Pizza and Who do you think you are?
|
|
- Sherman Weaver
- 5 years ago
- Views:
Transcription
1 Pizza and Who do you think you are? an overview of one of the newest and possibly more helpful developments in researching genealogy and family history that of using DNA for research
2 What is DNA? Part 1 It is DeoxyriboNucleic Acid, a self-replicating material present in nearly all living organisms as the main constituent of chromosomes. It is the carrier of genetic information.
3 What is DNA? Part 2 A genealogical DNA test looks at a person's genome (A genome is an organism's complete set of DNA, including all of its genes at specific locations). Results give information about genealogy or personal ancestry. In general, these tests compare the results of an individual to others from the same lineage or to current and historic ethnic groups.
4 So, I can spit in a tube and get my whole family history, right? If you have a patron who comes up and says this, here s what you should explain. No, you can t. Here s where you can find out more. Here are the main companies that do the testing.
5 What companies can do this? Ancestry.com, Family Tree DNA, and 23 and Me ---problem is, they do not talk to one another, and public free databases like GEDMATCH are not used. Do you go with the company with the largest database or the best testing?
6 Useful Terminology BASIC DNA TERMS Allele / Gene Bases A Adenine T Thymine C Cytosine G - Guanine Chromosomes DNA Genome Locus/marker GENETIC TERMS Haplogroup Haplotype MRCA Phylo-tree SNP STR Sub-clade Used with permission from Shannon Combs-Bennett (c) 2014
7
8 Last boring picture of DNA
9 What are some common mistakes? Believing that DNA will fill in your family tree. I don t have an ancestor s DNA. They are dead. I don t like needles! I am female. How do I test for male DNA? The DNA will reveal medical problems.
10 What is Autosomal DNA It is the DNA you inherit through autosomal chromosomes, not through the sex determining chromosomes. An autosome is any of the numbered chromosomes, as opposed to the sex chromosomes. Autosomal DNA tests can be used to confirm relationships with a high level of accuracy for parent/child relationships and all relationships up to the second cousin level.
11 What is Y-DNA Tersely, it is the chromosome that determines maleness, and is passed from father to son.
12 Results For Men
13 Y-DNA Results Y-DNA results can be used to verify the male lineage Since men do not get a Y chromosome from their mothers, a paternal line can be traced
14 What is mtdna mtdna is passed from a mother to all of her children mt = Mitochondira
15 mt Dna has only women
16 Results For Women
17 Tersely put
18
19 From Blaine Bettinger -
20 Talk about diminishing returns
21 Wait What Just Happened? Parents Children Grandchildren Great grandchildren Image from ricochetscience.com
22 Example Result: FTDNA Chromosome Comparison
23 This is mine from FT DNA
24 This is a sample from FT DNA Orange = Mom Blue = Mom's brother
25 Example Results: FTDNA Reconstructed Sapiens Reference System Shannon Combs-Bennett (c) 2014
26 Example Results: FTDNA
27 My own results
28 From my own AncestryDNA
29 A sample tree from my DNA match cousin.
30 My guys 2 nd marriage
31
32 Most of my distant relatives have their kits at Ancestry.com - which has much faster growing database - but I prefer FamilyTreeDNA for the better analysis tools. and someone else wrote: My entire project plan is about using FTDNA tools in conjunction with GedMatch. I sure hope that this GedMatch issue is temporary.
33 Unhappy campers 23andme just shot themselves in the foot with their price increase. Leaving ancestry and ftdna as the top dna contenders. I have the DNA results from about 5 yrs ago. This shows me nothing. There is no map There is a page that shows numbers but the explanation is worthless and meaningless I paid for both DNA test and membership and WOW did I get ripped off
34 From GEDMATCH.com: We regret we had to make the decision to stop accepting FTDNA [FamilyTreeDNA.com] DNA uploads. FTDNA has threatened to sue GEDmatch over claimed privacy issues. We have been asked not to discuss the details, because it would be to FTDNA s disadvantage. Suffice it to say that FTDNA s own site seems to currently violate these same issues.
35 Haplogroup Migration Map
36 An ad from 23andMe
37 From My Heritage: Here are some of our price reductions during this special DNA sale: mtdnaplus: Was $129 Now only $59 maternal line Powerful combo for male customers only: Buy Y-DNA37 + mtfullsequence, get Family Finder free Was $307 Now only $248 best value for all lines. Y-DNA111: Was $359 Now only $299 highest resolution test on the paternal line.
38 You won t have to give blood.. You can use your own DNA via a saliva tube. It can help confirm or refute! your research. You might find more family links
39 Some valid concerns Will insurance companies see the results? NPE s (adoptions, illegitimacies) What about law enforcement? Maybe Your Relative s DNA Could Turn You Into a Suspect from WIRED.com
40 What do you think about this? A single gram of DNA can store 1 trillion gigabytes and last for 2,000 years.
41 centimorgans If you have 10 centimorgans in common with another person, there is a 99 percent chance that you are related (and just by sheer chance). FT DNA can accept Ancestry data But if you do another test it could very well give you a different result! Tree can be blocked from view
42 Centimorgans are measurements of how likely the segment is to recombine as it passes from parent to child. Segments with higher cm values have a greater probability of recombining in any one generation. Therefore, when you share DNA segments with larger cm values with a match, your common ancestors are likely to come from generations that are more recent.
43 For example, known second cousins on average share centimorgans (cms), but in extreme cases can actually share as little as 47cMs or as much as 760cMs. Conversely, the relationship between pairs of individuals sharing 212.5cMs has been found to be anywhere between aunt-or-uncle/niece-ornephew and third cousin once removed
44 Autosomal DNA is inherited equally from both parents. The amount of autosomal DNA inherited from more distant ancestors is randomly shuffled up in a process called recombination and the percentage of autosomal DNA coming from each ancestor is diluted with each new generation. When interpreting autosomal DNA statistics, one must be careful to distinguish between the distribution of shared DNA for given relationships and the distribution of relationships for given amounts of shared DNA. For example, known second cousins on average share centimorgans (cms), but in extreme cases can actually share as little as 47cMs or as much as 760cMs. Conversely, the relationship between pairs of individuals sharing 212.5cMs has been found to be anywhere between aunt-or-uncle/niece-or-nephew and third cousin once removed. Autosomal DNA is inherited equally from both parents. The amount of autosomal DNA inherited from more distant ancestors is randomly shuffled up in a process called recombination and the percentage of autosomal DNA coming from each ancestor is diluted with each new generation. For example, known second cousins on average share centimorgans (cms), but in extreme cases can actually share as little as 47cMs or as much as 760cMs. Conversely, the relationship between pairs of individuals sharing 212.5cMs has been found to be anywhere between aunt-or-uncle/niece-or-nephew and third cousin once removed.
45 Where can I find out more? Blaine Bettinger has a blog: And also
46 From the RGS s February speaker: For the very first time, GGP offers hands-on exercises in areas of Y-DNA, mtdna, X-DNA, atdna, the Genealogical Proof Standard, ethics, and more. DNA evidence is increasingly necessary to confirm even the most documented and researched pedigrees. DNA evidence can also help examine some genealogical questions that appear nearly hopeless with traditional genealogical research.
Walter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018
DNA, Ancestry, and Your Genealogical Research- Segments and centimorgans Walter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018 1 Today s agenda Brief review of previous DIG session
More informationTRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter
TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter 1-1: DNA: WHERE DO I START? Definition Genetic genealogy is the application of genetics to traditional genealogy. Genetic genealogy uses genealogical
More informationAutosomal DNA. What is autosomal DNA? X-DNA
ANGIE BUSH AND PAUL WOODBURY info@thednadetectives.com November 1, 2014 Autosomal DNA What is autosomal DNA? Autosomal DNA consists of all nuclear DNA except for the X and Y sex chromosomes. There are
More informationUsing Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM
Using Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.
More informationDNA Basics. OLLI: Genealogy 101 October 1, ~ Monique E. Rivera ~
DNA Basics OLLI: Genealogy 101 October 1, 2018 ~ Monique E. Rivera ~ WHAT IS DNA? DNA (deoxyribonucleic acid) is found in every living cell everywhere. It is a long chemical chain that tells our cells
More informationWalter Steets Houston Genealogical Forum DNA Interest Group April 7, 2018
Ancestry DNA and GEDmatch Walter Steets Houston Genealogical Forum DNA Interest Group April 7, 2018 Today s agenda Recent News about DNA Testing DNA Cautions: DNA Data Used for Forensic Purposes New Technology:
More informationDNA Testing What you need to know first
DNA Testing What you need to know first This article is like the Cliff Notes version of several genetic genealogy classes. It is a basic general primer. The general areas include Project support DNA test
More informationGenealogical Research
DNA, Ancestry, and Your Genealogical Research Walter Steets Houston Genealogical Forum DNA Interest Group March 2, 2019 1 Today s Agenda Brief review of basic genetics and terms used in genetic genealogy
More informationCAGGNI s DNA Special Interest Group
CAGGNI s DNA Special Interest Group 10 Jan 2015 Al & Michelle Wilson Agenda Survey Basics in Fan Charts Recombination Exercise Triangulation Overview Survey 1. Have you taken (or sponsored) a DNA test?
More informationFirst Results: Intro to FamilyTreeDNA s Family Finder. Learn what to do with results of autosomal DNA testing with FamilyTreeDNA (FTDNA).
First Results: Family Tree DNA When You First Get Your FamilyTreeDNA (FTDNA) Results Objective: Learn what to do with results of autosomal DNA testing with FamilyTreeDNA (FTDNA). Tools: familytreedna.com
More informationGetting the Most Out of Your DNA Matches
Helen V. Smith PG Dip Public Health, BMedLabSci, ADCLT, Dip. Fam. Hist. PLCGS 46 Kraft Road, Pallara, Qld, 4110 Email: HVSresearch@DragonGenealogy.com Website: www.dragongenealogy.com Blog: http://www.dragongenealogy.com/blog/
More informationWalter Steets Houston Genealogical Forum DNA Interest Group February 24, 2018
Using Ancestry DNA and Third-Party Tools to Research Your Shared DNA Segments Part 2 Walter Steets Houston Genealogical Forum DNA Interest Group February 24, 2018 1 Today s agenda Brief review of previous
More informationUsing X-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM
Using X-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.
More informationTHE BASICS OF DNA TESTING. By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library
THE BASICS OF DNA TESTING By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library TYPES OF TESTS Mitochondrial DNA (mtdna/mdna) Y-DNA Autosomal DNA (atdna/audna) MITOCHONDRIAL DNA Found
More informationGenetic Genealogy. Rules and Tools. Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter
Genetic Genealogy Rules and Tools Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter I am NOT this guy! 2 Genealogy s Newest Tool Genealogy research: Study of Family History Identifies
More information[CLIENT] SmithDNA1701 DE January 2017
[CLIENT] SmithDNA1701 DE1704205 11 January 2017 DNA Discovery Plan GOAL Create a research plan to determine how the client s DNA results relate to his family tree as currently constructed. The client s
More informationMitochondrial DNA (mtdna) JGSGO June 5, 2018
Mitochondrial DNA (mtdna) JGSGO June 5, 2018 MtDNA - outline What is it? What do you do with it? How do you maximize its value? 2 3 mtdna a double-stranded, circular DNA that is stored in mitochondria
More informationA Day Out With Your DNA
A Day Out With Your DNA Diahan Southard www.yourdnaguide.com Your testing company has evaluated around 800,000 locations on your DNA to help them determine your origins and your genetic cousins. While
More informationIN THIS ISSUE: February From the Administrator Questions/News...1. George Varner of Missouri Direct Line...2
IN THIS ISSUE: From the Administrator..... 1 Questions/News.......1 George Varner of Missouri Direct Line...2 Do the Newtons & Varners Really Both have Riggs DNA?...2 2016 Newton/Varner Reunion. 5 February
More informationDNA Opening Doors for Today s s Genealogist
DNA Opening Doors for Today s s Genealogist Presented to JGSI Sunday, March 30, 2008 Presented by Alvin Holtzman Genetic Genealogy Discussion Points What is DNA How can it help genealogists What to expect
More informationDNA Testing. February 16, 2018
DNA Testing February 16, 2018 What Is DNA? Double helix ladder structure where the rungs are molecules called nucleotides or bases. DNA contains only four of these nucleotides A, G, C, T The sequence that
More informationDNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016
DNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016 1 What we will cover How testing helps genealogy What is DNA? How do you select from the three testing companies?
More information! FTDNA! Ancestry. ! 23andMe. ! Medical Considera,ons. ! Iden,fying family medical history. ! Communica,ng with the medical community
by JEFF CARPENTER! Brief Defini,ons about YDNA, XDNA, mtdna, atdna (Covered in Part 1)! Benefits of Tes,ng DNA! Examples of DNA TESTING! FTDNA! Ancestry! 3andMe Jeff Carpenter, 016 jeffcarpenter1939@gmal.com!
More informationIntroduction to Autosomal DNA Tools
GENETIC GENEALOGY JOURNEY Debbie Parker Wayne, CG, CGL Introduction to Autosomal DNA Tools Just as in the old joke about a new genealogist walking into the library and asking for the book that covers my
More informationY-DNA Genetic Testing
Y-DNA Genetic Testing 50 2/24/14 Y-DNA Genetic Testing Y-DNA flows from fathers to sons intact SNPs define Y-DNA haplogroups Haplogroups (clans) migrated together Timeframe between mutations is 2,000 to
More informationPrimer on Human Pedigree Analysis:
Primer on Human Pedigree Analysis: Criteria for the selection and collection of appropriate Family Reference Samples John V. Planz. Ph.D. UNT Center for Human Identification Successful Missing Person ID
More informationDNA Solu)ons for Brick Walls And Adop)on
DNA Solu)ons for Brick Walls And Adop)on "I have not failed. I've just found ten thousand ways that won't work." Thomas Edison Wise Woman Gene+c Genealogy Comments Listen Carefully! 1. DNA is not the be
More informationYour Family 101 Beginning Genealogical Research
Your Family 101 Beginning Genealogical Research What Will We Cover Today? Session 1: Getting Started Session 2: Your Resources Session 3: Common Mistakes and Pitfalls Session 4: DNA Testing and Medical
More informationGEDmatch Home Page The upper left corner of your home page has Information about you and links to lots of helpful information. Check them out!
USING GEDMATCH Created March 2015 GEDmatch is a free, non-profit site that accepts raw autosomal data files from Ancestry, FTDNA, and 23andme. As such, it provides a large autosomal database that spans
More informationGenetic Genealogy Journey Why Is My Cousin Not on my DNA Match List? Debbie Parker Wayne, CG SM, CGL SM
Genetic Genealogy Journey Why Is My Cousin Not on my DNA Match List? Debbie Parker Wayne, CG SM, CGL SM The CSI television shows have conditioned us to expect exact DNA matches and lead us to think DNA
More informationGetting the Most of Your DNA Test. Friends of Irish Research Richard Reid
Getting the Most of Your DNA Test Friends of Irish Research Richard Reid So You Have Been Tested! The results are back and now is time to explore and see if any of your brick walls can be broken down.
More informationHalley Family. Mystery? Mystery? Can you solve a. Can you help solve a
Can you solve a Can you help solve a Halley Halley Family Family Mystery? Mystery? Who was the great grandfather of John Bennett Halley? He lived in Maryland around 1797 and might have been born there.
More informationAutosomal-DNA. How does the nature of Jewish genealogy make autosomal DNA research more challenging?
Autosomal-DNA How does the nature of Jewish genealogy make autosomal DNA research more challenging? Using Family Finder results for genealogy is more challenging for individuals of Jewish ancestry because
More informationWalter Steets Houston Genealogical Forum DNA Interest Group January 27, 2018
Using Ancestry DNA and Third-Party Tools to Research Your Shared DNA Segments Walter Steets Houston Genealogical Forum DNA Interest Group January 27, 2018 1 Today s agenda Brief review of previous DIG
More informationThe Structure of DNA Let s take a closer look at how this looks under a microscope.
DNA Basics Adapted from a MyHeritage Blog and the International Society of Genetic Genealogy (ISOGG) Wiki by Earl Cory MyHeritage has started a series to explain DNA, how it works and answer the most common
More informationYour mtdna Full Sequence Results
Congratulations! You are one of the first to have your entire mitochondrial DNA (DNA) sequenced! Testing the full sequence has already become the standard practice used by researchers studying the DNA,
More informationDNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding
DNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding by Dr. Ing. Robert L. Baber 2014 July 26 Rights reserved, see the copyright notice at http://gengen.rlbaber.de
More informationEvery human cell (except red blood cells and sperm and eggs) has an. identical set of 23 pairs of chromosomes which carry all the hereditary
Introduction to Genetic Genealogy Every human cell (except red blood cells and sperm and eggs) has an identical set of 23 pairs of chromosomes which carry all the hereditary information that is passed
More informationDNA: UNLOCKING THE CODE
DNA: UNLOCKING THE CODE Connecting Cousins for Genetic Genealogy Bryant McAllister, PhD Associate Professor of Biology University of Iowa bryant-mcallister@uiowa.edu Iowa Genealogical Society April 9,
More informationFind JCD Project Date: Identification-DNA Process Updated:
New Look Investigations Created by: Jack Friess Find JCD Project Date: 04-20-2018 Identification-DNA Process Updated: 05-24-2018 Questions and Answers Identification-DNA (ID-DNA) is a scientific process
More informationTools: 23andMe.com website and test results; DNAAdoption handouts.
When You First Get Your 23andMe Results Objective: Learn what to do with results of atdna testing with 23andMe. Tools: 23andMe.com website and test results; DNAAdoption handouts. Exercises: Practice Exercises
More informationWalter Steets Houston Genealogical Forum DNA Interest Group May 5, 2018
GEDmatch: The Golden State Killer Tier 1 Tools Walter Steets Houston Genealogical Forum DNA Interest Group May 5, 2018 1 Today s agenda Walter s Take on DNA Developments Growth in Number of DNA Testers
More informationRecent Results from the Jackson Brigade DNA Project
Recent Results from the Jackson Brigade DNA Project Dr. Daniel C. Hyde Professor Emeritus of Computer Science Bucknell University Lewisburg, PA Presented at Jackson Brigade Reunion, Horner, WV on August
More informationWhat Can I Learn From DNA Testing?
What Can I Learn From DNA Testing? From where did my ancestors migrate? What is my DNA Signature? Was my ancestor a Jewish Cohanim Priest? Was my great great grandmother really an Indian Princes? I was
More informationDNA for Genealogy Librarians. Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District
DNA for Genealogy Librarians Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District What does DNA do? It replicates itself. It codes for the production
More informationLearn what to do with results of autosomal DNA testing from AncestryDNA. Tools: AncestryDNA results; ancestry.com, gedmatch.com and familytreedna.
First Look : AncestryDNA When You First Get Your AncestryDNA Results Objective: Learn what to do with results of autosomal DNA testing from AncestryDNA. Tools: AncestryDNA results; ancestry.com, gedmatch.com
More informationLearn what to do with results of autosomal DNA testing from AncestryDNA.
When You First Get Your AncestryDNA Results Objective: Learn what to do with results of autosomal DNA testing from AncestryDNA. Tools: AncestryDNA results; ancestry.com, genesis.gedmatch.com and familytreedna.com
More informationRobert Warthen
Robert Warthen www.dnagedcom.com GENETIC GENEALOGY STANDARD NINE ISOGG PRIVATIZE OR REDACT THE NAMES OF LIVING GENETIC MATCHES FROM PRESENTATIONS UNLESS THE GENETIC MATCHES HAVE GIVEN THEIR PRIOR PERMISSION
More informationWalter Steets Houston Genealogical Forum DNA Interest Group November 18, 2017
DNA, Ancestry, and Your Genealogical Research Session 2 Walter Steets Houston Genealogical Forum DNA Interest Group November 18, 2017 1 Today s agenda Brief review of previous DIG session Degrees of Separation
More informationTracking Your Roots With DNA
Tracking Your Roots With DNA Genetic Genealogy Lisa R Franklin RN,BSN 31 Oct 2013/27 Jun 2014 Andalusia, Alabama Why DNA test? Determine if two people are related Determine if two people descend from the
More informationUsing Mitochondrial DNA (mtdna) for Genealogy Debbie Parker Wayne, CG, CGL SM
Using Mitochondrial DNA (mtdna) for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical
More informationBig Y-700 White Paper
Big Y-700 White Paper Powering discovery in the field of paternal ancestry Authors: Caleb Davis, Michael Sager, Göran Runfeldt, Elliott Greenspan, Arjan Bormans, Bennett Greenspan, and Connie Bormans Last
More informationAdvanced Autosomal DNA Techniques used in Genetic Genealogy
Advanced Autosomal DNA Techniques used in Genetic Genealogy Tim Janzen, MD E-mail: tjanzen@comcast.net Summary of Chromosome Mapping Technique The following are specific instructions on how to map your
More informationApproaching and Connecting with Your DNA Matches
Approaching and Connecting with Your DNA Matches Shannon Stewart Christmas, MCP throughthetreesblog@gmail.com Understand DNA Tests The four types of DNA and the relevant test companies Segment triangulation
More informationAn Introduction. Your DNA. and Your Family Tree. (Mitochondrial DNA) Presentation by: 4/8/17 Page 1 of 10
An Introduction Your DNA and Your Family Tree (Mitochondrial DNA) Presentation by: FredCoffey@aol.com 4/8/17 Page 1 of 10 Coffey Surname, y-dna Project We're now ready to move on and look at the type of
More informationUnderstanding DNA in Genealogy. Peter Biggins, BY3164 Darien Library, Darien, CT November 18, 2017
Understanding DNA in Genealogy Peter Biggins, BY3164 Darien Library, Darien, CT November 18, 2017 1953: Watson 25, Crick 37, Franklin 33 My BY3164 SNP 1953 paper published on the structure of DNA 1962
More informationGenetic Genealogy Journey DNA Projects by Debbie Parker Wayne, CG SM, CGL SM
Genetic Genealogy Journey DNA Projects by Debbie Parker Wayne, CG SM, CGL SM Genealogy can be a solitary pursuit. Genealogists sometimes collaborate to work on common lines, but lone researchers can perform
More informationUnderstanding Third Party DNA Analysis Tools. Copyright 2014 James R. Lannin, Jr. aka Jimmy Chromosomes
Understanding Third Party DNA Analysis Tools Copyright 2014 James R. Lannin, Jr. aka Jimmy Chromosomes A Review of the Basics You have 46 chromosomes and they come to you in 23 pairs from your mother and
More informationDNA and Ancestry. An Update on New Tests. Steve Louis. Jewish Genealogical Society of Washington State. January 13, 2014
DNA and Ancestry An Update on New Tests Steve Louis Jewish Genealogical Society of Washington State January 13, 2014 DISCLAIMER This document was prepared as a result of independent work and opinions of
More informationVisual Phasing of Chromosome 1
Visual Phasing of Chromosome 1 If you have the possibility to test three full siblings, then the next great thing you could do with your DNA, is to try out the Visual Phasing technique developed by Kathy
More informationDNA, A Genealogy Tool. The Search for an Expert Genealogist, Photos & Clues
DNA, A Genealogy Tool The Search for an Expert Genealogist, Photos & Clues mydanishancestors.com *Slide Show shared in this class & more web-sites under Toolbar/DNA *One doesn t have to have Danish ancestors
More informationEwing Surname Y-DNA Project Article 8
Ewing Surname Y-DNA Project Article 8 This is the eighth in a series of articles about the Ewing Surname Y-DNA Project. The previous seven articles have appeared in the last seven issues of the Journal
More informationYoder Doors Opened by DNA Studies
Yoder Doors Opened by DNA Studies A Special Report to the 2012 North Carolina Yoder Reunion By Chris Yoder Yoder Newsletter Oct. 2012 www.yodernewsletter.org Established 1983 BACKGROUND How DNA Testing
More informationComputer - aided Genealogy. Rob Drew
Computer - aided Genealogy Rob Drew Topics Building your family tree Off-line tools for your laptop or desktop at home. What s a gedcom file? Building an on-line tree. Research websites Where to get help
More informationFamily Tree DNA Genetic Genealogy Started Here
Family Tree DNA Genetic Genealogy Started Here With 253,000 samples in our DNA database (the largest of its kind in the world) your genealogical search could become even easier Why Bennett Greenspan founded
More informationUsing Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM
Using Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.
More informationDAR POLICY STATEMENT AND BACKGROUND Using DNA Evidence for DAR Applications
Effective January 1, 2014, DAR will begin accepting Y-DNA evidence in support of new member applications and supplemental applications as one element in a structured analysis. This analysis will use a
More informationEller DNA Project. Status Report for Nashville EFA Conference----July 25, Tom Eller, DNA Project Administrator
Eller DNA Project Status Report for Nashville EFA Conference----July 25, 2009 Tom Eller, DNA Project Administrator Eller DNA Project This presentation used material from Family Tree DNA and from World
More informationOrangeburgh District DNA Project. Finding Family Connections with Autosomal DNA Testing
Orangeburgh District DNA Project Finding Family Connections with Autosomal DNA Testing Review some DNA basics Address privacy issues Evidence vs. Proof Look at some specific examples 3 Types of DNA Testing
More informationUse of DNA information in family research information for IOWFHS members
Use of DNA information in family research information for IOWFHS members What is DNA? Since the discovery of deoxyribonucleic acid (DNA) in the 1950s, we have come to understand more about its role as
More informationBefore India: Exploring Your Ancestry With DNA By David G. Mahal
Before India: Exploring Your Ancestry With DNA By David G. Mahal You then receive an email notifying you that your results are ready to explore on utilize your DNA results for family history by Ancestry.com
More informationGenealogy: DNA And The Family Tree By James Mayflower READ ONLINE
Genealogy: DNA And The Family Tree By James Mayflower READ ONLINE CeCe Moore's "DNA Testing for Genealogy - Getting Started" series is a Family Tree DNA is currently the only commercial laboratory offering
More informationWINSLOW HERITAGE SOCIETY ~~~~~~~~~~~~~~~~~~
Newsletter, Vol. 2, No. 1 March, 2015 WINSLOW HERITAGE SOCIETY ~~~~~~~~~~~~~~~~~~ In Vol. 1, No. 1 of the Winslow Heritage Society Newsletter, Kathy Myers, Society Governor, a descendant of Kenelm Winslow,
More informationFREQUENTLY ASKED QUESTIONS ABOUT THE OWSTON/OUSTON DNA PROJECT
FREQUENTLY ASKED QUESTIONS ABOUT THE OWSTON/OUSTON DNA PROJECT 1. What has been discovered thus far and what may be discovered with testing? The Owston/Ouston DNA project grew out of the combined genealogical
More informationRichard Weiss - Director / Exec VP
Richard Weiss - Director / Exec VP www.dnaadoption.com Welcome to DNAGEDCOM GENETIC GENEALOGY STANDARD NINE ISOGG PRIVATIZE OR REDACT THE NAMES OF LIVING GENETIC MATCHES FROM PRESENTATIONS UNLESS THE GENETIC
More informationWelcome to this issue of Facts & Genes, the only publication devoted to Genetic Genealogy.
Facts & Genes from Family Tree DNA ================================== March 3, 2004 Volume 3, Issue 2 In This Issue ============= Editor's Corner In the News: Family Tree DNA Announcements Haplogroups:
More informationGliesianDNA (BETA) atdna Relationships Predictions for cms with no influence factors
GliesianDNA (BETA) atdna Relationships Predictions for 562.3 cms with no influence factors Report generated on: 2018-07-07T13:08:31.511 by Gliesian, LLC's GliesianDNA (beta), version 0.4.1 Introduction
More informationReport on the VAN_TUYL Surname Project Y-STR Results 3/11/2013 Rory Van Tuyl
Report on the VAN_TUYL Surname Project Y-STR Results 3/11/2013 Rory Van Tuyl Abstract: Recent data for two descendants of Ott van Tuyl has been added to the project, bringing the total number of Gameren
More informationICMP DNA REPORTS GUIDE
ICMP DNA REPORTS GUIDE Distribution: General Sarajevo, 16 th December 2010 GUIDE TO ICMP DNA REPORTS 1. Purpose of This Document 1. The International Commission on Missing Persons (ICMP) endeavors to secure
More informationUsing Pedigrees to interpret Mode of Inheritance
Using Pedigrees to interpret Mode of Inheritance Objectives Use a pedigree to interpret the mode of inheritance the given trait is with 90% accuracy. 11.2 Pedigrees (It s in your genes) Pedigree Charts
More informationSouhrada Family Reunion U.S.A. #36
Souhrada Family Reunion U.S.A. #36 CEDAR FALLS, IOWA AUGUST 11, 2018 THANKS TO DAVE & CHERIE SOUHRADA AND JANEL STEPHENS! NOTE: SOUHRADA REUNION IN THE CZECH REPUBLIC SEPTEMBER 15, 2018 In memory of Leota
More informationContributed by "Kathy Hallett"
National Geographic: The Genographic Project Name Background The National Geographic Society is undertaking the ambitious process of tracking human migration using genetic technology. By using the latest
More informationDNA TESTING. This is the testing regime for FamilyTreeDNA. Other SNP tests were ordered from Yseq.
DNA & GENEALOGY DNA TESTING This is the testing regime for FamilyTreeDNA. Other SNP tests were ordered from Yseq. Product Date Batch Family Finder 30-May-14 Completed 569 05-Aug-14 Batched 569 05-Jul-14
More informationClan Galbraith Association Application for or Renewal of Membership
Clan Galbraith Association Application for or Renewal of Membership ELIGIBILITY FOR MEMBERSHIP: Membership in the Clan Galbraith Association is open to any person related by blood or marriage to the Galbraith
More informationGenetic Genealogy. Using DNA to research your maternal & paternal lines. Ed McGuire. Vermont Genealogy Library 2/24/14
Genetic Genealogy Using DNA to research your maternal & paternal lines Ed McGuire 2/24/14 Introduction Soprano Family Tree 2 2/24/14 Introduction 3 2/24/14 Introduction 4 2/24/14 Introduction Contradictory
More informationAn Introduction to Genetic Genealogy
An Introduction to Genetic Genealogy David A. Pike dapike@math.mun.ca Presented To: Family History Society of Newfoundland and Labrador 24 January 2006 Slide 1 of 21 Overview Genetic Genealogy using genetic
More informationcompany does improve its ethnicity estimates, your profile will automatically be updated, too. You won't have to retake the test to get the new
Ancestry dna kit The Y-DNA test is more limited than the ones from Family Tree DNA Does not offer a less expensive 'autosomal DNA-only' test Can't connect with other matches Can't upload raw data from
More informationGenetic Identity and
Genetic Identity and GACATGTAGCTCTTCACTTCACCCAGGTTGGGTTGTGTCAACAGGAAACATTGTAACATATCACTTGGATTAGCACCTAGG/TTAT/TTAT/TTA Community DTC Genetic Testing Workshop The National Academies' August 31 September 1,
More informationMeek DNA Project Group B Ancestral Signature
Meek DNA Project Group B Ancestral Signature The purpose of this paper is to explore the method and logic used by the author in establishing the Y-DNA ancestral signature for The Meek DNA Project Group
More informationWhat to Expect When You re Clustering
What to Expect When You re Clustering Walter Steets Houston Genealogical Forum DNA Interest Group January 5, 2018 1 Today s agenda New Ancestry Match Comparison Report Clustering for DNA Matches Describe
More informationEntire Chromosome 21 Inherited from 5 th Great Grandparents Captain Daniel and Elizabeth (Windecker) Young
Entire Chromosome 21 Inherited from 5 th Great Grandparents Captain Daniel and Elizabeth (Windecker) Young The Ancestors: Daniel Young was born about 1755 in the Canajoharie District of the Mohawk Valley
More informationAn O-F3288 Y DNA Discovery for Patrilineal Descendants of James Revell (Accomack) By Marie A. Rundquist, DNA Project Administrator November 2018
Project Scope Rundquist O-F3288 White Paper 11/2018 An O-F3288 Y DNA Discovery for Patrilineal Descendants of James Revell (Accomack) By Marie A. Rundquist, DNA Project Administrator November 2018 The
More informationPedigrees How do scientists trace hereditary diseases through a family history?
Why? Pedigrees How do scientists trace hereditary diseases through a family history? Imagine you want to learn about an inherited genetic trait present in your family. How would you find out the chances
More informationUsing Autosomal DNA to Solve a Family Mystery
Using Autosomal DNA to Solve a Family Mystery W. Jones, Ph.D., CG, CGL, FASG, FUGA, FNGS Tom@JonesResearchServices.com This case study shows how targeted autosomal-dna testing supplemented documentary
More informationGenealogy is a popular hobby, with Ancestry.com commercials and television shows like Who Do You Think You Are creating a great deal of interest.
Genealogy is a popular hobby, with Ancestry.com commercials and television shows like Who Do You Think You Are creating a great deal of interest. When you discover your lineage and study the records your
More informationGenealogy Report of Alejandro Lorenzetti Tarabelli
Genealogy Report of Alejandro Lorenzetti Tarabelli My name is Donald Martin Mattos Lorenzetti, Mattos is my paternal surname, and Lorenzetti my maternal surname. For years my maternal family and I have
More informationLecture 1: Introduction to pedigree analysis
Lecture 1: Introduction to pedigree analysis Magnus Dehli Vigeland NORBIS course, 8 th 12 th of January 2018, Oslo Outline Part I: Brief introductions Pedigrees symbols and terminology Some common relationships
More informationYour Family Tree Online: How To Trace Your Ancestry From Your Own Computer By Graeme Davis READ ONLINE
Your Family Tree Online: How To Trace Your Ancestry From Your Own Computer By Graeme Davis READ ONLINE Family History Wiki; Ancestry Academy; More; Publish; Download expert advice for tackling your research
More informationMEET YOUR VOLUNTEER PRATER PROJECT ADMINISTRATORS
Prater* Project NEWSLETTER i Vol I, No 1 Click on graphic above to view the latest Prater Project Results Tables using the drop-down menus MEET YOUR VOLUNTEER PRATER PROJECT ADMINISTRATORS Laverne Piatt
More informationDeveloping Conclusions About Different Modes of Inheritance
Pedigree Analysis Introduction A pedigree is a diagram of family relationships that uses symbols to represent people and lines to represent genetic relationships. These diagrams make it easier to visualize
More information