DNA Haplogroups Report

Size: px
Start display at page:

Download "DNA Haplogroups Report"

Transcription

1 DNA Haplogroups Report for Matthew Mayberry Generated and printed on Sep , 01:59 pm X This is a mtdna Haplogroup Report This is a mtdna Subclade Report Search criteria used in this report: HVR-1 markers This report contains the following sections: Section 1. Distribution Section 2. Description Section 3. mtdna Phylogenetic Tree Section 4. Further Studies Powered by Genebase Systems. 1 of 10 9/25/11 5:02 PM

2 DNA Haplogroups Report generated by Genebase Systems and printed on Sep , 01:59 pm mtdna Haplogroup of Matthew Mayberry Based on the SNP marker pattern found in Matthew Mayberry's HVR-1 markers, Matthew Mayberry's mtdna Haplogroup can be predicted. The top five mtdna haplogroup predictions are as follows: (1) B, (2) H, (3) HV, (4) R0, (5) R. Section 1: Distribution of Matthew Mayberry's Haplogroup Timeline of mtdna Haplogroup B Matthew Mayberry's predicted maternal haplogroup, B, arose from 10 key detectable genetic events over the past 150,000 years. This timeline illustrates how Haplogroup B arose and shows the genetic changes that occurred over time, resulting in its present day form. You can confirm Matthew Mayberry's membership in haplogroup B through Backbone SNP testing to see if Matthew Mayberry is positive for the defining SNPs for haplogroup B. L(origin) (4312 (??)) L1-6 L2-6 L2,3,4,6 L3,4,6 (3594 (??)) L3,L4 L3 (10873 (??)) N (12705 (??)) R (11719 (??)) R11,B B Migration Map of mtdna Haplogroup B The location where each of the key genetic markers is found in the world can be plotted on a map to reconstruct the ancient migration patterns of Matthew Mayberry's ancestors. This migration map indicates the migration pattern of Matthew's maternal ancestors based on Matthew's predicted mtdna haplogroup. * Please note that this is Matthew's predicted haplogroup based on mtdna markers. Matthew's mtdna haplogroup can be confirmed through mtdna SNP Backbone Testing which will confirm the presence or absence of Haplogroup specific SNP markers in Matthew's mtdna. Order the mtdna SNP Backbone Test to confirm Matthew's mtdna haplogroup. How is Matthew's mtdna Haplogroup predicted? Map data 2011 Geocentre Consulting, MapLink, Tele Atlas - Matthew's mtdna results are compared to people in the database who have already confirmed their mtdna Haplogroup through SNP testing. The prediction strength indicates how closely Matthew's mtdna profile (haplotype) matches the profiles of people with confirmed mtdna Haplogroups. The higher the prediction strength, the more closely Matthew's haplotype matches the haplotype of other individuals with a known Haplogroup. Please note that STR markers can only be used to generate a mtdna Haplogroup prediction. Matthew's mtdna Haplogroup can be confirmed through mtdna SNP Backbone testing. 2 of 10 9/25/11 5:02 PM

3 About the Haplogroup Migration Map Researchers are able to plot the migration path of our ancient maternal ancestors by examining the pattern of mtdna SNP markers found in "indigenous" populations from around the world. By determining the location where key mtdna SNP markers first arose and the approximate time that each mtdna SNP marker arose, researchers have been able to successfully plot the ancient migration patterns of man based on the pattern of SNPs found in their mtdna. SNP markers are often referred to as "time and date stamps" because each marker can be traced back to a particular time and place in history. By testing the SNP markers in Matthew's mtdna, you can determine Matthew's unique pattern of SNP markers. Matthew's mtdna SNP markers allow you to confirm Matthew's mtdna Haplogroup and view the migration patterns of Matthew's own maternal ancestors. Understanding the Haplogroup Migration Map The mtdna Haplogroup migration map shows the place of origin of Matthew's maternal ancestors and the arrows in the map indicate the subsequent migration patterns of ensuing generations based on the unique pattern of SNPs found in Matthew's mtdna. Click here to download a copy of the mtdna phylogenetic tree which shows in detail how each SNP marker in the mtdna is associated with various haplogroups. Get More Information To refine or confirm the mtdna haplogroup of Matthew Mayberry, you may consider ordering the mtdna HVR-2 Upgrade Test and mtdna Backbone SNP Test. Click here to find out more about the mtdna Full Sequencing Test. Recommended Reading The more you understand about the role of mtdna in maternal ancestry, the more you will get out of your genetic genealogy experience. For those who are interested in understanding the science behind the technology, we recommend reading our lesson series entitled "The role of mtdna in Ancestry" for helpful core background information. Click here to explore the phylogenetic tree of human mtdna and see how Matthew Mayberry's predicted mtdna haplogroup is connected to other major haplogroups. Click here to read more about Matthew Mayberry's predicted mtdna haplogroup. 3 of 10 9/25/11 5:02 PM

4 Section 2: Description of Matthew Mayberry's Haplogroup Haplogroup B Time: Emerged approx 60,000 years ago Place: Originated in Asia Facts: The woman who founded Haplogroup B lived approximately 50,000 years ago in Asia. Descendents of the Haplogroup B migrated throughout Asia and into the Americas approximately 20,000 years ago. Haplogroup B is one of five haplogroups found in indigenous peoples of the Americas (others are A, C, D, and X). Native American Ancestry Today, descendents of Haplogroup B can be found throughout Asia, including China, Korea and Japan and Southeast Asia. It is also found in a significant proportion of Native Americans. Unlike other haplogroups that were migrated into the New World, haplogroup B is the only one that is not found in today's North Siberian populations. Facts The woman who founded the Haplogroup B line is the direct female descendent of a woman belonging to the Haplogroup R line. Haplogroup R is Near/Middle Eastern and Caucasus in origin. 4 of 10 9/25/11 5:02 PM

5 Section 3: Matthew Mayberry's Placement in the mtdna Phylogenetic Tree Location of mtdna Haplogroup B in Phylogenetic Tree DNA studies have shown that all people living today descended from common ancestors who lived in Africa over 100,000 years ago. This genetic association can be plotted into a worldwide "family tree of mankind" called a "phylogenetic" tree. The phylogenetic tree below is based on the Human mtdna and shows how all human maternal lineages (mtdna haplogroups) are connected to each other. Scroll down the tree to see where Matthew Mayberry's predicted mtdna haplogroup, B, is located. SNP marker tested by Genebase = 1048, 4312, 6185, 11914, L0 3516A, 5442, 9042, 9347, 10589, 10664, 10915, 12720, 13276, L0a,b,f,k 189, 4586, 9818, , 6815, 8113A, 8152, 8251, 12121, 15466, 15930, 15941, L , 2758, 2885, 7146, 8468 L1 3666, 7055, 7389, 13789, 14178, L1b 185T, 357, 709, 1738, 2352, 3308, 3693, 5036, 5046, 5655, 6548, 6827, 6989, 7867, 8248, 12519, 13880A, 14203, 14769, 15115, 16264, L1b L1c 151, 186A, 189C, 316, 2395d, 5951, 6071, 8027, 9072, 10586, 12810, 13485, 14000A, 14911, 16294, L , 247, d, 825A, 8655, 10688, 10810, 13105, 16129, 16187, L2,3,4,6 4104, 7521 L2 146, 150, 152, 2416, 8206, 9221, 10115, L2a-d 195, L2e 479, 719, 1211, 3537, 4562, 5069T, 6014, 8383, 9377, 9971, 11935, 12189, 13708, 14299, 15697, 15734, 15889, 16111A, 16145, 16184, 16239, 16292, 16355, 16399, L3,4,6 182, 3594, 7256, 13650, L3,L4 769, 1018, L3 8701, 9540, 10398, 10873, L3a 152, d, 12816, L3b-d,j d, L3b 3450, 5773, 6221, 9449, 10086, 13914A, 15311, 15824, 15944d, 16124, 16278, L3b L3b2 3420, 16183C, L3c,d,j 152 L3c 195, 498.1C, 678, 3582, 4491, 5393, 7394, 9337, 9682, 12373, 14221, 14371, 14560, 14587, 16111, L3d 5147, 7424, 8618, 13886, 14284, L3d L3j 5821, 6182, 6722, 8676, 9365, 9731A, 12280, 12534, 14260, 15314, 15479, L3e,i,k,x 150, L3e 2352, L3e1 189, 200, 6221, 6587, 14152, 15670, 15942, L3e2 195, 14905, L3e3-5 L3i 7645 L3k 235, 494, 3918, 6620G, 9467, 13135, 13992, L3x 3483, C, 6401, 8311, 8817, 13708, L3f 3396, 4218, 15514, 15944d, L3h 7861, 9575 M 489, 10400, 14783, D 4883, 5178A, D4 3010, 8414, D5, of 10 9/25/11 5:02 PM

6 M1 195, 6446, 6680, 12403, 12905C, 14110, 16129, 16189, 16249, M2 447G, 1780, 8502, 11083, 15670, 16274, M3 482, M4" M5 1888, M6 461, 3537, 5082, 5301, 5558, 9329, 10640, 13966, 14128, 16231, M7 6455, 9824 M8 4715, 7196A, 8584, 15487T, CZ 249d C 3552A, 9545, 11914, 13263, 14318, C d, C A, 6026, 11969, C C, C6 1888, C7 5821, 6338, 7853 Z 152, 6752, 9090, 15784, 16185, Z1 151, 10325, 15261, 16129, Z2 3145, 8188, 14668, Z Z4 5492, 15475, 15944d, 16189, M8a 6179, 8684, 14470, M9 4491, E 3027, 3705, 7598, 13626, E1 4248, 10834, 13254, E2 195, 8440, 9080, 15178, M9a-d 153, 3394 M10, M11 146, 215, 318, 326, 1095, 6531, 7642, 8108, 9950, 11969, M12,G G 709, 4833, 5108, G1 8200, 15323, G2 5601, G G A, 194, 4541, 5051, 5460, 6216, 7521, 7660, 9670, 11383, 15940, 16114A M , 5580, 12030, 12372, 14727, 15010, 16172, 16234, M13 152, 3644, 5773, 6023, 6253, 6620, 10411, 10790, 15924, 16145, M14 234, 4216, 6962 M21 709, M22, M , 9201, M28 152, 195, 1719, 6281, 6374, 10245, 15067, 16148, 16362, M29,Q 13500, M31, A M M34 569, 3010, 6794, 11101, 15865, M M36 239, 7271, M T, 65.1T, 66T, 1811, 8679, M , 15721, 15954, M41 375, 870, 6297, 12398, 12469, 13656, 15601, 16327, M44 146, 930, 961, CC, 8179, C, of 10 9/25/11 5:02 PM

7 M46 146, 152, 1393, 3588, 4394, 6032, 6253, 7828, 8886, 9115, 10130, 11008, 11151, 13434, 16256, 16278, 16300, 16343T, M47, C M48 199, 6366, 15900, 16225, 16234, M , 11263, 12346, 14384, 15511, 15647, 16153, N 12705, A 152, 235, 663, 1736, 4248, 4824, 8794, 16290, A3 2857, 8962, 9711 A A5 8563, A7 146, 8413, 10172, 15379, 16051, 16129, A8 64 N1, N , N1a,c,d,e,I 204, N1a,d,e,I 199 N1c 73, 75, 189, 195, 207, 210, 8222, 11025, 11437, 13637, 16201, N1b 152, 1598, 1703, 2639, 3921A, 4960, 5471, 8251, 8472, 8836, 12822, 16145, 16176G, N5 5063, 7076, 9545, 11626, 13434, 16111, N2 709, 189, 5046, 11674, N2a 152, 199, 739, 1633, 7581, 10841, 11722, 12192, 15106, 16153, W 195, 204, 207, 1243, 3505, 5460, 8251, 8994, 11947, 15884C, W W3 1406, 13263, W4 143, 192, 194, 196 W5 6528, N N9a 150, 5231, 12358, 12372, 16257A, N9b 5147, 10607, 11016, 13183, 14893, Y 8392, 10398, 14178, 14693, Y1 3834, Y2 482, 5147, 6941, 7859, 14914, 15244, R 73, P P1 212, 6077, 10118, 16176, 16266, , 3882, 4122, 8859, P3 127, 128, CCC, 3645, 14338, 15748, 15937T P4 1719, 5460, P6 6719, 16311, R HV 2706, 7028 H 1438 H* H H H2a 750 H2a1 951, H2a2 263, 8860, H2a2a CRS H2a2b H2a , H2a of 10 9/25/11 5:02 PM

8 H2a , 16291, 1842, 4592 (16291 is variable in subclade H2a5.) H2b 152, 8598, H H4 3992, 5004, 9123 H5, H6, H H9 152, 3591, 4310, 13020, H A H11, H H , 10217, H15 55, 57, 6253 H H , 6296 H H H , 16328A H H , H H H , 16093, H30 195, 8638, HV0 72, HV0a HV0b,c 195 HV1 8014T, 15218, HV2 7193, 9336, HV HV HV , R0a 64, 2442, 3847, 13188, 16126, R1 295A, 1391, 3360, 4917, 5586, 5823, 6557, 6671, 7547, 8388, 8887, 10658, 10825, 13948, 14632, 15721, R2,JT 4216 JT 11251, 15452A, J 295, 489, 10398, 12612, 13708, J1 462, 3010 J2 150, 152, 7476, T 709, 1888, 4917, 8697, 10463, 13368, 14905, 15607, 15928, T A, 16163, T , 14233, (16296 is variable in subclade T2.) T R2 152, 7657, 8473, 9932, 10685, 12654, 13500, 14305, R5 8594, 10754, 14544, 16304, R6, R8 2755, 3384, 7759, 9449, R9,21, R9 3970, 13928C F 249d, 6392, F1 6962, 10609, 12406, of 10 9/25/11 5:02 PM

9 F2 1005, 1824, 7828, 10535, 10586, 12338, F3 3434, 5585, 5913, 5978, 10320, 11065, F4 5263, 12630, R9b 1541, 12714, 16309, R , 12234, 12361, 12510, 16168, R , R11,B B «Matthew Mayberry (predicted haplogroup) d B B5 709, 8584, 9950, 10398, B6 150, 5894C, 9452, 11914, 12950, 13928C, 14305, 16093, R11 185, 189, 709, 8277, 10031, 10398, 11061, 12950, 13681, R , 16290, R R U 11467, 12308, U1 285, 12879, 13104, 14070, 15148, 15954C, U2,3,4,7,8, U U3 150, 14139, 15454, U4,9 499, 5999 U7 152, 980, 5360, 10142, 16318T U U8a 282, 6392, 6455, 7055, 9365, U8b,K 9055, K 16224, 3480, 10550, 11299, 14798, K1 1189, K2 146, 9716 U8b 12771, 6546, 6599, 16189, U5 3197, 9477, 13617, U6 3348, S 8404 X 153, 6221, 6371, 13966, 14470, 16189, X1 146 X2 195, 1719 L L6 146, 152, 185C, 709, 770, 961, 1461, 4964, 5267, 6002, 6284, 9332, 10978, 11116, 11743, 12771, 13710, 14791, 14959, 15244, 15289, 15499, 16048, L C, 3423, 7972, 12432, 12950, 16148, Reference: van Oven M, Kayser M Updated comprehensive phylogenetic tree of global human mitochondrial DNA variation. Hum Mutat 30(2):E386- E394.doi: /humu Our mtdna, which is passed down from a mother to her children shows that all people living today shared a common female ancestor who lived in Africa over 100,000 years ago. She is often termed the "Mitochondrial Eve". The mtdna phylogenetic tree has approximately 26 main branches "mtdna haplogroups" classified by the letters "A to Z". Each mtdna haplogroup has many further sub-branches (subclades), classified by numbers and letters, i.e. L1a1, L1a2, L1b, etc. All people living today have descended from one of the main branches of the human mtdna phylogenetic tree. Find Matthew's haplogroup on the tree and see how Matthew is connected to all people living today on Matthew's maternal line. 9 of 10 9/25/11 5:02 PM

10 Section 4: Further Studies for Matthew Mayberry's Haplogroup Genebase Systems. All Rights Reserved. 10 of 10 9/25/11 5:02 PM

Mitochondrial DNA (mtdna) JGSGO June 5, 2018

Mitochondrial DNA (mtdna) JGSGO June 5, 2018 Mitochondrial DNA (mtdna) JGSGO June 5, 2018 MtDNA - outline What is it? What do you do with it? How do you maximize its value? 2 3 mtdna a double-stranded, circular DNA that is stored in mitochondria

More information

Your mtdna Full Sequence Results

Your mtdna Full Sequence Results Congratulations! You are one of the first to have your entire mitochondrial DNA (DNA) sequenced! Testing the full sequence has already become the standard practice used by researchers studying the DNA,

More information

Halley Family. Mystery? Mystery? Can you solve a. Can you help solve a

Halley Family. Mystery? Mystery? Can you solve a. Can you help solve a Can you solve a Can you help solve a Halley Halley Family Family Mystery? Mystery? Who was the great grandfather of John Bennett Halley? He lived in Maryland around 1797 and might have been born there.

More information

TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter

TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter 1-1: DNA: WHERE DO I START? Definition Genetic genealogy is the application of genetics to traditional genealogy. Genetic genealogy uses genealogical

More information

Welcome to this issue of Facts & Genes, the only publication devoted to Genetic Genealogy.

Welcome to this issue of Facts & Genes, the only publication devoted to Genetic Genealogy. Facts & Genes from Family Tree DNA ================================== March 3, 2004 Volume 3, Issue 2 In This Issue ============= Editor's Corner In the News: Family Tree DNA Announcements Haplogroups:

More information

DNA Testing What you need to know first

DNA Testing What you need to know first DNA Testing What you need to know first This article is like the Cliff Notes version of several genetic genealogy classes. It is a basic general primer. The general areas include Project support DNA test

More information

Using Mitochondrial DNA (mtdna) for Genealogy Debbie Parker Wayne, CG, CGL SM

Using Mitochondrial DNA (mtdna) for Genealogy Debbie Parker Wayne, CG, CGL SM Using Mitochondrial DNA (mtdna) for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical

More information

Autosomal-DNA. How does the nature of Jewish genealogy make autosomal DNA research more challenging?

Autosomal-DNA. How does the nature of Jewish genealogy make autosomal DNA research more challenging? Autosomal-DNA How does the nature of Jewish genealogy make autosomal DNA research more challenging? Using Family Finder results for genealogy is more challenging for individuals of Jewish ancestry because

More information

DNA and Ancestry. An Update on New Tests. Steve Louis. Jewish Genealogical Society of Washington State. January 13, 2014

DNA and Ancestry. An Update on New Tests. Steve Louis. Jewish Genealogical Society of Washington State. January 13, 2014 DNA and Ancestry An Update on New Tests Steve Louis Jewish Genealogical Society of Washington State January 13, 2014 DISCLAIMER This document was prepared as a result of independent work and opinions of

More information

Genetic Genealogy Journey DNA Projects by Debbie Parker Wayne, CG SM, CGL SM

Genetic Genealogy Journey DNA Projects by Debbie Parker Wayne, CG SM, CGL SM Genetic Genealogy Journey DNA Projects by Debbie Parker Wayne, CG SM, CGL SM Genealogy can be a solitary pursuit. Genealogists sometimes collaborate to work on common lines, but lone researchers can perform

More information

DNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016

DNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016 DNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016 1 What we will cover How testing helps genealogy What is DNA? How do you select from the three testing companies?

More information

What Can I Learn From DNA Testing?

What Can I Learn From DNA Testing? What Can I Learn From DNA Testing? From where did my ancestors migrate? What is my DNA Signature? Was my ancestor a Jewish Cohanim Priest? Was my great great grandmother really an Indian Princes? I was

More information

Meek DNA Project Group B Ancestral Signature

Meek DNA Project Group B Ancestral Signature Meek DNA Project Group B Ancestral Signature The purpose of this paper is to explore the method and logic used by the author in establishing the Y-DNA ancestral signature for The Meek DNA Project Group

More information

DNA Opening Doors for Today s s Genealogist

DNA Opening Doors for Today s s Genealogist DNA Opening Doors for Today s s Genealogist Presented to JGSI Sunday, March 30, 2008 Presented by Alvin Holtzman Genetic Genealogy Discussion Points What is DNA How can it help genealogists What to expect

More information

THE BASICS OF DNA TESTING. By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library

THE BASICS OF DNA TESTING. By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library THE BASICS OF DNA TESTING By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library TYPES OF TESTS Mitochondrial DNA (mtdna/mdna) Y-DNA Autosomal DNA (atdna/audna) MITOCHONDRIAL DNA Found

More information

DNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding

DNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding DNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding by Dr. Ing. Robert L. Baber 2014 July 26 Rights reserved, see the copyright notice at http://gengen.rlbaber.de

More information

An O-F3288 Y DNA Discovery for Patrilineal Descendants of James Revell (Accomack) By Marie A. Rundquist, DNA Project Administrator November 2018

An O-F3288 Y DNA Discovery for Patrilineal Descendants of James Revell (Accomack) By Marie A. Rundquist, DNA Project Administrator November 2018 Project Scope Rundquist O-F3288 White Paper 11/2018 An O-F3288 Y DNA Discovery for Patrilineal Descendants of James Revell (Accomack) By Marie A. Rundquist, DNA Project Administrator November 2018 The

More information

Every human cell (except red blood cells and sperm and eggs) has an. identical set of 23 pairs of chromosomes which carry all the hereditary

Every human cell (except red blood cells and sperm and eggs) has an. identical set of 23 pairs of chromosomes which carry all the hereditary Introduction to Genetic Genealogy Every human cell (except red blood cells and sperm and eggs) has an identical set of 23 pairs of chromosomes which carry all the hereditary information that is passed

More information

DNA Basics. OLLI: Genealogy 101 October 1, ~ Monique E. Rivera ~

DNA Basics. OLLI: Genealogy 101 October 1, ~ Monique E. Rivera ~ DNA Basics OLLI: Genealogy 101 October 1, 2018 ~ Monique E. Rivera ~ WHAT IS DNA? DNA (deoxyribonucleic acid) is found in every living cell everywhere. It is a long chemical chain that tells our cells

More information

Y-DNA Genetic Testing

Y-DNA Genetic Testing Y-DNA Genetic Testing 50 2/24/14 Y-DNA Genetic Testing Y-DNA flows from fathers to sons intact SNPs define Y-DNA haplogroups Haplogroups (clans) migrated together Timeframe between mutations is 2,000 to

More information

An Introduction. Your DNA. and Your Family Tree. (Mitochondrial DNA) Presentation by: 4/8/17 Page 1 of 10

An Introduction. Your DNA. and Your Family Tree. (Mitochondrial DNA) Presentation by: 4/8/17 Page 1 of 10 An Introduction Your DNA and Your Family Tree (Mitochondrial DNA) Presentation by: FredCoffey@aol.com 4/8/17 Page 1 of 10 Coffey Surname, y-dna Project We're now ready to move on and look at the type of

More information

Using Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM

Using Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM Using Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.

More information

Recent Results from the Jackson Brigade DNA Project

Recent Results from the Jackson Brigade DNA Project Recent Results from the Jackson Brigade DNA Project Dr. Daniel C. Hyde Professor Emeritus of Computer Science Bucknell University Lewisburg, PA Presented at Jackson Brigade Reunion, Horner, WV on August

More information

[CLIENT] SmithDNA1701 DE January 2017

[CLIENT] SmithDNA1701 DE January 2017 [CLIENT] SmithDNA1701 DE1704205 11 January 2017 DNA Discovery Plan GOAL Create a research plan to determine how the client s DNA results relate to his family tree as currently constructed. The client s

More information

Ernie Ebayley s Adventure in DNA-Land. A Resource for Beginning Your Own Adventure into Genealogical Genetics

Ernie Ebayley s Adventure in DNA-Land. A Resource for Beginning Your Own Adventure into Genealogical Genetics Ernie Ebayley s Adventure in DNA-Land A Resource for Beginning Your Own Adventure into Genealogical Genetics 2006 C.E. Smith Museum of Anthropology College of Arts, Letters, and Social Sciences (CLASS)

More information

Coalescence time distributions for hypothesis testing -Kapil Rajaraman 498BIN, HW# 2

Coalescence time distributions for hypothesis testing -Kapil Rajaraman 498BIN, HW# 2 Coalescence time distributions for hypothesis testing -Kapil Rajaraman (rajaramn@uiuc.edu) 498BIN, HW# 2 This essay will be an overview of Maryellen Ruvolo s work on studying modern human origins using

More information

Contributed by "Kathy Hallett"

Contributed by Kathy Hallett National Geographic: The Genographic Project Name Background The National Geographic Society is undertaking the ambitious process of tracking human migration using genetic technology. By using the latest

More information

Kenneth Nordtvedt. Many genetic genealogists eventually employ a time-tomost-recent-common-ancestor

Kenneth Nordtvedt. Many genetic genealogists eventually employ a time-tomost-recent-common-ancestor Kenneth Nordtvedt Many genetic genealogists eventually employ a time-tomost-recent-common-ancestor (TMRCA) tool to estimate how far back in time the common ancestor existed for two Y-STR haplotypes obtained

More information

Genetic Identity and

Genetic Identity and Genetic Identity and GACATGTAGCTCTTCACTTCACCCAGGTTGGGTTGTGTCAACAGGAAACATTGTAACATATCACTTGGATTAGCACCTAGG/TTAT/TTAT/TTA Community DTC Genetic Testing Workshop The National Academies' August 31 September 1,

More information

An Introduction to Genetic Genealogy

An Introduction to Genetic Genealogy An Introduction to Genetic Genealogy David A. Pike dapike@math.mun.ca Presented To: Family History Society of Newfoundland and Labrador 24 January 2006 Slide 1 of 21 Overview Genetic Genealogy using genetic

More information

DNA TESTING. This is the testing regime for FamilyTreeDNA. Other SNP tests were ordered from Yseq.

DNA TESTING. This is the testing regime for FamilyTreeDNA. Other SNP tests were ordered from Yseq. DNA & GENEALOGY DNA TESTING This is the testing regime for FamilyTreeDNA. Other SNP tests were ordered from Yseq. Product Date Batch Family Finder 30-May-14 Completed 569 05-Aug-14 Batched 569 05-Jul-14

More information

Pizza and Who do you think you are?

Pizza and Who do you think you are? Pizza and Who do you think you are? an overview of one of the newest and possibly more helpful developments in researching genealogy and family history that of using DNA for research What is DNA? Part

More information

Subgroup A2: Reilly-McGovern Cluster

Subgroup A2: Reilly-McGovern Cluster Subgroup A2: Reilly-McGovern Cluster Charts 15 & 16 below shows the names and origins for the members of this cluster, except for the Faughnans, who are placed with the A2 Various Lineages for economy

More information

The Jewish Genealogical Society of Great Britain

The Jewish Genealogical Society of Great Britain Edition No. 1-04/2007 (currently under revision) Reformatted and reissued 01/2010 Written by Jill L. Whitehead, M.A. Issued for JGSGB by JGSGB Education & Mentoring JGSGB 33 Seymour Place London W1H 5AP

More information

Steve Harding, *Turi King and *Mark Jobling Universities of Nottingham & *Leicester, UK

Steve Harding, *Turi King and *Mark Jobling Universities of Nottingham & *Leicester, UK Viking DNA Steve Harding, *Turi King and *Mark Jobling Universities of Nottingham & *Leicester, UK Viking DNA in Northern England Project Part 1 - Wirral and West Lancashire (2002-2007) Part 2 - North

More information

! FTDNA! Ancestry. ! 23andMe. ! Medical Considera,ons. ! Iden,fying family medical history. ! Communica,ng with the medical community

! FTDNA! Ancestry. ! 23andMe. ! Medical Considera,ons. ! Iden,fying family medical history. ! Communica,ng with the medical community by JEFF CARPENTER! Brief Defini,ons about YDNA, XDNA, mtdna, atdna (Covered in Part 1)! Benefits of Tes,ng DNA! Examples of DNA TESTING! FTDNA! Ancestry! 3andMe Jeff Carpenter, 016 jeffcarpenter1939@gmal.com!

More information

Autosomal DNA. What is autosomal DNA? X-DNA

Autosomal DNA. What is autosomal DNA? X-DNA ANGIE BUSH AND PAUL WOODBURY info@thednadetectives.com November 1, 2014 Autosomal DNA What is autosomal DNA? Autosomal DNA consists of all nuclear DNA except for the X and Y sex chromosomes. There are

More information

The Meek Family of Allegheny Co., PA Meek Group A Introduction

The Meek Family of Allegheny Co., PA Meek Group A Introduction Meek Group A Introduction In the 1770's a significant number of families named Meek(s) lived in S. W. Pennsylvania and they can be identified in the records of Westmoreland, Allegheny and Washington Counties.

More information

The African Origin Hypothesis What do the data tell us?

The African Origin Hypothesis What do the data tell us? The African Origin Hypothesis What do the data tell us? Mitochondrial DNA and Human Evolution Cann, Stoneking and Wilson, Nature 1987. WOS - 1079 citations Mitochondrial DNA and Human Evolution Cann, Stoneking

More information

A STUDY OF ANDREAS KILIAN S ANCESTRIAL Y-DNA

A STUDY OF ANDREAS KILIAN S ANCESTRIAL Y-DNA 1 A STUDY OF ANDREAS KILIAN S ANCESTRIAL Y-DNA Be Silent Were the Bible Is Silent For someone who believes the Bible is the inspired Word of God, how can I believe in DNA and the dates given in this paper?

More information

Genetic Genealogy. Using DNA to research your maternal & paternal lines. Ed McGuire. Vermont Genealogy Library 2/24/14

Genetic Genealogy. Using DNA to research your maternal & paternal lines. Ed McGuire. Vermont Genealogy Library 2/24/14 Genetic Genealogy Using DNA to research your maternal & paternal lines Ed McGuire 2/24/14 Introduction Soprano Family Tree 2 2/24/14 Introduction 3 2/24/14 Introduction 4 2/24/14 Introduction Contradictory

More information

Report on the VAN_TUYL Surname Project Y-STR Results 3/11/2013 Rory Van Tuyl

Report on the VAN_TUYL Surname Project Y-STR Results 3/11/2013 Rory Van Tuyl Report on the VAN_TUYL Surname Project Y-STR Results 3/11/2013 Rory Van Tuyl Abstract: Recent data for two descendants of Ott van Tuyl has been added to the project, bringing the total number of Gameren

More information

DNA study deals blow to theory of European origins

DNA study deals blow to theory of European origins 23 August 2011 Last updated at 23:15 GMT DNA study deals blow to theory of European origins By Paul Rincon Science editor, BBC News website Did Palaeolithic hunters leave a genetic legacy in today's European

More information

Eller DNA Project. Status Report for Nashville EFA Conference----July 25, Tom Eller, DNA Project Administrator

Eller DNA Project. Status Report for Nashville EFA Conference----July 25, Tom Eller, DNA Project Administrator Eller DNA Project Status Report for Nashville EFA Conference----July 25, 2009 Tom Eller, DNA Project Administrator Eller DNA Project This presentation used material from Family Tree DNA and from World

More information

Understanding your Results

Understanding your Results Paternal Ancestry Report: Sample Understanding your Results What Does this Genetic Test Accomplish? This genetic ancestry test works by analyzing specific regions of your Y chromosome. These regions, termed

More information

DNA Testing. February 16, 2018

DNA Testing. February 16, 2018 DNA Testing February 16, 2018 What Is DNA? Double helix ladder structure where the rungs are molecules called nucleotides or bases. DNA contains only four of these nucleotides A, G, C, T The sequence that

More information

Chart 2 Group A, 37-Marker Level Entire R1b-M222 Group Generations to Include MRCA at 99% Probability

Chart 2 Group A, 37-Marker Level Entire R1b-M222 Group Generations to Include MRCA at 99% Probability Chart 2 Group A, 37-Marker Level Entire R1b-M222 Group Generations to Include MRCA at 99% Probability 18 Irish R1b-M222 Section Overview The members of this group demonstrate a wide web of linkage over

More information

MEET YOUR VOLUNTEER PRATER PROJECT ADMINISTRATORS

MEET YOUR VOLUNTEER PRATER PROJECT ADMINISTRATORS Prater* Project NEWSLETTER i Vol I, No 1 Click on graphic above to view the latest Prater Project Results Tables using the drop-down menus MEET YOUR VOLUNTEER PRATER PROJECT ADMINISTRATORS Laverne Piatt

More information

Identification of the Hypothesized African Ancestry of the Wife of Pvt. Henry Windecker Using Genomic Testing of the Autosomes.

Identification of the Hypothesized African Ancestry of the Wife of Pvt. Henry Windecker Using Genomic Testing of the Autosomes. Identification of the Hypothesized African Ancestry of the Wife of Pvt. Henry Windecker Using Genomic Testing of the Autosomes Introduction African Ancestry: The hypothesis, based on considerable circumstantial

More information

Y-Chromosome Haplotype Origins via Biogeographical Multilateration

Y-Chromosome Haplotype Origins via Biogeographical Multilateration Y-Chromosome Haplotype Origins via Biogeographical Multilateration Michael R. Maglio Abstract Current Y-chromosome migration maps only cover the broadest-brush strokes of the highest-level haplogroups.

More information

Genealogical trees, coalescent theory, and the analysis of genetic polymorphisms

Genealogical trees, coalescent theory, and the analysis of genetic polymorphisms Genealogical trees, coalescent theory, and the analysis of genetic polymorphisms Magnus Nordborg University of Southern California The importance of history Genetic polymorphism data represent the outcome

More information

Big Y-700 White Paper

Big Y-700 White Paper Big Y-700 White Paper Powering discovery in the field of paternal ancestry Authors: Caleb Davis, Michael Sager, Göran Runfeldt, Elliott Greenspan, Arjan Bormans, Bennett Greenspan, and Connie Bormans Last

More information

Genetic Genealogy. Rules and Tools. Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter

Genetic Genealogy. Rules and Tools. Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter Genetic Genealogy Rules and Tools Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter I am NOT this guy! 2 Genealogy s Newest Tool Genealogy research: Study of Family History Identifies

More information

The Meek Family of Allegheny Co., PA Meek Group A Introduction

The Meek Family of Allegheny Co., PA Meek Group A Introduction Meek Group A Introduction In the 1770's a significant number of families named Meek(s) lived in S. W. Pennsylvania and they can be identified in the records of Westmoreland, Allegheny and Washington Counties.

More information

Ewing Surname Y-DNA Project Article 8

Ewing Surname Y-DNA Project Article 8 Ewing Surname Y-DNA Project Article 8 This is the eighth in a series of articles about the Ewing Surname Y-DNA Project. The previous seven articles have appeared in the last seven issues of the Journal

More information

DNA CHARLOTTE COUNTY GENEALOGICAL SOCIETY - MARCH 30, 2013 WALL STREET JOURNAL ARTICLE

DNA CHARLOTTE COUNTY GENEALOGICAL SOCIETY - MARCH 30, 2013 WALL STREET JOURNAL ARTICLE DNA CHARLOTTE COUNTY GENEALOGICAL SOCIETY - MARCH 30, 2013 WALL STREET JOURNAL ARTICLE NATIONAL GEOGRAPHIC GENOGRAPHIC PROJECT ABOUT NEWS RESULTS BUY THE KIT RESOURCES Geno 2.0 - Genographic Project

More information

The Structure of DNA Let s take a closer look at how this looks under a microscope.

The Structure of DNA Let s take a closer look at how this looks under a microscope. DNA Basics Adapted from a MyHeritage Blog and the International Society of Genetic Genealogy (ISOGG) Wiki by Earl Cory MyHeritage has started a series to explain DNA, how it works and answer the most common

More information

DOWNLOAD OR READ : THE ANCESTRY OF EDGAR RICE BURROUGHS PDF EBOOK EPUB MOBI

DOWNLOAD OR READ : THE ANCESTRY OF EDGAR RICE BURROUGHS PDF EBOOK EPUB MOBI DOWNLOAD OR READ : THE ANCESTRY OF EDGAR RICE BURROUGHS PDF EBOOK EPUB MOBI Page 1 Page 2 the ancestry of edgar rice burroughs the ancestry of edgar pdf the ancestry of edgar rice burroughs J Forensic

More information

Coalescents. Joe Felsenstein. GENOME 453, Winter Coalescents p.1/39

Coalescents. Joe Felsenstein. GENOME 453, Winter Coalescents p.1/39 Coalescents Joe Felsenstein GENOME 453, Winter 2007 Coalescents p.1/39 Cann, Stoneking, and Wilson Becky Cann Mark Stoneking the late Allan Wilson Cann, R. L., M. Stoneking, and A. C. Wilson. 1987. Mitochondrial

More information

BIOL Evolution. Lecture 8

BIOL Evolution. Lecture 8 BIOL 432 - Evolution Lecture 8 Expected Genotype Frequencies in the Absence of Evolution are Determined by the Hardy-Weinberg Equation. Assumptions: 1) No mutation 2) Random mating 3) Infinite population

More information

company does improve its ethnicity estimates, your profile will automatically be updated, too. You won't have to retake the test to get the new

company does improve its ethnicity estimates, your profile will automatically be updated, too. You won't have to retake the test to get the new Ancestry dna kit The Y-DNA test is more limited than the ones from Family Tree DNA Does not offer a less expensive 'autosomal DNA-only' test Can't connect with other matches Can't upload raw data from

More information

From Sticky Mucus to Probing our Past: Aspects and problems of the Biotechnological use of Macromolecules

From Sticky Mucus to Probing our Past: Aspects and problems of the Biotechnological use of Macromolecules From Sticky Mucus to Probing our Past: Aspects and problems of the Biotechnological use of Macromolecules DNA natures most important glycoconjugate DNA natures most important glycoconjugate High molecular

More information

Family Tree DNA Genetic Genealogy Started Here

Family Tree DNA Genetic Genealogy Started Here Family Tree DNA Genetic Genealogy Started Here With 253,000 samples in our DNA database (the largest of its kind in the world) your genealogical search could become even easier Why Bennett Greenspan founded

More information

IN THIS ISSUE: February From the Administrator Questions/News...1. George Varner of Missouri Direct Line...2

IN THIS ISSUE: February From the Administrator Questions/News...1. George Varner of Missouri Direct Line...2 IN THIS ISSUE: From the Administrator..... 1 Questions/News.......1 George Varner of Missouri Direct Line...2 Do the Newtons & Varners Really Both have Riggs DNA?...2 2016 Newton/Varner Reunion. 5 February

More information

Primer on Human Pedigree Analysis:

Primer on Human Pedigree Analysis: Primer on Human Pedigree Analysis: Criteria for the selection and collection of appropriate Family Reference Samples John V. Planz. Ph.D. UNT Center for Human Identification Successful Missing Person ID

More information

Coalescents. Joe Felsenstein. GENOME 453, Autumn Coalescents p.1/48

Coalescents. Joe Felsenstein. GENOME 453, Autumn Coalescents p.1/48 Coalescents p.1/48 Coalescents Joe Felsenstein GENOME 453, Autumn 2015 Coalescents p.2/48 Cann, Stoneking, and Wilson Becky Cann Mark Stoneking the late Allan Wilson Cann, R. L., M. Stoneking, and A. C.

More information

Using Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM

Using Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM Using Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.

More information

Your web browser (Safari 7) is out of date. For more security, comfort and the best experience on this site: Update your browser Ignore

Your web browser (Safari 7) is out of date. For more security, comfort and the best experience on this site: Update your browser Ignore Your web browser (Safari 7) is out of date. For more security, comfort and the best experience on this site: Update your browser Ignore Activitydevelop U SING GENETIC MARKERS TO CREATE L INEAGES How do

More information

CAGGNI s DNA Special Interest Group

CAGGNI s DNA Special Interest Group CAGGNI s DNA Special Interest Group 10 Jan 2015 Al & Michelle Wilson Agenda Survey Basics in Fan Charts Recombination Exercise Triangulation Overview Survey 1. Have you taken (or sponsored) a DNA test?

More information

CLAN DONNACHAIDH DNA NEWS No 1

CLAN DONNACHAIDH DNA NEWS No 1 CLAN DONNACHAIDH DNA NEWS No Introduction Greetings to everyone who has taken part. This is the first of an occasional publication, which will be published when there is something to say or time to write

More information

William E. Howard III

William E. Howard III William E. Howard III Part 1 of this two-part series of articles presented a new correlation method for analyzing Y-STR haplotypes (Howard, 2009). The method reduces pairs of haplotypes to a single number

More information

Walter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018

Walter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018 DNA, Ancestry, and Your Genealogical Research- Segments and centimorgans Walter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018 1 Today s agenda Brief review of previous DIG session

More information

The genealogical history of a population The coalescent process. Identity by descent Distribution of pairwise coalescence times

The genealogical history of a population The coalescent process. Identity by descent Distribution of pairwise coalescence times The coalescent The genealogical history of a population The coalescent process Identity by descent Distribution of pairwise coalescence times Adding mutations Expected pairwise differences Evolutionary

More information

GEDmatch Home Page The upper left corner of your home page has Information about you and links to lots of helpful information. Check them out!

GEDmatch Home Page The upper left corner of your home page has Information about you and links to lots of helpful information. Check them out! USING GEDMATCH Created March 2015 GEDmatch is a free, non-profit site that accepts raw autosomal data files from Ancestry, FTDNA, and 23andme. As such, it provides a large autosomal database that spans

More information

Learn what to do with results of autosomal DNA testing from AncestryDNA.

Learn what to do with results of autosomal DNA testing from AncestryDNA. When You First Get Your AncestryDNA Results Objective: Learn what to do with results of autosomal DNA testing from AncestryDNA. Tools: AncestryDNA results; ancestry.com, genesis.gedmatch.com and familytreedna.com

More information

No Journal of North Minzu University Gen.No.143

No Journal of North Minzu University Gen.No.143 2018 5 No.5 2018 143 Journal of North Minzu University Gen.No.143 1 2 1 1. 200438 2. 100088 Y-SNP Y-STR C912.4 A 1674-6627 2018 05-0110-08 2018-05-24 31671297 91731303 2016YFC0900300 1 2 3 4 5 6 7 8 9

More information

Genesis and Genetics Matthew Price

Genesis and Genetics Matthew Price Genesis and Genetics Matthew Price Apologetics and Creation Camp 16 June 2018 Karakariki Christian Camp, Waikato, NZ 1 What is Science? 2 What is Science? Hypothesis Theory Start with a hypothesis; a reasonable

More information

Through the Lens of Genetics, Genographic Project and University of Pennsylvania Scientists Illuminate the Ancient History of Circumarctic Peoples

Through the Lens of Genetics, Genographic Project and University of Pennsylvania Scientists Illuminate the Ancient History of Circumarctic Peoples CONTACT: Glynnis Breen Colby Bishop (202) 857-7481 (202) 828-8075 gbreen@ngs.org cbishop@ngs.org Through the Lens of Genetics, Genographic Project and University of Pennsylvania Scientists Illuminate the

More information

Origins: Coffey/Keogh Families By Fred Coffey. ONLINE:

Origins: Coffey/Keogh Families By Fred Coffey. ONLINE: Origins: Coffey/Keogh Families By Fred Coffey ONLINE: http://www.coffey.ws/familytree/dna/origins-coffeykeoghfamilies.pdf My name is Coffey, and I m very interested in working out the origins of my family.

More information

Using X-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM

Using X-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM Using X-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.

More information

Before India: Exploring Your Ancestry With DNA By David G. Mahal

Before India: Exploring Your Ancestry With DNA By David G. Mahal Before India: Exploring Your Ancestry With DNA By David G. Mahal You then receive an email notifying you that your results are ready to explore on utilize your DNA results for family history by Ancestry.com

More information

Growing the Family Tree: The Power of DNA in Reconstructing Family Relationships

Growing the Family Tree: The Power of DNA in Reconstructing Family Relationships Growing the Family Tree: The Power of DNA in Reconstructing Family Relationships Luke A. D. Hutchison Natalie M. Myres Scott R. Woodward Sorenson Molecular Genealogy Foundation (www.smgf.org) 2511 South

More information

Lutz Roewer, Sascha Willuweit Dept. Forensic Genetics, Institute of Legal Medicine and Forensic Sciences Charité Universitätsmedizin Berlin, Germany

Lutz Roewer, Sascha Willuweit Dept. Forensic Genetics, Institute of Legal Medicine and Forensic Sciences Charité Universitätsmedizin Berlin, Germany The new YHRD Lutz Roewer, Sascha Willuweit Dept. Forensic Genetics, Institute of Legal Medicine and Forensic Sciences Charité Universitätsmedizin Berlin, Germany 2000 2004 2008 2014 Aug 99 Jun 00 Jan 03

More information

First Results: Intro to FamilyTreeDNA s Family Finder. Learn what to do with results of autosomal DNA testing with FamilyTreeDNA (FTDNA).

First Results: Intro to FamilyTreeDNA s Family Finder. Learn what to do with results of autosomal DNA testing with FamilyTreeDNA (FTDNA). First Results: Family Tree DNA When You First Get Your FamilyTreeDNA (FTDNA) Results Objective: Learn what to do with results of autosomal DNA testing with FamilyTreeDNA (FTDNA). Tools: familytreedna.com

More information

BETTER TOGETHER: MAKING YOUR CASE WITH DOCUMENTS AND DNA BCG-sponsored Webinar (https://bcgcertification.org) Patricia Lee Hobbs, CG

BETTER TOGETHER: MAKING YOUR CASE WITH DOCUMENTS AND DNA BCG-sponsored Webinar (https://bcgcertification.org) Patricia Lee Hobbs, CG BETTER TOGETHER: MAKING YOUR CASE WITH DOCUMENTS AND DNA BCG-sponsored Webinar (https://bcgcertification.org) Patricia Lee Hobbs, CG LIMITATIONS & BENEFITS OF DNA TESTING DNA test results do not solve

More information

New Advances Reconstructing the Y Chromosome Haplotype of Napoléon the First Based on Three of his Living Descendants

New Advances Reconstructing the Y Chromosome Haplotype of Napoléon the First Based on Three of his Living Descendants Journal of Molecular Biology Research; Vol. 5, No. 1; 20 ISSN 125-430X E-ISSN 125-4318 Published by Canadian Center of Science and Education New Advances Reconstructing the Y Chromosome Haplotype of Napoléon

More information

Meek/Meeks Families of Virginia Meek Group F Introduction

Meek/Meeks Families of Virginia Meek Group F Introduction Meek Group F Introduction The Meek/Meeks DNA Project 1 has established Y-DNA signatures 2 for a significant number of early American ancestors based on tests of living descendants. This allows for a determination

More information

Creating a Private and Unsearchable Ancestry Family Tree

Creating a Private and Unsearchable Ancestry Family Tree Creating a Private and Unsearchable Ancestry Family Tree Creating a tree on Ancestry is a step you can take whilst waiting for your DNA results to be processed. You do not have to have a subscription to

More information

Case Study Pinpointing the Grace English Paternal Ancestral Genetic Homeland

Case Study Pinpointing the Grace English Paternal Ancestral Genetic Homeland Case Study Pinpointing the Grace English Paternal Ancestral Genetic Homeland Dr Tyrone Bowes 12 th June 2017 INTRODUCTION A simple painless commercial ancestral Y chromosome DNA test will potentially provide

More information

Comparative method, coalescents, and the future

Comparative method, coalescents, and the future Comparative method, coalescents, and the future Joe Felsenstein Depts. of Genome Sciences and of Biology, University of Washington Comparative method, coalescents, and the future p.1/36 Correlation of

More information

Table of Contents. Introduction DNA Basics DNA Origins: How it works Concepts of Race BioGeographical Ancestry...

Table of Contents. Introduction DNA Basics DNA Origins: How it works Concepts of Race BioGeographical Ancestry... Table of Contents Introduction... 1 In This Manual Your Results Package DNA Basics... 2 Terms You Will Encounter in this Manual Types of DNA Used in Ancestry Testing DNA Origins: How it works... 4 Concepts

More information

WINSLOW HERITAGE SOCIETY ~~~~~~~~~~~~~~~~~~

WINSLOW HERITAGE SOCIETY ~~~~~~~~~~~~~~~~~~ Newsletter, Vol. 2, No. 1 March, 2015 WINSLOW HERITAGE SOCIETY ~~~~~~~~~~~~~~~~~~ In Vol. 1, No. 1 of the Winslow Heritage Society Newsletter, Kathy Myers, Society Governor, a descendant of Kenelm Winslow,

More information

Bioinformatics I, WS 14/15, D. Huson, December 15,

Bioinformatics I, WS 14/15, D. Huson, December 15, Bioinformatics I, WS 4/5, D. Huson, December 5, 204 07 7 Introduction to Population Genetics This chapter is closely based on a tutorial given by Stephan Schiffels (currently Sanger Institute) at the Australian

More information

Your Family 101 Beginning Genealogical Research

Your Family 101 Beginning Genealogical Research Your Family 101 Beginning Genealogical Research What Will We Cover Today? Session 1: Getting Started Session 2: Your Resources Session 3: Common Mistakes and Pitfalls Session 4: DNA Testing and Medical

More information

Supplementary information for Pierson et al (2006) Deciphering Past Human Population Movements in Oceania: Provably Optimal Trees of 127 mtdna Genomes

Supplementary information for Pierson et al (2006) Deciphering Past Human Population Movements in Oceania: Provably Optimal Trees of 127 mtdna Genomes Supplementary information for Pierson et al (2006) Deciphering Past Human Population Movements in Oceania: Provably Optimal Trees of 127 mtdna Genomes Supplementary Table 1: Pacific dataset details Haplogroup

More information

A Day Out With Your DNA

A Day Out With Your DNA A Day Out With Your DNA Diahan Southard www.yourdnaguide.com Your testing company has evaluated around 800,000 locations on your DNA to help them determine your origins and your genetic cousins. While

More information

Walter Steets Houston Genealogical Forum DNA Interest Group April 7, 2018

Walter Steets Houston Genealogical Forum DNA Interest Group April 7, 2018 Ancestry DNA and GEDmatch Walter Steets Houston Genealogical Forum DNA Interest Group April 7, 2018 Today s agenda Recent News about DNA Testing DNA Cautions: DNA Data Used for Forensic Purposes New Technology:

More information

Tools: 23andMe.com website and test results; DNAAdoption handouts.

Tools: 23andMe.com website and test results; DNAAdoption handouts. When You First Get Your 23andMe Results Objective: Learn what to do with results of atdna testing with 23andMe. Tools: 23andMe.com website and test results; DNAAdoption handouts. Exercises: Practice Exercises

More information

Ancestral Origins of Baltic N-Z ver /

Ancestral Origins of Baltic N-Z ver / Copyright G. Dunkel Ancestral Origins of Baltic N-Z16981+ ver. 1.3. /4.10.2016 This small-scale study provides a new perspective to look at N-Z16981+ Balts SNP results. First of all, it must be noted,

More information

Use of DNA information in family research information for IOWFHS members

Use of DNA information in family research information for IOWFHS members Use of DNA information in family research information for IOWFHS members What is DNA? Since the discovery of deoxyribonucleic acid (DNA) in the 1950s, we have come to understand more about its role as

More information