of bases in DNA: adenine, cytosine, guanine and thymine, abbreviated A, C, G and T respectively. Any sequence of rungs in the DNA ladder can be specified or described by the corresponding sequence of the letters A, C, G and T. Robert L. Baber 4

6 1. DNA Basics: DNA Size The 23 pairs of chromosomes together contain more than 3 billion bp (3,000,000,000 base pairs). The X chromosome contains about 155 million bp (155,000,000 base pairs). The Y chromosome contains about 59 million bp (59,000,000 base pairs). Each copy of the mtdna contains 16,569 positions. Robert L. Baber 5

7 1. DNA Basics: STR A short tandem repeat, usually abbreviated STR, is a sequence of base pairs within a chromosome in which a shorter subsequence is repeated a number of times. Such an STR is also often called a marker. The value of the marker is the number of times the shorter subsequence is repeated within the STR. STRs are commonly used in Y DNA analyses at the family (surname) level. Robert L. Baber 6

8 1. DNA Basics: SNP A single nucleotide polymorphism or SNP is a single base pair (a single rung in the DNA ladder) that occurs in different forms, i.e. in both an original and in a mutated form. Mutated forms of certain SNPs are, for example, used as a basis for defining haplogroups and haplosubclades at all levels. One example is the SNP M75. A mutation of the relevant base from the original G to the mutated A identifies a particular subclade of Y haplogroup E. SNPs also convey many other types of genetic information. Robert L. Baber 7

9 1. DNA Basics: Haplogroups In the course of time, mutations giving rise to SNPs have occurred in the Y chromosome. These mutations subdivide repeatedly the collection of Y chromosomes in humans, forming a hierarchical relationship between the individuals in the population. The results of the first subdivision are called haplogroups. The subgroups are called subclades. There are (currently) 20 top level Y haplogroups, each denoted by a letter of the alphabet. Each of these haplogroups is further subdivided hierarchically into subclades. mtdna is similarly classified into haplogroups and subclades. Robert L. Baber 8

10 1. DNA Basics: Haplogroups Two notational forms are currently in use for Y haplogroups and their subclades. The first denotes a subclade by a sequence of letters and digits specifying in full detail the subclade s hierarchical position in the haplogroup tree, e.g. E1b1b1a1b1a4. As the tree grows, these names become ever longer and less readable. Also, as modifications are made to the structure of the tree as new information becomes available, the names are changed to reflect the new hierarchy. For example, E1b1b1a1b1a6 was an earlier name for the current E1b1b1a1b1a4. Robert L. Baber 9

11 1. DNA Basics: Haplogroups The second notational form consists of the highest level letter followed by the SNP defining the lowest level subclade. For subclade E1b1b1a1b1a4 in the previous slide, the second notational form is E L241. This notation will not change. Of course, if a person is retested and found to be in a lower level subclade than previously known, then his subclade notation will change to the SNP defining his newly known lowest level subclade. E.g. if a person previously known only to be in subclade E V13 is retested as L241 positive, then his subclade will be changed to E L241, which is a subclade of E V13. The second notational form is not (yet?) used for mtdna. Robert L. Baber 10

12 2. Y DNA Marker Tables A marker table contains each tested person s marker values. Such a sequence of marker values is called a haplotype. A convenient form for a marker table is one data row for each tested person s marker values (haplotype). one data column for each marker. A marker (column) with only one value (all tested persons have the same value) can be omitted. Robert L. Baber 11

13 2. Y DNA Marker Tables If there are n different values for a marker one value can come from the common ancestor, every other value, i.e. n 1 values, must come from a mutation. Add n 1 over all markers. The result is the minimum number of mutations needed to explain the observed Y DNA test results assuming a common ancestor. Robert L. Baber 12

14 2. Y DNA Marker Tables: Example Marker group: Marker name: DYS DYS DYS DYS DYS DYS DYS DYS Y G DYS CDYb Name c A Bert Carl Fred Guy Hugh Jim Paul min # mutations At least 12 mutations from a common ancestor are needed to explain these results. Robert L. Baber 13

15 2. Y DNA Marker Tables: Example Again: One value for any particular marker can come from the common ancestor. Each other value for that marker must come from a mutation. Therefore, for any marker with n different values, n 1 mutations must have occurred at least. Duplicate or exactly reversing mutations are uncommon in ancestral trees typical of family research, with fewer than about 50 to 100 generations along all paths. In larger trees, duplicate or reversing mutations occur sometimes. Then more than the minimum number of mutations as calculated above will have occurred. Robert L. Baber 14

16 3. Ancestral Trees Several different types family tree, with mothers and fathers, brothers and sisters, spouses, uncles, aunts, cousins, etc. paternal lines only, with fathers, sons, brothers, uncles, male cousins, only (e.g. no spouses). paternal lines only, with tested persons and their most recent common ancestors (MRCAs) only. A Y DNA ancestral tree (paternal lines only) can show how the various persons Y DNA marker values were derived from those of the common ancestor. Robert L. Baber 15

17 3. Ancestral Trees: Example A8 A7 A6 A4 A5 A1 A2 A3 Bert Carl Fred Guy Hugh Jim Paul Tested persons: Bert, Carl, Fred, Guy, Hugh, Jim and Paul Robert L. Baber 16

18 3. Ancestral Trees: Tested Persons and Branching Nodes (MRCAs) Only A8 A7 A6 A4 A5 A2 Bert Carl Fred Guy Hugh Jim Paul Robert L. Baber 17

19 3. Ancestral Trees: Ancestors Marker Values If, for example, Carl and Fred have the same value 13 for some marker, but their MRCA had a different value for that marker, then two identical mutations and hence more than the minimum number would be needed. Typically, therefore, their MRCA will have the same value. This principle can be used to determine many marker values of ancestors. A2, 13 Carl, 13 Fred, 13 Robert L. Baber 18

20 3. Ancestral Trees: Ancestors Marker Values More generally, if any two persons in an ancestral tree have the same value of a marker, then every person on the ancestral path between those two persons will typically have the same value of that marker. Otherwise, more than the minimum number of mutations would be required. A4, 16 A2, 16 Carl, 16 Fred, 17 Guy, 16 Robert L. Baber 19

21 4. Properties of Ancestral Trees Each node represents one person. A top node is present and represents the common ancestor. Ancestor descendant relationship is shown. The numbers of generations between nodes are usually known and indicated. A Y DNA ancestral tree branches downward only. Robert L. Baber 20

22 4. Properties of Ancestral Trees Definition: A minimal ancestral tree is a paternal line only ancestral tree including at least two bottom level persons, the MRCA1 of all bottom level persons, and the various intermediate MRCAs only and in which only the minimum possible number of mutations occurred. In such an ancestral tree all upper level nodes are branching nodes. A minimal tree is usually assumed until shown to be impossible for the given Y DNA marker values. MRCA1 MRCA2 MRCA3 MRCA4 A B C D E Robert L. Baber 21

23 4. Properties of Ancestral Trees MRCA1 MRCA2 MRCA3 MRCA4 A B C D E If, in a minimal tree, there is a mutation crossing over the dashed line, then the bottom level person receiving the mutation will have a unique value of the marker in question. That is, no other bottom level person will have that marker value. If, on the other hand, there is no mutation crossing over the dashed line, then at least two nodes will have the same haplotype. In this example, nodes A and B will have the same haplotype, as will nodes D and E. Robert L. Baber 22

24 4. Properties of Ancestral Trees MRCA1 MRCA2 MRCA3 MRCA4 A B C D E Therefore, in a minimal tree either some bottom level person has a unique value OR at least two bottom level persons have the same haplotype. If there is neither a unique value nor two bottom level persons with the same haplotype, then the tree is not minimal; it requires more than the minimum number of mutations. Robert L. Baber 23

25 4. Properties of Ancestral Trees: Additional Property for Mutations Restating: IF two or more persons (haplotypes) have a common ancestor AND the minimum number of mutations suffices to explain how the haplotypes derive from a common ancestor THEN either at least two persons have the same haplotype OR at least one person has a unique value. This property enables us to derive the structure of an ancestral tree from the Y DNA marker values only. Such derivation is the topic of another document on this web site. A minimal tree is usually assumed until shown to be impossible for the given Y DNA marker values. Robert L. Baber 24

26 5. Mutation Graphs A mutation graph is a graph connecting several different haplotypes with each other. is, in effect, a compressed, abstract version of an ancestral tree. has no top. does not indicate the direction of ancestral relationships. can be derived from a marker table. Robert L. Baber 25

27 5. Mutation Graphs Each node represents a haplotype (not a person). Each line between nodes represents one or more mutations. A mutation graph has the branching structure of a tree; it contains no cycle. A mutation graph shows the mutational relationships between the several persons haplotypes. Robert L. Baber 26

28 5. Mutation Graphs Initial assumption for constructing/deducing a mutation graph: A minimal ancestral tree exists for the tested persons and their MRCA. Deriving a mutation graph from a marker table (Y DNA test results) is the subject of another unit in this series. Robert L. Baber 27

29 5. Mutation Graphs The mutation graph below corresponds to the example of the marker table in Section 1 and the ancestral tree in Section 2 above. Carl H1 Hugh Bert H2 Fred Guy Jim Paul Robert L. Baber 28

30 5. Mutation Graphs: Deducing an Ancestral Tree But... where is the top? One cannot tell from the mutation graph alone. In the case of the preceding slide, we know that the tested persons Bert, Carl, Fred, Guy, Hugh, Jim and Paul are at the bottom level of the tree. But only Fred, Guy and Jim/Paul are outer, or end, or bottom nodes, that is, nodes with only one connecting line each. The others Bert, Carl and Hugh must be extracted from their nodes. (They share their nodes with some of their ancestors.) The top (common ancestor of all) is still unknown. It could be any ancestor of Carl and Fred, of Guy, of Hugh, of Bert, or of Jim and Paul. Picking up any of these nodes lets the rest of the mutation graph fall into the form of an ancestral tree, with the tested persons at the bottom level. Any of these trees would be a possible ancestral tree for the persons tested. A known top can be introduced: the mode of the haplotypes of other surnames in the same haplosubclade, a known earlier ancestor or a more distant relative. Robert L. Baber 29

31 6. Comparison of Marker Tables, Ancestral Trees and Mutation Graphs A marker table lists for each tested person his marker values (haplotypes). An ancestral tree shows how the various persons descended from their common ancestor and how the various persons marker values were derived from those of the common ancestor. A mutation graph shows the mutational relationships between the several persons haplotypes. Robert L. Baber 30

32 6. Comparison: an Ancestral Tree and its Mutation Graph H2 A8 Each green dashed border encloses one node in the mutation graph. A7 A6 H1 A4 A5 A1 A2 A3 Bert Carl Fred Guy Hugh Jim Paul Robert L. Baber 31

33 6. Comparison: an Ancestral Tree and its Mutation Graph Each green dashed border in the preceding slide encloses one node in the mutation graph. One node in the mutation graph includes all persons in the ancestral tree with the same haplotype. Persons on the lines between nodes in the mutation graph have haplotypes that are intermediate between the connected nodes. Robert L. Baber 32

34 6. Comparison: the Ancestral Tree and its Mutation Graph Node in Mutation Graph Bert Carl Fred Guy Hugh Jim/Paul H1 H2 Node(s) in Ancestor Tree Bert, A1, A7 Carl, A2 Fred Guy Hugh, A6 Jim, Paul, A3, A5 A4 A8 Robert L. Baber 33

35 6. Comparison: an Ancestral Tree and a Mutation Graph Property ancestral tree mutation graph each node represents one person one haplotype has a top node yes no lines between nodes indicate direction of ancestral relationship mutations between nodes yes persons, generations per node 1 person Robert L. Baber 34 no not necessarily (0 or more) at least 1 (1 or more) nodes per haplotype 1 or more 1 number of generations between nodes often identified and shown 1 or more cannot be determined or shown Ancestral trees and mutation graphs are closely related, but also fundamentally different.

36 7. Summary A marker table lists the tested persons Y DNA marker values. is a basis for analysis. An ancestral tree shows the relationships between tested persons and their ancestors. A mutation graph shows the mutational relationships between haplotypes. All three are useful in family genealogical research. Robert L. Baber 35

37 7. Summary From a marker table one can derive a mutation graph. From a mutation graph one can derive an ancestral tree. From a marker table and an ancestral tree one can deduce ancestors Y DNA. Robert L. Baber 36

38 7. Summary Marker Table Mutation Graph Ancestors Y DNA Ancestral Tree Robert L. Baber 37

39 Our ancestors never completely died. They continue to live in our DNA. Robert L. Baber 38

40 The End Robert L. Baber 39

Every human cell (except red blood cells and sperm and eggs) has an. identical set of 23 pairs of chromosomes which carry all the hereditary

Every human cell (except red blood cells and sperm and eggs) has an. identical set of 23 pairs of chromosomes which carry all the hereditary Introduction to Genetic Genealogy Every human cell (except red blood cells and sperm and eggs) has an identical set of 23 pairs of chromosomes which carry all the hereditary information that is passed

More information

Your mtdna Full Sequence Results

Your mtdna Full Sequence Results Congratulations! You are one of the first to have your entire mitochondrial DNA (DNA) sequenced! Testing the full sequence has already become the standard practice used by researchers studying the DNA,

More information

TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter

TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter 1-1: DNA: WHERE DO I START? Definition Genetic genealogy is the application of genetics to traditional genealogy. Genetic genealogy uses genealogical

More information

Meek DNA Project Group B Ancestral Signature

Meek DNA Project Group B Ancestral Signature Meek DNA Project Group B Ancestral Signature The purpose of this paper is to explore the method and logic used by the author in establishing the Y-DNA ancestral signature for The Meek DNA Project Group

More information

Using Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM

Using Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM Using Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.

More information

Halley Family. Mystery? Mystery? Can you solve a. Can you help solve a

Halley Family. Mystery? Mystery? Can you solve a. Can you help solve a Can you solve a Can you help solve a Halley Halley Family Family Mystery? Mystery? Who was the great grandfather of John Bennett Halley? He lived in Maryland around 1797 and might have been born there.

More information

DNA Testing What you need to know first

DNA Testing What you need to know first DNA Testing What you need to know first This article is like the Cliff Notes version of several genetic genealogy classes. It is a basic general primer. The general areas include Project support DNA test

More information

Walter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018

Walter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018 DNA, Ancestry, and Your Genealogical Research- Segments and centimorgans Walter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018 1 Today s agenda Brief review of previous DIG session

More information

The Meek Family of Allegheny Co., PA Meek Group A Introduction

The Meek Family of Allegheny Co., PA Meek Group A Introduction Meek Group A Introduction In the 1770's a significant number of families named Meek(s) lived in S. W. Pennsylvania and they can be identified in the records of Westmoreland, Allegheny and Washington Counties.

More information

Genealogical Research

Genealogical Research DNA, Ancestry, and Your Genealogical Research Walter Steets Houston Genealogical Forum DNA Interest Group March 2, 2019 1 Today s Agenda Brief review of basic genetics and terms used in genetic genealogy

More information

The Meek Family of Allegheny Co., PA Meek Group A Introduction

The Meek Family of Allegheny Co., PA Meek Group A Introduction Meek Group A Introduction In the 1770's a significant number of families named Meek(s) lived in S. W. Pennsylvania and they can be identified in the records of Westmoreland, Allegheny and Washington Counties.

More information

What Can I Learn From DNA Testing?

What Can I Learn From DNA Testing? What Can I Learn From DNA Testing? From where did my ancestors migrate? What is my DNA Signature? Was my ancestor a Jewish Cohanim Priest? Was my great great grandmother really an Indian Princes? I was

More information

Recent Results from the Jackson Brigade DNA Project

Recent Results from the Jackson Brigade DNA Project Recent Results from the Jackson Brigade DNA Project Dr. Daniel C. Hyde Professor Emeritus of Computer Science Bucknell University Lewisburg, PA Presented at Jackson Brigade Reunion, Horner, WV on August

More information

Using X-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM

Using X-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM Using X-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.

More information

Kenneth Nordtvedt. Many genetic genealogists eventually employ a time-tomost-recent-common-ancestor

Kenneth Nordtvedt. Many genetic genealogists eventually employ a time-tomost-recent-common-ancestor Kenneth Nordtvedt Many genetic genealogists eventually employ a time-tomost-recent-common-ancestor (TMRCA) tool to estimate how far back in time the common ancestor existed for two Y-STR haplotypes obtained

More information

Using Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM

Using Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM Using Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.

More information

Mitochondrial DNA (mtdna) JGSGO June 5, 2018

Mitochondrial DNA (mtdna) JGSGO June 5, 2018 Mitochondrial DNA (mtdna) JGSGO June 5, 2018 MtDNA - outline What is it? What do you do with it? How do you maximize its value? 2 3 mtdna a double-stranded, circular DNA that is stored in mitochondria

More information

DNA Opening Doors for Today s s Genealogist

DNA Opening Doors for Today s s Genealogist DNA Opening Doors for Today s s Genealogist Presented to JGSI Sunday, March 30, 2008 Presented by Alvin Holtzman Genetic Genealogy Discussion Points What is DNA How can it help genealogists What to expect

More information

Pizza and Who do you think you are?

Pizza and Who do you think you are? Pizza and Who do you think you are? an overview of one of the newest and possibly more helpful developments in researching genealogy and family history that of using DNA for research What is DNA? Part

More information

Walter Steets Houston Genealogical Forum DNA Interest Group November 18, 2017

Walter Steets Houston Genealogical Forum DNA Interest Group November 18, 2017 DNA, Ancestry, and Your Genealogical Research Session 2 Walter Steets Houston Genealogical Forum DNA Interest Group November 18, 2017 1 Today s agenda Brief review of previous DIG session Degrees of Separation

More information

DNA Testing. February 16, 2018

DNA Testing. February 16, 2018 DNA Testing February 16, 2018 What Is DNA? Double helix ladder structure where the rungs are molecules called nucleotides or bases. DNA contains only four of these nucleotides A, G, C, T The sequence that

More information

Using Mitochondrial DNA (mtdna) for Genealogy Debbie Parker Wayne, CG, CGL SM

Using Mitochondrial DNA (mtdna) for Genealogy Debbie Parker Wayne, CG, CGL SM Using Mitochondrial DNA (mtdna) for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical

More information

The DNA Case for Bethuel Riggs

The DNA Case for Bethuel Riggs The DNA Case for Bethuel Riggs The following was originally intended as an appendix to Alvy Ray Smith, Edwardian Riggses of America I: Elder Bethuel Riggs (1757 1835) of Morris County, New Jersey, and

More information

DAR POLICY STATEMENT AND BACKGROUND Using DNA Evidence for DAR Applications

DAR POLICY STATEMENT AND BACKGROUND Using DNA Evidence for DAR Applications Effective January 1, 2014, DAR will begin accepting Y-DNA evidence in support of new member applications and supplemental applications as one element in a structured analysis. This analysis will use a

More information

Autosomal-DNA. How does the nature of Jewish genealogy make autosomal DNA research more challenging?

Autosomal-DNA. How does the nature of Jewish genealogy make autosomal DNA research more challenging? Autosomal-DNA How does the nature of Jewish genealogy make autosomal DNA research more challenging? Using Family Finder results for genealogy is more challenging for individuals of Jewish ancestry because

More information

Y-DNA Genetic Testing

Y-DNA Genetic Testing Y-DNA Genetic Testing 50 2/24/14 Y-DNA Genetic Testing Y-DNA flows from fathers to sons intact SNPs define Y-DNA haplogroups Haplogroups (clans) migrated together Timeframe between mutations is 2,000 to

More information

Autosomal DNA. What is autosomal DNA? X-DNA

Autosomal DNA. What is autosomal DNA? X-DNA ANGIE BUSH AND PAUL WOODBURY info@thednadetectives.com November 1, 2014 Autosomal DNA What is autosomal DNA? Autosomal DNA consists of all nuclear DNA except for the X and Y sex chromosomes. There are

More information

THE BASICS OF DNA TESTING. By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library

THE BASICS OF DNA TESTING. By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library THE BASICS OF DNA TESTING By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library TYPES OF TESTS Mitochondrial DNA (mtdna/mdna) Y-DNA Autosomal DNA (atdna/audna) MITOCHONDRIAL DNA Found

More information

! FTDNA! Ancestry. ! 23andMe. ! Medical Considera,ons. ! Iden,fying family medical history. ! Communica,ng with the medical community

! FTDNA! Ancestry. ! 23andMe. ! Medical Considera,ons. ! Iden,fying family medical history. ! Communica,ng with the medical community by JEFF CARPENTER! Brief Defini,ons about YDNA, XDNA, mtdna, atdna (Covered in Part 1)! Benefits of Tes,ng DNA! Examples of DNA TESTING! FTDNA! Ancestry! 3andMe Jeff Carpenter, 016 jeffcarpenter1939@gmal.com!

More information

DNA for Genealogy Librarians. Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District

DNA for Genealogy Librarians. Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District DNA for Genealogy Librarians Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District What does DNA do? It replicates itself. It codes for the production

More information

DNA Basics. OLLI: Genealogy 101 October 1, ~ Monique E. Rivera ~

DNA Basics. OLLI: Genealogy 101 October 1, ~ Monique E. Rivera ~ DNA Basics OLLI: Genealogy 101 October 1, 2018 ~ Monique E. Rivera ~ WHAT IS DNA? DNA (deoxyribonucleic acid) is found in every living cell everywhere. It is a long chemical chain that tells our cells

More information

[CLIENT] SmithDNA1701 DE January 2017

[CLIENT] SmithDNA1701 DE January 2017 [CLIENT] SmithDNA1701 DE1704205 11 January 2017 DNA Discovery Plan GOAL Create a research plan to determine how the client s DNA results relate to his family tree as currently constructed. The client s

More information

DNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016

DNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016 DNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016 1 What we will cover How testing helps genealogy What is DNA? How do you select from the three testing companies?

More information

Primer on Human Pedigree Analysis:

Primer on Human Pedigree Analysis: Primer on Human Pedigree Analysis: Criteria for the selection and collection of appropriate Family Reference Samples John V. Planz. Ph.D. UNT Center for Human Identification Successful Missing Person ID

More information

Report on the VAN_TUYL Surname Project Y-STR Results 3/11/2013 Rory Van Tuyl

Report on the VAN_TUYL Surname Project Y-STR Results 3/11/2013 Rory Van Tuyl Report on the VAN_TUYL Surname Project Y-STR Results 3/11/2013 Rory Van Tuyl Abstract: Recent data for two descendants of Ott van Tuyl has been added to the project, bringing the total number of Gameren

More information

The Structure of DNA Let s take a closer look at how this looks under a microscope.

The Structure of DNA Let s take a closer look at how this looks under a microscope. DNA Basics Adapted from a MyHeritage Blog and the International Society of Genetic Genealogy (ISOGG) Wiki by Earl Cory MyHeritage has started a series to explain DNA, how it works and answer the most common

More information

Genetic Genealogy Journey DNA Projects by Debbie Parker Wayne, CG SM, CGL SM

Genetic Genealogy Journey DNA Projects by Debbie Parker Wayne, CG SM, CGL SM Genetic Genealogy Journey DNA Projects by Debbie Parker Wayne, CG SM, CGL SM Genealogy can be a solitary pursuit. Genealogists sometimes collaborate to work on common lines, but lone researchers can perform

More information

Developing Conclusions About Different Modes of Inheritance

Developing Conclusions About Different Modes of Inheritance Pedigree Analysis Introduction A pedigree is a diagram of family relationships that uses symbols to represent people and lines to represent genetic relationships. These diagrams make it easier to visualize

More information

Family Tree DNA Genetic Genealogy Started Here

Family Tree DNA Genetic Genealogy Started Here Family Tree DNA Genetic Genealogy Started Here With 253,000 samples in our DNA database (the largest of its kind in the world) your genealogical search could become even easier Why Bennett Greenspan founded

More information

An Introduction. Your DNA. and Your Family Tree. (Mitochondrial DNA) Presentation by: 4/8/17 Page 1 of 10

An Introduction. Your DNA. and Your Family Tree. (Mitochondrial DNA) Presentation by: 4/8/17 Page 1 of 10 An Introduction Your DNA and Your Family Tree (Mitochondrial DNA) Presentation by: FredCoffey@aol.com 4/8/17 Page 1 of 10 Coffey Surname, y-dna Project We're now ready to move on and look at the type of

More information

Walter Steets Houston Genealogical Forum DNA Interest Group February 24, 2018

Walter Steets Houston Genealogical Forum DNA Interest Group February 24, 2018 Using Ancestry DNA and Third-Party Tools to Research Your Shared DNA Segments Part 2 Walter Steets Houston Genealogical Forum DNA Interest Group February 24, 2018 1 Today s agenda Brief review of previous

More information

Lecture 1: Introduction to pedigree analysis

Lecture 1: Introduction to pedigree analysis Lecture 1: Introduction to pedigree analysis Magnus Dehli Vigeland NORBIS course, 8 th 12 th of January 2018, Oslo Outline Part I: Brief introductions Pedigrees symbols and terminology Some common relationships

More information

Meek/Meeks Families of Virginia Meek Group F Introduction

Meek/Meeks Families of Virginia Meek Group F Introduction Meek Group F Introduction The Meek/Meeks DNA Project 1 has established Y-DNA signatures 2 for a significant number of early American ancestors based on tests of living descendants. This allows for a determination

More information

GEDmatch Home Page The upper left corner of your home page has Information about you and links to lots of helpful information. Check them out!

GEDmatch Home Page The upper left corner of your home page has Information about you and links to lots of helpful information. Check them out! USING GEDMATCH Created March 2015 GEDmatch is a free, non-profit site that accepts raw autosomal data files from Ancestry, FTDNA, and 23andme. As such, it provides a large autosomal database that spans

More information

CAGGNI s DNA Special Interest Group

CAGGNI s DNA Special Interest Group CAGGNI s DNA Special Interest Group 10 Jan 2015 Al & Michelle Wilson Agenda Survey Basics in Fan Charts Recombination Exercise Triangulation Overview Survey 1. Have you taken (or sponsored) a DNA test?

More information

DNA and Ancestry. An Update on New Tests. Steve Louis. Jewish Genealogical Society of Washington State. January 13, 2014

DNA and Ancestry. An Update on New Tests. Steve Louis. Jewish Genealogical Society of Washington State. January 13, 2014 DNA and Ancestry An Update on New Tests Steve Louis Jewish Genealogical Society of Washington State January 13, 2014 DISCLAIMER This document was prepared as a result of independent work and opinions of

More information

Ewing Surname Y-DNA Project Article 8

Ewing Surname Y-DNA Project Article 8 Ewing Surname Y-DNA Project Article 8 This is the eighth in a series of articles about the Ewing Surname Y-DNA Project. The previous seven articles have appeared in the last seven issues of the Journal

More information

Yoder Doors Opened by DNA Studies

Yoder Doors Opened by DNA Studies Yoder Doors Opened by DNA Studies A Special Report to the 2012 North Carolina Yoder Reunion By Chris Yoder Yoder Newsletter Oct. 2012 www.yodernewsletter.org Established 1983 BACKGROUND How DNA Testing

More information

Algorithms for Genetics: Basics of Wright Fisher Model and Coalescent Theory

Algorithms for Genetics: Basics of Wright Fisher Model and Coalescent Theory Algorithms for Genetics: Basics of Wright Fisher Model and Coalescent Theory Vineet Bafna Harish Nagarajan and Nitin Udpa 1 Disclaimer Please note that a lot of the text and figures here are copied from

More information

DNA TESTING. This is the testing regime for FamilyTreeDNA. Other SNP tests were ordered from Yseq.

DNA TESTING. This is the testing regime for FamilyTreeDNA. Other SNP tests were ordered from Yseq. DNA & GENEALOGY DNA TESTING This is the testing regime for FamilyTreeDNA. Other SNP tests were ordered from Yseq. Product Date Batch Family Finder 30-May-14 Completed 569 05-Aug-14 Batched 569 05-Jul-14

More information

An O-F3288 Y DNA Discovery for Patrilineal Descendants of James Revell (Accomack) By Marie A. Rundquist, DNA Project Administrator November 2018

An O-F3288 Y DNA Discovery for Patrilineal Descendants of James Revell (Accomack) By Marie A. Rundquist, DNA Project Administrator November 2018 Project Scope Rundquist O-F3288 White Paper 11/2018 An O-F3288 Y DNA Discovery for Patrilineal Descendants of James Revell (Accomack) By Marie A. Rundquist, DNA Project Administrator November 2018 The

More information

FREQUENTLY ASKED QUESTIONS ABOUT THE OWSTON/OUSTON DNA PROJECT

FREQUENTLY ASKED QUESTIONS ABOUT THE OWSTON/OUSTON DNA PROJECT FREQUENTLY ASKED QUESTIONS ABOUT THE OWSTON/OUSTON DNA PROJECT 1. What has been discovered thus far and what may be discovered with testing? The Owston/Ouston DNA project grew out of the combined genealogical

More information

Using a Y-DNA Surname Project to Dig Deeper Into Your Genealogy: A Case Study

Using a Y-DNA Surname Project to Dig Deeper Into Your Genealogy: A Case Study Using a Y-DNA Surname Project to Dig Deeper Into Your Genealogy: A Case Study Allan H. Westreich, Ph.D. Address for correspondence: Allan H. Westreich, Ph.D., 250 Route 28, Suite 206, Bridgewater, NJ 08807,

More information

Walter Steets Houston Genealogical Forum DNA Interest Group April 7, 2018

Walter Steets Houston Genealogical Forum DNA Interest Group April 7, 2018 Ancestry DNA and GEDmatch Walter Steets Houston Genealogical Forum DNA Interest Group April 7, 2018 Today s agenda Recent News about DNA Testing DNA Cautions: DNA Data Used for Forensic Purposes New Technology:

More information

DNA Haplogroups Report

DNA Haplogroups Report DNA Haplogroups Report for Matthew Mayberry Generated and printed on Sep 25 2011, 01:59 pm X This is a mtdna Haplogroup Report This is a mtdna Subclade Report Search criteria used in this report: HVR-1

More information

Eller DNA Project. Status Report for Nashville EFA Conference----July 25, Tom Eller, DNA Project Administrator

Eller DNA Project. Status Report for Nashville EFA Conference----July 25, Tom Eller, DNA Project Administrator Eller DNA Project Status Report for Nashville EFA Conference----July 25, 2009 Tom Eller, DNA Project Administrator Eller DNA Project This presentation used material from Family Tree DNA and from World

More information

Advanced Autosomal DNA Techniques used in Genetic Genealogy

Advanced Autosomal DNA Techniques used in Genetic Genealogy Advanced Autosomal DNA Techniques used in Genetic Genealogy Tim Janzen, MD E-mail: tjanzen@comcast.net Summary of Chromosome Mapping Technique The following are specific instructions on how to map your

More information

Walter Steets Houston Genealogical Forum DNA Interest Group January 27, 2018

Walter Steets Houston Genealogical Forum DNA Interest Group January 27, 2018 Using Ancestry DNA and Third-Party Tools to Research Your Shared DNA Segments Walter Steets Houston Genealogical Forum DNA Interest Group January 27, 2018 1 Today s agenda Brief review of previous DIG

More information

The Jewish Genealogical Society of Great Britain

The Jewish Genealogical Society of Great Britain Edition No. 1-04/2007 (currently under revision) Reformatted and reissued 01/2010 Written by Jill L. Whitehead, M.A. Issued for JGSGB by JGSGB Education & Mentoring JGSGB 33 Seymour Place London W1H 5AP

More information

IN THIS ISSUE: February From the Administrator Questions/News...1. George Varner of Missouri Direct Line...2

IN THIS ISSUE: February From the Administrator Questions/News...1. George Varner of Missouri Direct Line...2 IN THIS ISSUE: From the Administrator..... 1 Questions/News.......1 George Varner of Missouri Direct Line...2 Do the Newtons & Varners Really Both have Riggs DNA?...2 2016 Newton/Varner Reunion. 5 February

More information

Big Y-700 White Paper

Big Y-700 White Paper Big Y-700 White Paper Powering discovery in the field of paternal ancestry Authors: Caleb Davis, Michael Sager, Göran Runfeldt, Elliott Greenspan, Arjan Bormans, Bennett Greenspan, and Connie Bormans Last

More information

Contributed by "Kathy Hallett"

Contributed by Kathy Hallett National Geographic: The Genographic Project Name Background The National Geographic Society is undertaking the ambitious process of tracking human migration using genetic technology. By using the latest

More information

The Two Phases of the Coalescent and Fixation Processes

The Two Phases of the Coalescent and Fixation Processes The Two Phases of the Coalescent and Fixation Processes Introduction The coalescent process which traces back the current population to a common ancestor and the fixation process which follows an individual

More information

A Day Out With Your DNA

A Day Out With Your DNA A Day Out With Your DNA Diahan Southard www.yourdnaguide.com Your testing company has evaluated around 800,000 locations on your DNA to help them determine your origins and your genetic cousins. While

More information

Ernie Ebayley s Adventure in DNA-Land. A Resource for Beginning Your Own Adventure into Genealogical Genetics

Ernie Ebayley s Adventure in DNA-Land. A Resource for Beginning Your Own Adventure into Genealogical Genetics Ernie Ebayley s Adventure in DNA-Land A Resource for Beginning Your Own Adventure into Genealogical Genetics 2006 C.E. Smith Museum of Anthropology College of Arts, Letters, and Social Sciences (CLASS)

More information

Visual Phasing of Chromosome 1

Visual Phasing of Chromosome 1 Visual Phasing of Chromosome 1 If you have the possibility to test three full siblings, then the next great thing you could do with your DNA, is to try out the Visual Phasing technique developed by Kathy

More information

Princess Margaret Cancer Centre Familial Breast and Ovarian Cancer Clinic. Family History Questionnaire

Princess Margaret Cancer Centre Familial Breast and Ovarian Cancer Clinic. Family History Questionnaire Princess Margaret Cancer Centre Familial Breast and Ovarian Cancer Clinic Family History Questionnaire How to complete this questionnaire The information in this questionnaire will be used to determine

More information

Origins: Coffey/Keogh Families By Fred Coffey. ONLINE:

Origins: Coffey/Keogh Families By Fred Coffey. ONLINE: Origins: Coffey/Keogh Families By Fred Coffey ONLINE: http://www.coffey.ws/familytree/dna/origins-coffeykeoghfamilies.pdf My name is Coffey, and I m very interested in working out the origins of my family.

More information

First Results: Intro to FamilyTreeDNA s Family Finder. Learn what to do with results of autosomal DNA testing with FamilyTreeDNA (FTDNA).

First Results: Intro to FamilyTreeDNA s Family Finder. Learn what to do with results of autosomal DNA testing with FamilyTreeDNA (FTDNA). First Results: Family Tree DNA When You First Get Your FamilyTreeDNA (FTDNA) Results Objective: Learn what to do with results of autosomal DNA testing with FamilyTreeDNA (FTDNA). Tools: familytreedna.com

More information

Growing the Family Tree: The Power of DNA in Reconstructing Family Relationships

Growing the Family Tree: The Power of DNA in Reconstructing Family Relationships Growing the Family Tree: The Power of DNA in Reconstructing Family Relationships Luke A. D. Hutchison Natalie M. Myres Scott R. Woodward Sorenson Molecular Genealogy Foundation (www.smgf.org) 2511 South

More information

WINSLOW HERITAGE SOCIETY ~~~~~~~~~~~~~~~~~~

WINSLOW HERITAGE SOCIETY ~~~~~~~~~~~~~~~~~~ Newsletter, Vol. 2, No. 1 March, 2015 WINSLOW HERITAGE SOCIETY ~~~~~~~~~~~~~~~~~~ In Vol. 1, No. 1 of the Winslow Heritage Society Newsletter, Kathy Myers, Society Governor, a descendant of Kenelm Winslow,

More information

Genetic Genealogy. Rules and Tools. Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter

Genetic Genealogy. Rules and Tools. Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter Genetic Genealogy Rules and Tools Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter I am NOT this guy! 2 Genealogy s Newest Tool Genealogy research: Study of Family History Identifies

More information

Large scale kinship:familial Searching and DVI. Seoul, ISFG workshop

Large scale kinship:familial Searching and DVI. Seoul, ISFG workshop Large scale kinship:familial Searching and DVI Seoul, ISFG workshop 29 August 2017 Large scale kinship Familial Searching: search for a relative of an unidentified offender whose profile is available in

More information

Genetic Identity and

Genetic Identity and Genetic Identity and GACATGTAGCTCTTCACTTCACCCAGGTTGGGTTGTGTCAACAGGAAACATTGTAACATATCACTTGGATTAGCACCTAGG/TTAT/TTAT/TTA Community DTC Genetic Testing Workshop The National Academies' August 31 September 1,

More information

Putting the genes into genealogy

Putting the genes into genealogy Putting the genes into genealogy DNA testing can help find lost branches of your family tree. Susan C Meates describes how DNA surname projects work DNA testing for genealogy has been available since 2000,

More information

Introduction to Autosomal DNA Tools

Introduction to Autosomal DNA Tools GENETIC GENEALOGY JOURNEY Debbie Parker Wayne, CG, CGL Introduction to Autosomal DNA Tools Just as in the old joke about a new genealogist walking into the library and asking for the book that covers my

More information

Welcome to this issue of Facts & Genes, the only publication devoted to Genetic Genealogy.

Welcome to this issue of Facts & Genes, the only publication devoted to Genetic Genealogy. Facts & Genes from Family Tree DNA ================================== March 3, 2004 Volume 3, Issue 2 In This Issue ============= Editor's Corner In the News: Family Tree DNA Announcements Haplogroups:

More information

An Introduction to Genetic Genealogy

An Introduction to Genetic Genealogy An Introduction to Genetic Genealogy David A. Pike dapike@math.mun.ca Presented To: Family History Society of Newfoundland and Labrador 24 January 2006 Slide 1 of 21 Overview Genetic Genealogy using genetic

More information

ICMP DNA REPORTS GUIDE

ICMP DNA REPORTS GUIDE ICMP DNA REPORTS GUIDE Distribution: General Sarajevo, 16 th December 2010 GUIDE TO ICMP DNA REPORTS 1. Purpose of This Document 1. The International Commission on Missing Persons (ICMP) endeavors to secure

More information

Coalescence. Outline History. History, Model, and Application. Coalescence. The Model. Application

Coalescence. Outline History. History, Model, and Application. Coalescence. The Model. Application Coalescence History, Model, and Application Outline History Origins of theory/approach Trace the incorporation of other s ideas Coalescence Definition and descriptions The Model Assumptions and Uses Application

More information

have to get on the phone or family members for the names of more distant relatives.

have to get on the phone or  family members for the names of more distant relatives. Ideas for Teachers: Give each student the family tree worksheet to fill out at home. Explain to them that each family is different and this worksheet is meant to help them plan their family tree. They

More information

DNA Solu)ons for Brick Walls And Adop)on

DNA Solu)ons for Brick Walls And Adop)on DNA Solu)ons for Brick Walls And Adop)on "I have not failed. I've just found ten thousand ways that won't work." Thomas Edison Wise Woman Gene+c Genealogy Comments Listen Carefully! 1. DNA is not the be

More information

Chart 2 Group A, 37-Marker Level Entire R1b-M222 Group Generations to Include MRCA at 99% Probability

Chart 2 Group A, 37-Marker Level Entire R1b-M222 Group Generations to Include MRCA at 99% Probability Chart 2 Group A, 37-Marker Level Entire R1b-M222 Group Generations to Include MRCA at 99% Probability 18 Irish R1b-M222 Section Overview The members of this group demonstrate a wide web of linkage over

More information

Finding a Male Hodge(s) Descendant for Y-Chromosome DNA Testing. Prepared by Jan Alpert

Finding a Male Hodge(s) Descendant for Y-Chromosome DNA Testing. Prepared by Jan Alpert Finding a Male Hodge(s) Descendant for Y-Chromosome DNA Testing Prepared by Jan Alpert Why Test Male Y-Chromosome DNA All males carry the Y-Chromosome of their fathers As a result the same DNA markers

More information

Genetic Genealogy Journey Why Is My Cousin Not on my DNA Match List? Debbie Parker Wayne, CG SM, CGL SM

Genetic Genealogy Journey Why Is My Cousin Not on my DNA Match List? Debbie Parker Wayne, CG SM, CGL SM Genetic Genealogy Journey Why Is My Cousin Not on my DNA Match List? Debbie Parker Wayne, CG SM, CGL SM The CSI television shows have conditioned us to expect exact DNA matches and lead us to think DNA

More information

Your Family 101 Beginning Genealogical Research

Your Family 101 Beginning Genealogical Research Your Family 101 Beginning Genealogical Research What Will We Cover Today? Session 1: Getting Started Session 2: Your Resources Session 3: Common Mistakes and Pitfalls Session 4: DNA Testing and Medical

More information

Use of DNA information in family research information for IOWFHS members

Use of DNA information in family research information for IOWFHS members Use of DNA information in family research information for IOWFHS members What is DNA? Since the discovery of deoxyribonucleic acid (DNA) in the 1950s, we have come to understand more about its role as

More information

Understanding DNA in Genealogy. Peter Biggins, BY3164 Darien Library, Darien, CT November 18, 2017

Understanding DNA in Genealogy. Peter Biggins, BY3164 Darien Library, Darien, CT November 18, 2017 Understanding DNA in Genealogy Peter Biggins, BY3164 Darien Library, Darien, CT November 18, 2017 1953: Watson 25, Crick 37, Franklin 33 My BY3164 SNP 1953 paper published on the structure of DNA 1962

More information

Genetic Genealogy. Using DNA to research your maternal & paternal lines. Ed McGuire. Vermont Genealogy Library 2/24/14

Genetic Genealogy. Using DNA to research your maternal & paternal lines. Ed McGuire. Vermont Genealogy Library 2/24/14 Genetic Genealogy Using DNA to research your maternal & paternal lines Ed McGuire 2/24/14 Introduction Soprano Family Tree 2 2/24/14 Introduction 3 2/24/14 Introduction 4 2/24/14 Introduction Contradictory

More information

Chapter 2: Genes in Pedigrees

Chapter 2: Genes in Pedigrees Chapter 2: Genes in Pedigrees Chapter 2-0 2.1 Pedigree definitions and terminology 2-1 2.2 Gene identity by descent (ibd) 2-5 2.3 ibd of more than 2 genes 2-14 2.4 Data on relatives 2-21 2.1.1 GRAPHICAL

More information

BOUSE GENIES NEWSLETTER

BOUSE GENIES NEWSLETTER BOUSE GENIES NEWSLETTER Volume 10, Number 2 Spring 2016 GENETIC GENEALOGY [From the Spring 2016 SKP Genies Newsletter] Today there is so much more to doing genealogy research than studying the roots, branches

More information

Understanding Third Party DNA Analysis Tools. Copyright 2014 James R. Lannin, Jr. aka Jimmy Chromosomes

Understanding Third Party DNA Analysis Tools. Copyright 2014 James R. Lannin, Jr. aka Jimmy Chromosomes Understanding Third Party DNA Analysis Tools Copyright 2014 James R. Lannin, Jr. aka Jimmy Chromosomes A Review of the Basics You have 46 chromosomes and they come to you in 23 pairs from your mother and

More information

HEREDITARY CANCER FAMILY HISTORY QUESTIONNAIRE

HEREDITARY CANCER FAMILY HISTORY QUESTIONNAIRE Packet received: Appointment: HEREDITARY CANCER FAMILY HISTORY QUESTIONNAIRE Please complete this questionnaire. While this can take some time, a review of your family history will allow us to provide

More information

New Advances Reconstructing the Y Chromosome Haplotype of Napoléon the First Based on Three of his Living Descendants

New Advances Reconstructing the Y Chromosome Haplotype of Napoléon the First Based on Three of his Living Descendants Journal of Molecular Biology Research; Vol. 5, No. 1; 20 ISSN 125-430X E-ISSN 125-4318 Published by Canadian Center of Science and Education New Advances Reconstructing the Y Chromosome Haplotype of Napoléon

More information

Thesis/Dissertation Collections. Panneerselvam, Madhumalar, "Pedigree tool" (2007). Thesis. Rochester Institute of Technology.

Thesis/Dissertation Collections. Panneerselvam, Madhumalar, Pedigree tool (2007). Thesis. Rochester Institute of Technology. Rochester Institute of Technology RIT Scholar Works Theses Thesis/Dissertation Collections 5-24-2007 Pedigree tool Madhumalar Panneerselvam Follow this and additional works at: http://scholarworks.rit.edu/theses

More information

Chromosome X haplotyping in deficiency paternity testing principles and case report

Chromosome X haplotyping in deficiency paternity testing principles and case report International Congress Series 1239 (2003) 815 820 Chromosome X haplotyping in deficiency paternity testing principles and case report R. Szibor a, *, I. Plate a, J. Edelmann b, S. Hering c, E. Kuhlisch

More information

Subgroup A2: Reilly-McGovern Cluster

Subgroup A2: Reilly-McGovern Cluster Subgroup A2: Reilly-McGovern Cluster Charts 15 & 16 below shows the names and origins for the members of this cluster, except for the Faughnans, who are placed with the A2 Various Lineages for economy

More information

Ancestral Recombination Graphs

Ancestral Recombination Graphs Ancestral Recombination Graphs Ancestral relationships among a sample of recombining sequences usually cannot be accurately described by just a single genealogy. Linked sites will have similar, but not

More information

Using Birth, Marriage and Death Certificates from the General Register Office (GRO) for England and Wales

Using Birth, Marriage and Death Certificates from the General Register Office (GRO) for England and Wales Using Birth, Marriage and Death Certificates from the General Register Office (GRO) for England and Wales Civil registration of births, marriages and deaths began in July 1837. At that time, England &

More information

Find JCD Project Date: Identification-DNA Process Updated:

Find JCD Project Date: Identification-DNA Process Updated: New Look Investigations Created by: Jack Friess Find JCD Project Date: 04-20-2018 Identification-DNA Process Updated: 05-24-2018 Questions and Answers Identification-DNA (ID-DNA) is a scientific process

More information