Varner-Newton-Williams Family Reunion 28 May, Macks Creek, Missouri
|
|
|
- Stewart Barker
- 5 years ago
- Views:
Transcription
1 Varner-Newton-Williams Family Reunion 28 May, 2016 Macks Creek, Missouri
2 Today s Discussions Expanding The Circle We are Learning More Every Day, But Who Are These New Folks? The Samuel Philip Varner Line. Billy Joe Varner Ancestors. The John Varner of Maryland Line. William Virgil Varner Ancestors. Y-DNA Testing Results of Billy Joe Varner What We Learned What We Do Not Know What Can we Deduce from the Information we Currently Have? The Search to Substantiate the Ancestors for George Varner of Missouri Next Steps Why Varner s, Newton s, & Williams Reunion Together Where Did we Initially Connect? How Those Connections Can be Used in Autosomal DNA Testing
3 Expanding The Circle The Samuel Philip Varner Line. Billy Joe Varner s Ancestors. Ancestors George Varner of Missouri (Abt Abt. 1861) Samuel Philip Varner ( ) George Henry Varner ( ) Henry Edgar Varner ( ) Billy Joe Varner (1944-) Miller, Phelps Counties Missouri
4 Expanding The Circle The Samuel Philip Varner Line. Billy Joe Varner s Ancestors. Ancestors George Varner of Missouri (Abt Abt. 1861) Samuel Philip Varner ( ) George Henry Varner ( ) Henry Edgar Varner ( ) Cole, Phelps Counties Missouri Billy Joe Varner (1944-)
5 Expanding The Circle The Samuel Philip Varner Line. Billy Joe Varner s Ancestors. Ancestors George Varner of Missouri (Abt Abt. 1861) Samuel Philip Varner ( ) George Henry Varner ( ) Miller, Phelps Counties Missouri Henry Edgar Varner ( ) Billy Joe Varner (1944-)
6 Expanding The Circle The Samuel Philip Varner Line. Billy Joe Varner s Ancestors. Ancestors George Varner of Missouri (Abt Abt. 1861) Samuel Philip Varner ( ) Pettis, Miller Counties Missouri George Henry Varner ( ) Henry Edgar Varner ( ) Billy Joe Varner (1944-)
7 Expanding The Circle The Samuel Philip Varner Line. Billy Joe Varner s Ancestors. Ancestors George Varner of Missouri (Abt Abt. 1861) Oglethorpe Co. GA. Howard, Pettis, Miller Counties Missouri Samuel Philip Varner ( ) George Henry Varner ( ) Henry Edgar Varner ( ) Billy Joe Varner (1944-)
8 Expanding The Circle The Samuel Philip Varner Line. Billy Joe Varner s Ancestors. Ancestors George Varner of Missouri (Abt Abt. 1861) Samuel Philip Varner ( ) George Henry Varner ( ) Henry Edgar Varner ( ) Billy Joe Varner (1944-)
9 Expanding The Circle John Varner of Maryland Line. William Virgil Varner Ancestors Ancestors John Varner (1740-Unk) John Varner ( ) William Varner ( ) William H. (Sandy) Varner ( ) George Washington Varner ( ) William Roy Varner ( ) William Virgil Varner (1933-) OK.
10 Expanding The Circle John Varner of Maryland Line. William Virgil Varner Ancestors Ancestors John Varner (1740-Unk) John Varner ( ) William Varner ( ) William H. (Sandy) Varner ( ) George Washington Varner ( ) William Roy Varner ( ) LeFlore, Pawnee Counties, OK. William Virgil Varner (1933-)
11 Expanding The Circle John Varner of Maryland Line. William Virgil Varner Ancestors Ancestors John Varner (1740-Unk) John Varner ( ) William Varner ( ) William H. (Sandy) Varner ( ) George Washington Varner ( ) Gibson Co. TN.- Panhandle, TX.- Pawnee Co. OK. William Roy Varner ( ) William Virgil Varner (1933-)
12 Expanding The Circle John Varner of Maryland Line. William Virgil Varner Ancestors Ancestors John Varner (1740-Unk) John Varner ( ) William Varner ( ) William H. (Sandy) Varner ( ) Davidson Co. NC.- Gibson Co. TN. George Washington Varner ( ) William Roy Varner ( ) William Virgil Varner (1933-)
13 Expanding The Circle John Varner of Maryland Line. William Virgil Varner Ancestors Ancestors John Varner (1740-Unk) John Varner ( ) William Varner ( ) Rowan County NC. To Gibson Co. TN. William H. (Sandy) Varner ( ) George Washington Varner ( ) William Roy Varner ( ) William Virgil Varner (1933-)
14 Expanding The Circle John Varner of Maryland Line. William Virgil Varner Ancestors Ancestors John Varner (1740-Unk) John Varner ( ) Maryland? to Davidson County NC. William Varner ( ) William H. (Sandy) Varner ( ) George Washington Varner ( ) William Roy Varner ( ) William Virgil Varner (1933-)
15 Expanding The Circle John Varner of Maryland Line. William Virgil Varner Ancestors Ancestors John Varner (1740-Unk) Possible Maryland to????? John Varner ( ) William Varner ( ) William H. (Sandy) Varner ( ) George Washington Varner ( ) William Roy Varner ( ) William Virgil Varner (1933-)
16 Expanding The Circle John Varner of Maryland Line. William Virgil Varner Ancestors Ancestors John Varner (1740-Unk) Possible John Varner ( ) William Varner ( ) William H. (Sandy) Varner ( ) George Washington Varner ( ) William Roy Varner ( ) William Virgil Varner (1933-)
17 Y-DNA Testing Results of Billy Joe Varner What We Learned
18 Y-DNA Testing Results of Billy Joe Varner What We Learned Billy Joe Varner DNA closely matches only one other in the FTDNA database. William Virgil Varner---
19 Y-DNA Testing Results of Billy Joe Varner What We Learned Billy Joe Varner DNA closely matches only one other in the FTDNA database. William Virgil Varner--- Billy Joe Varner does not closely match anyone on GedMatch.com except William Virgil Varner---
20 Y-DNA Testing Results of Billy Joe Varner What We Learned Billy Joe Varner DNA closely matches only one other in the FTDNA database. William Virgil Varner--- Billy Joe Varner does not closely match anyone on GedMatch.com except William Virgil Varner--- None of the other FTDNA Varner Surname Project members matched Billy Joe Varner---
21 Y-DNA Testing Results of Billy Joe Varner What We Learned Billy Joe Varner DNA closely matches only one other in the FTDNA database. William Virgil Varner--- Billy Joe Varner does not closely match anyone on GedMatch.com except William Virgil Varner--- None of the other FTDNA Varner Surname Project members matched Billy Joe Varner--- Billy Joe Varner s DNA Haplogroup is G. G is an uncommon Haplogroup. The detailed signature is: G-L91---
22 Y-DNA Testing Results of Billy Joe Varner What We Do Not Know
23 Y-DNA Testing Results of Billy Joe Varner What We Do Not Know Where the connection between Billy Joe Varner and William Virgil Varner occurs?
24 Y-DNA Testing Results of Billy Joe Varner What We Do Not Know Where the connection between Billy Joe Varner and William Virgil Varner occurs? Why are there so few Y-DNA matches?
25 Y-DNA Testing Results of Billy Joe Varner What Can we Deduce from the Information we Currently Have
26 Y-DNA Testing Results of Billy Joe Varner What Can we Deduce from the Information we Currently Have Billy Joe Varner s Y-DNA is George Varner of Missouri s DNA---
27 Y-DNA Testing Results of Billy Joe Varner What Can we Deduce from the Information we Currently Have Billy Joe Varner s Y-DNA is George Varner of Missouri s DNA--- The Billy Joe Varner lines and the William Virgil Varner lines do have a common ancestor within the last several generations---
28 Y-DNA Testing Results of Billy Joe Varner What Can we Deduce from the Information we Currently Have Billy Joe Varner s Y-DNA is George Varner of Missouri s DNA--- The Billy Joe Varner lines and the William Virgil Varner lines have a common ancestor within the last several generations--- George Varner of Missouri is NOT genetically descended from those tested, Oglethorpe County, Georgia Varner lines---
29 Y-DNA Testing Results of Billy Joe Varner What Can we Deduce from the Information we Currently Have The George Varner of Missouri line is NOT descended from Johannes Adam Werner family---
30 Y-DNA Testing Results of Billy Joe Varner What Can we Deduce from the Information we Currently Have The George Varner of Missouri line is NOT descended from Johannes Adam Werner family--- The most likely place where the George Varner of Missouri genetic line & William Virgil Varner line join is John Varner ( ) from Williams line in North Carolina.
31 Y-DNA Testing Results of Billy Joe Varner What Can we Deduce from the Information we Currently Have Johannes Adam Werner ( ) Palatine - PA John Varner (????-aft. 1800) PA Rowen Co. NC. Fredrick Varner ( ) PA - GA George Varner (Abt Abt. 1861) GA - MO
32 Y-DNA Testing Results of Billy Joe Varner What Can we Deduce from the Information we Currently Have Johannes Adam Werner ( ) Palatine - PA John Varner (????-aft. 1800) PA Rowen Co. NC. Fredrick Varner ( ) PA - GA George Varner (Abt Abt. 1861) GA - MO
33 Y-DNA Testing Results of Billy Joe Varner What Can we Deduce from the Information we Currently Have Johannes Adam Werner ( ) Palatine - PA John Varner (????-aft. 1800) PA Rowen Co. NC. Fredrick Varner ( )?? - GA George Varner (Abt Abt. 1861) GA - MO
34 Y-DNA Testing Results of Billy Joe Varner What Can we Deduce from the Information we Currently Have Johannes Adam Werner ( ) Palatine - PA John Varner (????-aft. 1800) PA Rowen Co. NC. Fredrick Varner ( ) PA - GA George Varner (Abt Abt. 1861) GA - MO
35 Expanding The Circle John Varner of Maryland Line. William Virgil Varner Ancestors Ancestors John Varner (1740-Unk) Possible John Varner ( ) William Varner ( ) William H. (Sandy) Varner ( ) George Washington Varner ( ) William Roy Varner ( ) William Virgil Varner (1933-)
36 Expanding The Circle John Varner of Maryland Line. William Virgil Varner Ancestors Ancestors John Varner (1740-Unk) Possible John Varner ( ) William Varner ( ) William H. (Sandy) Varner ( ) George Washington Varner ( ) William Roy Varner ( ) William Virgil Varner (1933-)
37 Y-DNA Testing Results of Billy Joe Varner What Can we Deduce from the Information we Currently Have John Varner (????-aft. 1800) Fredrick Varner ( ) PA - GA George Varner (Abt Abt. 1861) GA MO John Varner ( ) William Varner ( ) William H. (Sandy) Varner ( ) George Washington Varner ( ) William Roy Varner ( ) William Virgil Varner (1933-)
38 Y-DNA Testing Results of Billy Joe Varner The Search to Substantiate the Ancestors for George Varner of Missouri Next Steps
39 Y-DNA Testing Results of Billy Joe Varner The Search to Substantiate the Ancestors for George Varner of Missouri Next Steps Find a second male genetic descendant of George Varner of Missouri to complete DNA testing to further validate the G Haplogroup---
40 Y-DNA Testing Results of Billy Joe Varner The Search to Substantiate the Ancestors for George Varner of Missouri Next Steps Find a second male genetic descendant of George Varner of Missouri to complete DNA testing to further validate the G Haplogroup--- Conduct detailed study of the North Carolina Varner s to find MRCA (Most Recent Common Ancestor) link to William Virgil Varner line---
41 Why Varner s, Newton s, & Williams Reunion Together Where Did we Initially Connect? Varner s & Newton s:
42 Why Varner s, Newton s, & Williams Reunion Together Where Did we Initially Connect? Varner s & Newton s: No evidence has found Varner s/newton s in the same location before Miller Co. MO. between
43 Why Varner s, Newton s, & Williams Reunion Together Where Did we Initially Connect? Varner s & Newton s: No evidence has found Varner s/newton s in the same location before Miller Co. MO. between William Andrew Newton ( ) moved from Miller to Camden Co. in 1890 s
44 Why Varner s, Newton s, & Williams Reunion Together Where Did we Initially Connect? Varner s & Newton s: No evidence has found Varner s/newton s in the same location before Miller Co. MO. between William Andrew Newton ( ) moved from Miller to Camden Co. in 1890 s Eurelda Varner ( ) moved from Miller to Camden Co. between
45 Why Varner s, Newton s, & Williams Reunion Together Where Did we Initially Connect? Varner s & Newton s: No evidence has found Varner s/newton s in the same location before Miller Co. MO. between William Andrew Newton ( ) moved from Miller to Camden Co. in 1890 s Eurelda Varner ( ) moved from Miller to Camden Co. between The marriage bonding the Varner s/newton s occurred in Camden Co. MO. on 03/26/1893 with the wedding between William Andrew Newton & Eurelda Varner
46 Why Varner s, Newton s, & Williams Reunion Together Where Did we Initially Connect? Varner s & Williams:
47 Why Varner s, Newton s, & Williams Reunion Together Where Did we Initially Connect? Varner s & Williams: No evidence has found Varner s/williams in the same location before Camden Co. MO. between
48 Why Varner s, Newton s, & Williams Reunion Together Where Did we Initially Connect? Varner s & Williams: No evidence has found Varner s/williams in the same location before Camden Co. MO. between William Owen Varner ( ) moved from Miller to Camden Co. between
49 Why Varner s, Newton s, & Williams Reunion Together Where Did we Initially Connect? Varner s & Williams: No evidence has found Varner s/williams in the same location before Camden Co. MO. between William Owen Varner ( ) moved from Miller to Camden Co. between Alta Williams ( ) moved from Polk to Camden Co. between
50 Why Varner s, Newton s, & Williams Reunion Together Where Did we Initially Connect? Varner s & Williams: No evidence has found Varner s/williams in the same location before Camden Co. MO. between William Owen Varner ( ) moved from Miller to Camden Co. between Alta Williams ( ) moved from Polk to Camden Co. between The marriage bonding the Varner s/williams occurred in Camden Co. MO. on 06/21/1903 with the wedding between William Owen Varner & Alta Williams
51 Why Varner s, Newton s, & Williams Reunion Together Where Did we Initially Connect? Newton s & Williams: No evidence has found Newton s/williams in the same location before Camden Co. MO. No direct marriage is found to have occurred between Newton s & Williams
52 And the search continues still Be the one who finds the answer! End
NANCY ANN VARNER ( ) OF PETTIS, MILLER, AND CAMDEN COUNTIES, MISSOURI
Nancy Ann Varner of Missouri: NANCY ANN VARNER (1841-1934) OF PETTIS, MILLER, AND CAMDEN COUNTIES, MISSOURI This is a portion only of the complete text of- George Varner of Missouri GEORGE VARNER (c1789-c1861)
IN THIS ISSUE: QUESTIONS / NEWS Q: From Dee Bremer...going to purchase a ydna kit for a cousin..would you go with Y37 or 67 with a difference of $80?
IN THIS ISSUE: From the Administrator... 1 Questions/News......1 George Varner of Missouri Direct Line 2 Riggs/Varner Connection. 2 Nancy Ann Varner....2 May 2017 FROM THE ADMINISTRATOR Previous newsletters
IN THIS ISSUE: February From the Administrator Questions/News...1. George Varner of Missouri Direct Line...2
IN THIS ISSUE: From the Administrator..... 1 Questions/News.......1 George Varner of Missouri Direct Line...2 Do the Newtons & Varners Really Both have Riggs DNA?...2 2016 Newton/Varner Reunion. 5 February
IN THIS ISSUE: FROM THE ADMINISTRATOR. From the Administrator...1. Questions...2
IN THIS ISSUE: From the Administrator...1 Questions...2 News.. 2 Varner/Riggs Update... 2 George Varner Line DNA... 2 George Varner of Missouri.2 Direct Line Descendants of George Varner of Missouri s
GEORGE VARNER AT FT. BOWYER George Varner s time spent at Ft. Bowyer, Alabama during the War of 1812 IN THIS ISSUE: George Varner at Ft. Bowyer.
IN THIS ISSUE: George Varner at Ft. Bowyer.1 From the Administrator.3 Questions.3 News 4 - Varner/Riggs Update (New!!) 5 -George Varner Line DNA... 5 -A George Varner Line 5-2014 Reunion.6 GEORGE VARNER
Eller DNA Project. Status Report for Nashville EFA Conference----July 25, Tom Eller, DNA Project Administrator
Eller DNA Project Status Report for Nashville EFA Conference----July 25, 2009 Tom Eller, DNA Project Administrator Eller DNA Project This presentation used material from Family Tree DNA and from World
GEDmatch.Com Autosomal Comparison. GEDmatch.Com Autosomal Comparison
Comparing Kit F188390 (James Ronald Thompson) and M003155 (Jim Sanders Beasley)----possibly Walker connection--john Walker and Ann Houston are James Ronald Thompson's line. Largest segment = 3.7 cm Total
The Meek Family of Allegheny Co., PA Meek Group A Introduction
Meek Group A Introduction In the 1770's a significant number of families named Meek(s) lived in S. W. Pennsylvania and they can be identified in the records of Westmoreland, Allegheny and Washington Counties.
Meek DNA Project Group B Ancestral Signature
Meek DNA Project Group B Ancestral Signature The purpose of this paper is to explore the method and logic used by the author in establishing the Y-DNA ancestral signature for The Meek DNA Project Group
The Meek Family of Allegheny Co., PA Meek Group A Introduction
Meek Group A Introduction In the 1770's a significant number of families named Meek(s) lived in S. W. Pennsylvania and they can be identified in the records of Westmoreland, Allegheny and Washington Counties.
DNA Testing What you need to know first
DNA Testing What you need to know first This article is like the Cliff Notes version of several genetic genealogy classes. It is a basic general primer. The general areas include Project support DNA test
Yoder Doors Opened by DNA Studies
Yoder Doors Opened by DNA Studies A Special Report to the 2012 North Carolina Yoder Reunion By Chris Yoder Yoder Newsletter Oct. 2012 www.yodernewsletter.org Established 1983 BACKGROUND How DNA Testing
Family Tree DNA Genetic Genealogy Started Here
Family Tree DNA Genetic Genealogy Started Here With 253,000 samples in our DNA database (the largest of its kind in the world) your genealogical search could become even easier Why Bennett Greenspan founded
Recent Results from the Jackson Brigade DNA Project
Recent Results from the Jackson Brigade DNA Project Dr. Daniel C. Hyde Professor Emeritus of Computer Science Bucknell University Lewisburg, PA Presented at Jackson Brigade Reunion, Horner, WV on August
An O-F3288 Y DNA Discovery for Patrilineal Descendants of James Revell (Accomack) By Marie A. Rundquist, DNA Project Administrator November 2018
Project Scope Rundquist O-F3288 White Paper 11/2018 An O-F3288 Y DNA Discovery for Patrilineal Descendants of James Revell (Accomack) By Marie A. Rundquist, DNA Project Administrator November 2018 The
Y-DNA Genetic Testing
Y-DNA Genetic Testing 50 2/24/14 Y-DNA Genetic Testing Y-DNA flows from fathers to sons intact SNPs define Y-DNA haplogroups Haplogroups (clans) migrated together Timeframe between mutations is 2,000 to
DNA Opening Doors for Today s s Genealogist
DNA Opening Doors for Today s s Genealogist Presented to JGSI Sunday, March 30, 2008 Presented by Alvin Holtzman Genetic Genealogy Discussion Points What is DNA How can it help genealogists What to expect
Using Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM
Using Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.
What Can I Learn From DNA Testing?
What Can I Learn From DNA Testing? From where did my ancestors migrate? What is my DNA Signature? Was my ancestor a Jewish Cohanim Priest? Was my great great grandmother really an Indian Princes? I was
DNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding
DNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding by Dr. Ing. Robert L. Baber 2014 July 26 Rights reserved, see the copyright notice at http://gengen.rlbaber.de
Walter Steets Houston Genealogical Forum DNA Interest Group April 7, 2018
Ancestry DNA and GEDmatch Walter Steets Houston Genealogical Forum DNA Interest Group April 7, 2018 Today s agenda Recent News about DNA Testing DNA Cautions: DNA Data Used for Forensic Purposes New Technology:
Genealogical Research
DNA, Ancestry, and Your Genealogical Research Walter Steets Houston Genealogical Forum DNA Interest Group March 2, 2019 1 Today s Agenda Brief review of basic genetics and terms used in genetic genealogy
The Meek Family Group B Introduction
The Meek Family Group B Introduction The Meek/Meeks DNA Project 1 has established Y-DNA signatures 2 for a significant number of early American ancestors. This allows for a determination of which Meek
WALKER GROUP 42 DNA DISCUSSION DOCUMENT by Fred Coffey
WALKER GROUP 42 DNA DISCUSSION DOCUMENT by Fred Coffey (FredCoffey@aol.com) (Source Link: www.coffey.ws/familytree/familynotes/walkerdna2.pdf) There is a Walker DNA Project on FTDNA (Family Tree DNA) that
Baugh Family Genealogy
Baugh Family Genealogy Descendants of Peter Baugh [#62] & Elizabeth Walthall Generations 2-8 Mark B. Arslan 407 Highlands Lake Drive Cary, NC 27518-9167 marslan@nc.rr.com Baugh Web Site: http://arslanmb.org/baugh/baugh.html
Pizza and Who do you think you are?
Pizza and Who do you think you are? an overview of one of the newest and possibly more helpful developments in researching genealogy and family history that of using DNA for research What is DNA? Part
[CLIENT] Dean1412 R March Research Highlights
![[CLIENT] Dean1412 R March Research Highlights](/thumbs/87/96071363.jpg "[CLIENT] Dean1412 R March Research Highlights")
[CLIENT] Dean1412 R14121 12 March 2015 Research Highlights GOALS Review DNA test results to determine if they provide any evidence for the parents of Charles Noble Dean or provide direction for future
Recommended Citations
Recommended Citations Entire set Kunkel, K., R. Frankson, J. Runkle, S. Champion, L. Stevens, D. Easterling, and B. Stewart (Eds.), 2017: State Climate Summaries for the United States. NOAA Technical Report
Genetic Genealogy. Rules and Tools. Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter
Genetic Genealogy Rules and Tools Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter I am NOT this guy! 2 Genealogy s Newest Tool Genealogy research: Study of Family History Identifies
[CLIENT] SmithDNA1701 DE January 2017
![[CLIENT] SmithDNA1701 DE January 2017](/thumbs/93/113058427.jpg "[CLIENT] SmithDNA1701 DE January 2017")
[CLIENT] SmithDNA1701 DE1704205 11 January 2017 DNA Discovery Plan GOAL Create a research plan to determine how the client s DNA results relate to his family tree as currently constructed. The client s
DNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016
DNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016 1 What we will cover How testing helps genealogy What is DNA? How do you select from the three testing companies?
THE BASICS OF DNA TESTING. By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library
THE BASICS OF DNA TESTING By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library TYPES OF TESTS Mitochondrial DNA (mtdna/mdna) Y-DNA Autosomal DNA (atdna/audna) MITOCHONDRIAL DNA Found
DNA Solu)ons for Brick Walls And Adop)on
DNA Solu)ons for Brick Walls And Adop)on "I have not failed. I've just found ten thousand ways that won't work." Thomas Edison Wise Woman Gene+c Genealogy Comments Listen Carefully! 1. DNA is not the be
First Results: Intro to FamilyTreeDNA s Family Finder. Learn what to do with results of autosomal DNA testing with FamilyTreeDNA (FTDNA).
First Results: Family Tree DNA When You First Get Your FamilyTreeDNA (FTDNA) Results Objective: Learn what to do with results of autosomal DNA testing with FamilyTreeDNA (FTDNA). Tools: familytreedna.com
Genetic Genealogy Journey DNA Projects by Debbie Parker Wayne, CG SM, CGL SM
Genetic Genealogy Journey DNA Projects by Debbie Parker Wayne, CG SM, CGL SM Genealogy can be a solitary pursuit. Genealogists sometimes collaborate to work on common lines, but lone researchers can perform
Walter Steets Houston Genealogical Forum DNA Interest Group November 18, 2017
DNA, Ancestry, and Your Genealogical Research Session 2 Walter Steets Houston Genealogical Forum DNA Interest Group November 18, 2017 1 Today s agenda Brief review of previous DIG session Degrees of Separation
Halley Family. Mystery? Mystery? Can you solve a. Can you help solve a
Can you solve a Can you help solve a Halley Halley Family Family Mystery? Mystery? Who was the great grandfather of John Bennett Halley? He lived in Maryland around 1797 and might have been born there.
I don't believe you can purchase a copy I have looked but no luck.
Email August 19, 2005 9:24:52 AM PDT Charles, No I don't have a copy of that book written by Levi Hilligoss in 1913. Some guy here loaned it to me so I could get the information and copy the pictures I
Shaver Family Genealogy
Shaver Family Genealogy Children of John Shaver & Mary Blackwelder Mark B. Arslan 407 Highlands Lake Drive Cary, NC 27518-9167 marslan@nc.rr.com Shaver Genealogy Web Site: http://arslanmb.org/shaver/shaver.html
! FTDNA! Ancestry. ! 23andMe. ! Medical Considera,ons. ! Iden,fying family medical history. ! Communica,ng with the medical community
by JEFF CARPENTER! Brief Defini,ons about YDNA, XDNA, mtdna, atdna (Covered in Part 1)! Benefits of Tes,ng DNA! Examples of DNA TESTING! FTDNA! Ancestry! 3andMe Jeff Carpenter, 016 jeffcarpenter1939@gmal.com!
DNA: UNLOCKING THE CODE
DNA: UNLOCKING THE CODE Connecting Cousins for Genetic Genealogy Bryant McAllister, PhD Associate Professor of Biology University of Iowa bryant-mcallister@uiowa.edu Iowa Genealogical Society April 9,
DNA for Genealogy Librarians. Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District
DNA for Genealogy Librarians Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District What does DNA do? It replicates itself. It codes for the production
James Perdue Family. (including sources) Research Report by. Joan Horsley Joan Horsley
James Perdue Family (including sources) Research Report by Joan Horsley 2011 Joan Horsley Contact Joan's husband at: jhorsley46@yahoo.com This document may not be used in part or whole for commercial purposes
Chart 2 Group A, 37-Marker Level Entire R1b-M222 Group Generations to Include MRCA at 99% Probability
Chart 2 Group A, 37-Marker Level Entire R1b-M222 Group Generations to Include MRCA at 99% Probability 18 Irish R1b-M222 Section Overview The members of this group demonstrate a wide web of linkage over
W H I T E S I D E F A M I L Y A S S O C I A T I O N
WHITESIDE FAMILY ASSOCIATION W H I T E S I D E F A M I L Y A S S O C I A T I O N S AV E T H E DAT E!! SPECIAL POINTS OF INTEREST: ANNUAL MEETING PLANS 2014 Annual Meeting The WFA plans to hold it its 2014
San Joaquin County First Families Certificate Program
San Joaquin County First Families Certificate Program The San Joaquin Genealogical Society and The San Joaquin County Historical Society have partnered to offer the First Families of San Joaquin County
Tracking Your Roots With DNA
Tracking Your Roots With DNA Genetic Genealogy Lisa R Franklin RN,BSN 31 Oct 2013/27 Jun 2014 Andalusia, Alabama Why DNA test? Determine if two people are related Determine if two people descend from the
Varners in Georgia Census Records (Table of contents at end of document)
To view the ADAHCat catalog record for the Varner Family History Research Papers, click here: http://216.226.178.202:81/vwebv/holdingsinfo?bibid=29322 Varners in Georgia Census Records 1800-1860 (Table
Presentation for BCG Webinar, April 2016
Finding Your Early 1800 s US Ancestors Online Presentation for BCG Webinar, April 2016 James M. Baker, PhD, CG jimb@starstream.net Data Type Comments Online Sources 1. US 1850 census lists everyone and
Autosomal DNA. What is autosomal DNA? X-DNA
ANGIE BUSH AND PAUL WOODBURY info@thednadetectives.com November 1, 2014 Autosomal DNA What is autosomal DNA? Autosomal DNA consists of all nuclear DNA except for the X and Y sex chromosomes. There are
Family Group Record. If this was a son, he died before Resided, Brownville, Lee Co., Alabama,USA
Born 14 Mar 1759, Hanover Co., Virginia Page 1 of 6 23 Aug 1836, Hall Co., Georgia, USA 's father 's mother Born Abt 1781 Thomas Kendrick Rebecca Palmer Abt 1760/1770 perhaps,, Sc Perhaps,, South Carolina
Approaching and Connecting with Your DNA Matches
Approaching and Connecting with Your DNA Matches Shannon Stewart Christmas, MCP throughthetreesblog@gmail.com Understand DNA Tests The four types of DNA and the relevant test companies Segment triangulation
Head Family Genealogy
Head Family Genealogy Children of Benjamin Head [#152] & Martha Sharman Mark B. Arslan 407 Highlands Lake Drive Cary, NC 27518-9167 marslan@nc.rr.com Head Genealogy Web Site: http://arslanmb.org/head/head.html
An Introduction. Your DNA. and Your Family Tree. (Coffey y-dna) Presentation by: 4/8/17 Page 1 of 30
An Introduction Your DNA and Your Family Tree (Coffey y-dna) Presentation by: FredCoffey@aol.com 4/8/17 Page 1 of 30 Coffey Surname, y-dna Project We're now ready to move on and look at the type of results
Ancestors of William Edgar McCulloh
Ancestors of William Edgar McCulloh Generation No. 1 1. William Edgar McCulloh, born Oct 18, 1866 in Fort Louden, Franklin Co., PA; died May 26, 1938 in Harrisurg, Pa.. He was the son of 2. Amos Crosby
Pinpointing the BLAIR Paternal Ancestral Genetic Homeland. A Scottish Case Study
Pinpointing the BLAIR Paternal Ancestral Genetic Homeland A Scottish Case Study Dr Tyrone Bowes Updated 6 th June 2015 Introduction A simple painless commercial ancestral Y chromosome DNA test will potentially
VBGS CD Library. Last update: 11/2/09 1 of 5
CD# TITLE TYPE AREA 4 Marriage Index: MD, NC, VA Virginia, West Va., Maryland, Delaware 121 Military Records, VA in the Rev. and War of 1812 Virginia, West Va., Maryland, Delaware 133 Military Records:
FORM G-37. Name of Regulated Entity: L.J. Hart & Company. Report Period: First Quarter of 2018
FORM G-37 Name of Regulated Entity: L.J. Hart & Company Report Period: First Quarter of 2018 I. CONTRIBUTIONS made to officials of a municipal entity (list by state) State None Complete name, title (including
Walter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018
DNA, Ancestry, and Your Genealogical Research- Segments and centimorgans Walter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018 1 Today s agenda Brief review of previous DIG session
FREQUENTLY ASKED QUESTIONS ABOUT THE OWSTON/OUSTON DNA PROJECT
FREQUENTLY ASKED QUESTIONS ABOUT THE OWSTON/OUSTON DNA PROJECT 1. What has been discovered thus far and what may be discovered with testing? The Owston/Ouston DNA project grew out of the combined genealogical
Case Study Pinpointing the Grace English Paternal Ancestral Genetic Homeland
Case Study Pinpointing the Grace English Paternal Ancestral Genetic Homeland Dr Tyrone Bowes 12 th June 2017 INTRODUCTION A simple painless commercial ancestral Y chromosome DNA test will potentially provide
INTORDUCTION TO FAMILY RESEARCH BY BELINDA JO ADAMS. (2018)
INTORDUCTION TO FAMILY RESEARCH BY BELINDA JO ADAMS. (2018) This book 1 is in honor of our ancestors whose genes we carry in our DNA makeup. It is also dedicated to our grandchildren and the generations
Genetic Genealogy Journey Why Is My Cousin Not on my DNA Match List? Debbie Parker Wayne, CG SM, CGL SM
Genetic Genealogy Journey Why Is My Cousin Not on my DNA Match List? Debbie Parker Wayne, CG SM, CGL SM The CSI television shows have conditioned us to expect exact DNA matches and lead us to think DNA
Tools: 23andMe.com website and test results; DNAAdoption handouts.
When You First Get Your 23andMe Results Objective: Learn what to do with results of atdna testing with 23andMe. Tools: 23andMe.com website and test results; DNAAdoption handouts. Exercises: Practice Exercises
Walter Steets Houston Genealogical Forum DNA Interest Group February 24, 2018
Using Ancestry DNA and Third-Party Tools to Research Your Shared DNA Segments Part 2 Walter Steets Houston Genealogical Forum DNA Interest Group February 24, 2018 1 Today s agenda Brief review of previous
Descendants of William Wonnacott
Descendants of William Wonnacott Generation No. 1 1. WILLIAM 1 WONNACOTT was born Abt. 1821 in Kings Nympton, Devon, England, and died Bet. Apr - Jun 1899 in South Molton, Devon, England. He married MARY
DNA and Ancestry. An Update on New Tests. Steve Louis. Jewish Genealogical Society of Washington State. January 13, 2014
DNA and Ancestry An Update on New Tests Steve Louis Jewish Genealogical Society of Washington State January 13, 2014 DISCLAIMER This document was prepared as a result of independent work and opinions of
Meek/Meeks Families of Virginia Meek Group F Introduction
Meek Group F Introduction The Meek/Meeks DNA Project 1 has established Y-DNA signatures 2 for a significant number of early American ancestors based on tests of living descendants. This allows for a determination
Using Mitochondrial DNA (mtdna) for Genealogy Debbie Parker Wayne, CG, CGL SM
Using Mitochondrial DNA (mtdna) for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical
An Introduction to Genetic Genealogy
An Introduction to Genetic Genealogy David A. Pike dapike@math.mun.ca Presented To: Family History Society of Newfoundland and Labrador 24 January 2006 Slide 1 of 21 Overview Genetic Genealogy using genetic
Early Meek Settlers Of S. W. Pennsylvania By Christopher A. Meek
Early Meek Settlers Of S. W. Pennsylvania By Christopher A. Meek In 1769 the Proprietor of Pennsylvania opened the area of S. W. Pennsylvania to settlers 1. Ownership of the area was also claimed by Virginia
Use U.S. Census Information to Resolve Family History Research Problems
Use U.S. Census Information to Resolve Family History Research Problems Using 1860-1900 migration patterns to find records 1 Using 1860-1900 migration patterns to find records Between 1860 and 1900 the
Finding a Male Hodge(s) Descendant for Y-Chromosome DNA Testing. Prepared by Jan Alpert
Finding a Male Hodge(s) Descendant for Y-Chromosome DNA Testing Prepared by Jan Alpert Why Test Male Y-Chromosome DNA All males carry the Y-Chromosome of their fathers As a result the same DNA markers
ABSTRACTS OF MONTGOMERY COUNTY PENNSYLVANIA WILLS
ABSTRACTS OF MONTGOMERY COUNTY PDF ONLINE OHIO DEATH INDEXES, RECORDS & OBITUARIES DESCENDANTS OF HENRY SMITH - SEDGWICK RESEARCH.COM 1 / 5 2 / 5 3 / 5 abstracts of montgomery county pdf A list of
Ahnentafel Report for Martin Arbuckle
Page 1 of 6 Generation 1 1. Martin Arbuckle 1 2 3 4 was born 5 March 30, 1841 in Near Hope, Bartholomew County, Indiana, He married Mary A. Benson September 4, 1861 in Indiana, He died August 25, 1903
The FERGUS(S)ON DNA project was organized in August of Currently there are about 450 participants whose y-chromosome has been analyzed.
FERGUS(S)ON DNA Project by Colin R. Ferguson, PhD (First Published in The Bee Line, Clan Fergusson Society of North America, Issue No. 94, Spring 2006 and perpetually revised since then) The FERGUS(S)ON
Hyde Families. Newsletter of the Hyde Genealogy Association
Hyde Families Newsletter of the Hyde Genealogy Association!!Volume!2,!Number!1!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!September!2014!
Chapter 10 of Some Jasper County Pioneers Jacob and Mary Herring L. Kenyon
Chapter 10 of Some Jasper County Pioneers Jacob and Mary Herring L. Kenyon This chapter is one of a series if 18 chapters which cover the ancestors and descendants of jasper county pioneer settlers, all
The Charles Alfred and Blanche Missouri Rhodes Hyde Family
Hyde Families Newsletter of the Hyde Genealogy Association!!Volume!2,!Number!2!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!March!2015
Mitchelmore in the middle: A Study of M* surmids Michael Mitchelmore, Sydney
Mitchelmore in the middle: A Study of M* surmids Michael Mitchelmore, Sydney It was a well known custom in the 19th century in England for children to be given their mother s maiden name as a middle name.
CARTMILL/CARTMELL Y-DNA Project 21 Jan 2018 By: Don Sticher
CARTMILL/CARTMELL Y-DNA Project 21 Jan 2018 By: Don Sticher dsticher@earthlink.net The Cartmill/Cartmell Family Group DNA Project was launched in March of 2005. As of January 2018 there are 20 Y-DNA test
Descendants of Thomas Whitted & Peggy Lashley. First Generation
Descendants of Thomas Whitted & Peggy Lashley First Generation 1. Thomas Whitted Jr., 1,2 son of Thomas Whitted Sr. Esq., was born 3 Mar 1784 in Orange County, North Carolina, 1,3 died 15 Jul 1851 in Mount
in: Maury County, Tennessee by McMurray, J.P. in: Montgomery County, Tennessee
Husband: Thomas Franklin Henley I 1799 North Carolina 26 Sep 1832 Maury County, by McMurray, J.P. 1878 Montgomery Co. USA Other Spouses: Amarilla Bowers (unconfirmed) Wife: Zilpha Nolen 1802 1868 Montgomery
WILLIAM HORSLEY and HANNAH RYAN. Parents of. THEOPHILUS T. HORSLEY, JOHN B. HORSLEY, and MARY HORSLEY PARTON. by Joan Horsley June 2011
WILLIAM HORSLEY and HANNAH RYAN Parents of THEOPHILUS T. HORSLEY, JOHN B. HORSLEY, and MARY HORSLEY PARTON by Joan Horsley June 2011 Revised and expanded from Theophilus T. Horsley and John B. Horsley:
Genealogy Report of Alejandro Lorenzetti Tarabelli
Genealogy Report of Alejandro Lorenzetti Tarabelli My name is Donald Martin Mattos Lorenzetti, Mattos is my paternal surname, and Lorenzetti my maternal surname. For years my maternal family and I have
Descendants of Gilkrist Makuredy
Gilkrist Makuredy d. Deceased + Wife of Gilkrist Makuredy d. Deceased Donald Makuredy d. Deceased + Wife of Donald Makuredy d. Deceased Donald nd Makuredy d. abt 00 Isle of Bute, Scotland + Wife of Donald
TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter
TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter 1-1: DNA: WHERE DO I START? Definition Genetic genealogy is the application of genetics to traditional genealogy. Genetic genealogy uses genealogical
A domestic address must contain the following data elements:
ADDRESS EDITS FOR FILE MAINTENANCE ATTACHMENT TO SERVICE REQUEST #16941 FINAL 1.0 INTRODUCTION There are minimal edits in the Payroll/Personnel System (PPS) for employee address formatting which is causing
OGS FINDING AIDS MSS 193. Title: Jean Warhol Collection. Inclusive Dates: 1977 to 1991
OHIO GENEALOGICAL SOCIETY 611 State Route 97 W Bellville OH 44813-8813 419-886-1903 www.ogs.org OGS FINDING AIDS Users of this collection should credit the Ohio Genealogical Society in any reference citing.
LAWSON FAMILY HERITAGE PROGRAM NEWSLETTER
LAWSON FAMILY HERITAGE PROGRAM NEWSLETTER Volume 2. Issue 1 The LFHP newsletter is published four times a year by the Lawson Family Heritage Program and is dedicated to research on William Lawson, Scottish
Genetic Identity and
Genetic Identity and GACATGTAGCTCTTCACTTCACCCAGGTTGGGTTGTGTCAACAGGAAACATTGTAACATATCACTTGGATTAGCACCTAGG/TTAT/TTAT/TTA Community DTC Genetic Testing Workshop The National Academies' August 31 September 1,
23 March I will try and summarize the Y-DNA male line test results for both of you and the other members of the Stubbs DNA Project:
23 March 2019 Hello Irving and Rodney, I would like to share with you my thoughts regarding the recent DNA testing both of you in the Big Y program. I am therefore including both of you in this message.
Getting the Most Out of Your DNA Matches
Helen V. Smith PG Dip Public Health, BMedLabSci, ADCLT, Dip. Fam. Hist. PLCGS 46 Kraft Road, Pallara, Qld, 4110 Email: HVSresearch@DragonGenealogy.com Website: www.dragongenealogy.com Blog: http://www.dragongenealogy.com/blog/
State Capitals Directions:
State Capitals Directions: Using the word bank of state capitals below, match the capitals to their state. Hint: Use a map of the United States to help you locate the capitals. State Capitals Albany -
Family of Lou Vicie Pierce Wright Custer Smith
Family of Lou Vicie Pierce Wright Custer Smith Lou Vicie PIERCE, b. 14 Oct 1854 in Georgia, i,ii,iii,iv,v,vi,vii,viii (daughter of Andrew Jackson PIERCE and Nancy ABERCROMBIE), census 1920 in Ahsahka District
An Introduction. Your DNA. and Your Family Tree. (Mitochondrial DNA) Presentation by: 4/8/17 Page 1 of 10
An Introduction Your DNA and Your Family Tree (Mitochondrial DNA) Presentation by: FredCoffey@aol.com 4/8/17 Page 1 of 10 Coffey Surname, y-dna Project We're now ready to move on and look at the type of
OCCGS Civil War Veterans Project. Veteran s Information
OCCGS Civil War Veterans Project Veteran s Information Veteran s Name: Henry A. NEWMAN Birth Date: March 1844 Location: Adams County, Ohio Death Date: 1 October 1926 Location: Santa Ana, Orange County,
Beginning African American Research: 1865 to the Present
Beginning African American Research: 1865 to the Present Danielle Batson, AG, MLS October 15, 2015 Batsondl@familysearch.org This class focuses on African American research from 1865 (after the Civil War)
State Population Yes No.Alabama 4,822,023 2 Alabama: Sessions (R-AL), Nay.Alaska 731,449 2 Alaska: Begich (D-AK), Nay.Arizona 6,553, Arizona:
State Population Yes No.Alabama 4,822,023 2 Alabama: Sessions (R-AL), Nay.Alaska 731,449 2 Alaska: Begich (D-AK), Nay.Arizona 6,553,255 1 1 Arizona: Flake (R-AZ), Nay.Arkansas 2,949,131 2 Arkansas: Boozman
MISSOURI TANEY COUNTY, MISSOURI - RECORDS pages - soft cover - full name index - reprinted 2018
MOUNTAIN PRESS P.O. BOX 400 SIGNAL MOUNTAIN, TENNESSEE 37377-0400 1-423-886-6369 - office 1-432-886-5312 - fax ************************************************************ NEW BOOKS Here is a listing o