Understanding Third Party DNA Analysis Tools. Copyright 2014 James R. Lannin, Jr. aka Jimmy Chromosomes
|
|
- Alan Hudson
- 6 years ago
- Views:
Transcription
1 Understanding Third Party DNA Analysis Tools Copyright 2014 James R. Lannin, Jr. aka Jimmy Chromosomes
2 A Review of the Basics You have 46 chromosomes and they come to you in 23 pairs from your mother and father. For each numbered pair of "Autosomes" (1 through 22) you have one from your father and one from your mother. And you have a Y from your father and an X from your mother if you are male, or an X from your father and an X from your mother if you are female. (Your Mitochondrial DNA - mtdna - comes from outside the nucleus so it is not part of this discussion.) From Autosomal DNA Segment Analyzer (ADSA) Manual by Don Worth on DNA Gedcom
3 A Review of the Basics (p2) Thus, you actually have two chromosome 13s, and two chromosome 6s and so on. And, if you are female, you have two X chromosomes also. Most chromosome browsers plot only a single horizontal bar to depict segments that match on a chromosome - but a sequence of your DNA that matches someone else's (also known as a matching segment) can be on either chromosome of your or your match's pairs. This means two matching segments could occupy exactly the same location on a given chromosome but actually represent matches to two different common ancestors on opposite sides of your family - one in your mother's tree and one in your father's tree. From Autosomal DNA Segment Analyzer (ADSA) Manual by Don Worth on DNA Gedcom
4 A Review of the Basics (p3) Not all matching segments are representations of a legitimate DNA match. Because Family Tree DNA's autosomal DNA sequencing produces un-phased data (where the DNA values of your mother's and father's chromosomes at each genetic marker are not identified separately but are presented as a pair of letters in an arbitrary order at each SNP) it is possible for the equipment to find sequences of seemingly matching DNA when, in fact, matching markers are coming alternately and randomly from both chromosomes in the pair. From Autosomal DNA Segment Analyzer (ADSA) Manual by Don Worth on DNA Gedcom
5 Match? or No Match? Consider this example: From Autosomal DNA Segment Analyzer (ADSA) Manual by Don Worth on DNA Gedcom
6 Match? In the diagram above, let's imagine that the two chromosomes at the top are your chromosome 13 pair. And let's suppose the topmost one is from your father and the one just below it is from your mother. The "ladder rungs" that connect the strands of the double helix of one chromosome are pairs of molecules called "bases". A "rung" can be a Guanine molecule attached to a Cytosine molecule or an Adenine attached to a Thymine. Each "ladder rung" along a chromosome is called a "base pair" and is numbered from zero at the start of the chromosome to a number in the 100s of millions at the end of the chromosome, depending on the length of the particular chromosome. From Autosomal DNA Segment Analyzer (ADSA) Manual by Don Worth on DNA Gedcom
7 Or The vast majority of these base pairs (about 99%) are structured identically in all human beings. Only 1% of the base pair locations on a chromosome vary from one person to another. Base pairs that can differ between people are called SNPs (Single Nucleotide Polymorphisms - or "snips") and are what allows us to compare and contrast individuals' DNA. In the example above, when comparing your DNA to someone else's, the testing company compares either of the letters that appear at a given horizontal location along your two chromosomes with either of the letters that appear in the same location on the same chromosome pair of someone else's test results. From Autosomal DNA Segment Analyzer (ADSA) Manual by Don Worth on DNA Gedcom
8 No Match! For a match to be legitimate, all of the comparisons of a segment should come from the same chromosome of your pair and your predicted cousin's pair. However, you can see that, while this is the case for the last four SNPs in the example above, it is not the case for the first four. The comparison for the first half of the segment switches back and forth between chromosomes. The resulting "match" of the first four SNPs in this segment is not a match at all. Only the last half of this segment is a legitimate DNA match, and even then, your two chromosomes don't have tiny "Mom" and "Dad" labels on them, so the sequencer can't tell you which side of the family the match is on. From Autosomal DNA Segment Analyzer (ADSA) Manual by Don Worth on DNA Gedcom
9 Identity by State, Not Descent From Autosomal DNA Segment Analyzer (ADSA) Manual by Don Worth on DNA Gedcom
10 Definition of centimorgan (from ISOGG wiki) A centimorgan (abbreviated cm) is a unit of recombinant frequency which is used to measure genetic distance. It is often used to imply distance along a chromosome, and takes into account how often recombination occurs in a region. A region with few cms undergoes relatively less recombination. The number of base pairs to which it corresponds varies widely across the genome
11 Half-identical region A Half-identical region (HIR) is a region of two paired chromosomes where at least one of the two alleles from one person's pair of chromosomes matches at least one of the two alleles from another person's pair of chromosomes throughout the entire region. A half-identical region may be either identical by descent (IBD) or identical by state (IBS).
12 Identical by Descent or Identical by State? An Identical by Descent (IBD) segment is a segment of DNA that is found to be identical (except for rare mutations or testing errors) in two people who are related to each other due to the fact that this segment was passed down to both of them from a common ancestor. An Identical by State (IBS) segment is a region of the genome where two people by coincidence share at least one matching base pair for the entire region. In such cases the segment does not come from a common ancestor.
13 ISOGG wiki statistics: Parent/child: cms 1st cousins: cms 1st cousins 1R: cms 2nd cousins: cms 2nd cousins 2R: cms 3rd cousins: 43-ca 150 cms 3rd cousins 1R: cms More distant cousins: 5-ca 50 cms image by Dimario, Wikimedia Commons
14 DNA Segments Shared With Matches End of 8 cm Segment 1 Start of 10 cm Segment 2 8 cm Segment 10 cm Segment Start of 8 cm Segment 1 End of 10 cm Segment 2 An 8 cm Segment match has a 50% chance of being Identical by Descent. A 10 cm Segment match has a 99% chance of being Identical by Descent. Table from John Walden and the International Society of Genetic Genealogy - ISOGG)
15 So Which atdna Matches Do I Compare With? Half of your 8 cm matches are Identical By Descent, half are Identical By State. Your 10 cm and above segment matches are almost certainly IBD. The larger the largest matching segment, the closer in generations is the MRCA. For the highest success rate, focus first on matches with 10 cm + segments in common.
16 Shared DNA Cheat Sheet by Kelly Wheaton KELLY (MOSIER) WHEATON Download the Shared DNA Cheat Sheet created by Kelly Wheaton from her link below.
17 DNA Segment Matching Tools Now that you ve received your atdna Test Results, what can you do with them? Find cousins! Discover your biogeographical origins! You Cousin 1 Cousin 2 Using 3 rd Party analytical tools is a great way to learn more about your matches (like which side of the family they re on) as well as ascertain which matches are IBD, IBS, or Undetermined
18 Me Cousin A Cousin B Sharing Matches with Matches TRIANGULATION
19 The Five Steps to Triangulation Collect many segments of your matches. Arrange them by chromosome and segment starting location number. Compare and group the overlapping segments. Assign Triangulated Groups to Paternal and Maternal sides of your family. Determine the MRCAs for each Triangulated Group and the Common Ancestor between you and the group.
20 Triangulation Steps to Common Ancestors CoAs & MRCAs Assign Triangulated Groups Compare and Group by Overlap, ICW Relationships Arrange Segments by Chromosome Collect Many DNA Segments of Your Matches
21 Why Does Triangulation Work? Two Scenarios for Mary to Have Two Matches on One Segment Scenario #1: Mary has matches on two halves of a chromosome pair. Chr. Mary John Sam Side M ACTGACTG ACTGACTG GAGAGAGA Mary s Maternal Ancestor P CGCGCGCG ATATATAT CGCGCGCG Mary s Paternal Ancestor Mary matches John & Sam, but they do not match each other. John & Sam are related to Mary on opposite sides of her family, John on the Maternal, Sam on the Paternal. Scenario #2: Mary has matches on only one half of a chromosome pair. Chr. Mary John Sam Side M ACTGACTG ACTGACTG ACTGACTG Mary s Maternal Ancestor P CGCGCGCG ATATATAT GAGAGAGA Mary s Paternal Ancestor Mary matches John & Sam, and John and Sam match both Mary and each other on the same segment. They are all three related on the same side of Mary s family, in this case, the Maternal side. They are a Triangulated Match.
22 DNAGedcom.com View and Analyze your Segment Matches by Chromosome From 1-22 Plus X
23 DNA Gedcom HomePage
24 DNA Gedcom Registration Page
25 DNA Gedcom Login Page
26 Upload AncestryDNA Raw Data to DNA Gedcom
27 AncestryDNA Helper Tool by Jeff Snavely
28 Download Data From FTDNA to DNA Gedcom
29 Download Data From FTDNA to DNA Gedcom
30 Download Data From 23andMe to DNA Gedcom
31 Download Data From 23andMe to DNA Gedcom
32 Autosomal Tools Menu
33 Autosomal DNA Segment Analyzer (ADSA) - Version 2
34 What the ADSL Manual Covers
35 ADSL Links to Manual & Quick Start Guide
36 Links to Manual & Quick Start Guide ADSL Manual by Don Worth - ml.php ADSL Quick Start Guide - al.html.php
37 ADSA DNA Segment Analysis Page
38 Jworks Download Page (Juan Pizarro)
39 Kworks (Kitty Munson Cooper)
40 Sample X Chromosome Matches DNAGedcom Note: I used a minimum segment length of 2 cms and a minimum SNP count of 500. When asked what a good minimum comparison size for X Chromosome matches was, Roberta Estes of the DNA Explained blog said: Regarding what is a good match, it s both the cm length, generally over 7, and the total number of SNPS in that segment, generally over 500. Since males have only 1 X Chromosome, shorter segment lengths can be considered.
41 Created and Operated by John Olson and Curtis Rogers GEDMatch.com Tools for DNA & Genealogy Research
42 My GEDmatch Home Page
43 GEDmatch Statistics as of August 2014 The GEDmatch database contains data from are over 80,000 DNA kits. The Gedmatch genealogy database contains records of 25 million individuals. GEDmatch has over 50,000 registered users. Big Three DNA Testing Company Statistics as of August 2014 Dr. Maurice Gleeson at the International Genetic Genealogy Conference, Aug 2014
44 What is Gedmatch? GEDmatch is a website which accepts uploads of data from the three major testing companies. Steps to start using GEDmatch: Register and select a username and password. Upload your data following the clear instructions. Most of the tools are usable within an hour of upload. The One to Many comparison tool may take a day to be available, due to time required to process data.
45 What Can I Do at GEDmatch View your Admixture (ethno-ancestry composition). Compare your DNA results to others. Phase DNA results to one or more parents. Analyze your DNA. Compare or search GEDcoms
46 GEDmatch Data Analysis
47 Determining your deep ethnic ancestry. ADMIXTURE
48 Admixture Calculators Creations of Citizen Scientists Results are approximations; there is no guarantee of accuracy. The results can take a minute or more. Results have a link to creator s Project Page. Select the Admixture (heritage) option to view choices. For best results choose tests based on your predominant ethnic ancestry.
49 Select an Admixture Calculator Selecting the MDLP Project, then choosing the World-22 Admixture Proportions Calculator will give a good overview for a first-time user.
50 Magnus Ducatus Lituaniae Project - BGA analysis project for the territories of former Grand Duchy of Lithuania. Admin: Vadim Verenich Co-admin: Leon Kull MLDP PROJECT
51 MDLP World-22 Admixture Proportions
52 Admixture Graphing and Calculations by Dienekes Pontikos DODECAD
53 Meet the Ancestors!
54 Admixture Results by Chromosome
55 Dodecad V3 Admixture Proportions
56 Dodecad V3 Admixture Proportions Chromosome Painting
57 Davidski David Wesolowski Admixture Graphing EUROGENES PROJECT
58 Eurogenes K13 Admixture Proportions
59 Eurogenes K36 Admixture Proportions
60 Eurogenes Hunter Gatherer vs. Farmer Admixture Proportions
61 Eurogenes Jtest Admixture Proportions
62 Eurogenes EUtest Admixture Proportions
63 Feature Benefits of Admixture Options MDLP World 22 General Overall compares with 22 populations Worldwide. Dodecad - General Populations and Africa Eurogenes Best for Europeans, has some special extras (Jewish, hunter gatherer) HarappaWorld Best choice for South Asia Ethiohelix Best choice for African ancestry, use Africa+French with European mixture.
64 GEDmatch Data Comparisons
65 One to Many Matches
66 One to One Comparison
67 X One to One Comparison
68 GEDmatch Miscellaneous Utilities
69 Phasing
70 People Who Match One or Both of Two Kits Input Screen
71 People Who Match One or Both of Two Kits
72 Predict Eye Color
73 Are Your Parents Related?
74 Are Your Parents Related?
75 Are Jim s Parents Related? NO!
76 3-D Chromosome Browser Input
77 3-D Chromosome Browser
78 3-D Chromosome Browser
79 3-D Chromosome Browser
80 Archaic DNA Matches
81 DNA File Diagnostic Utility
82 GEDmatch Kit Numbers GEDmatch assigns a letter prefix to your testing company s kit number: A****** for AncestryDNA F****** for FamilyTreeDNA M****** for 23andMe Forgetting to include the initial letter of the GEDmatch kit number is one of the biggest reasons for GEDmatch tools not to work.
83 Rebecca Walker Attended University of Alaska Anchorage Lives in Kansas City, Missouri Beckins LLC Genome Mate Desktop Software A Tool for Managing DNA Comparisons
84 Genome Mate
85 Tracking & Organizing Your Matches Until now, Genetic Genealogists needed to be competent, if not expert, in the use of spreadsheet software like Excel, if they wanted to track and organize their DNA matches to find MRCAs and CoAs. Setting up and organizing the columns, rows and cells can be confusing for some. Now, there is a desktop computer program which does all of the hard stuff for you. It is:
86
87 What is Genome Mate? Genome Mate is a desktop tool used to organize in one place the data collected while researching DNA comparisons. Besides data storage it has many features to aid in identifying common ancestors. Genome Mate is like a dashboard, a central control system for your Genetic Genealogy Investigations. Works with FamilyTreeDNA, AncestryDNA, DNAGedcom, GEDmatch and 23andMe,. Download at:
88 What is Genome Mate? Genome Mate can be downloaded for free, but it s author, Rebecca Walker, asks that if you like it and use it, please make a donation. If you use Genome Mate, you ll agree that she deserves it! To make best use of Genome Mate, you should have already uploaded your data to DNA Gedcom and GEDmatch. Instructions for downloading data into Genome Mate are easy to follow if you read them carefully. Download Genome Mate at: Clear instruction for using Genome Mate can be found on Rebecca s blog at
89 Features Multiple Profiles for multiple kits Import of 23andMe, FTDNA and GedMatch data Chromosome Mapping of Common Ancestors In Common With (ICW) Groups Import of Gedcom data for each Profile Surname Matching and Searching Display of Overlapping Segments X-List of X Chromosome Donors All of your data is stored locally on your computer. A server is used to initially download the application and to install updates as they become available.
90 Main Page The main screen displays DNA comparisons sorted by chromosome and segment start/end points. These can be filtered by several means so that just the data of interest is displayed. Data is displayed both graphically and in table format. Research notes can be added and are maintained in a database on your computer. The application supports multiple profiles so there can be a profile for each relative tested. When the most recent common ancestors (MRCA) are found for a DNA segment, these can be added to the chromosome map. One of the most useful functions is the the ability to look at all the matches which overlap a DNA segment across all sources (23andMe, GedMatch, FTDNA) since not everyone subscribes to all three.
91 Links to More Information App Overview Getting Started with 23andMe Data Getting Started with FTDNA Data Getting Started with GedMatch Data Getting Started with Ancestry Data You Tube Videos Getting Started With Genome Mate Genome Mate Demo ICW on Genome Mate
92 Import Data Screen
93 Table View
94 Graph View
95 Triangulated Matches on Graph Page
96 Match Details Page
97 Segment View
98 User Options Screen
99 Setup Form Letter Screen
100 Sample Initial Sent to a Match Redacted
101 Neanderthal Denisovan Bronze Age Neolithic Farmers Paleolithic Hunter-Gatherers Genetic Genealogy Tools and Other Things Felix Jeyareuben Chandrakumar Works at Hewlett-Packard Australia Pty. Limited Attended University of South Australia Lives in Adelaide
102 Felix s Popular Tools
103 BAM Analysis Kit
104 Genetic Genealogy Kit
105 Genetic Genealogy Kit Ethnic Origins
106 Genetic Genealogy Kit Mito-Map
107 Genetic Genealogy Kit Mito-Map Details
108 Genetic Genealogy Kit Mitochondrial Phylogeny
109 Genetic Genealogy Kit New Kit Screen
110 Genetic Genealogy Kit Matching Kits
111 Genetic Genealogy Kit Phased Segment Visualizer
112 Genetic Genealogy Kit Phasing Utility
113 Genetic Genealogy Kit ISOGG Y-Tree
114 ISOGG Y-Tree AddOn for Google Chrome
115 SNP Map A program to view SNP data, and see how the data compares to other populations and regions of the world.
116 What is SNP Map? The purpose of SNP Map is to help you explore your autosomal genome data from 23andMe or FamilyTreeDNA. In particular, it's meant to help identify segments of your chromosomes that show ancestry, either recent or ancient, that show similarities with different regions of the world, and the populations within those regions.
117 What Does SNP Map Compare? One thing you'll discover, is that genetically, people all over the globe are quite similar. At some positions on the chromosome, people can have alternate alleles for that position. Some of these are the SNP locations that the DNA services test. Although any allele can occur in people from any part of the globe, studies have shown that the frequencies of the alleles are often different among people from different parts of the world.
118 What Does SNP Map Help You Do? For most SNPs the frequency differences are small - too small to be very useful for identifying the region or population from which a person might have ancestry. But there are some SNPs that have sizable frequency differences. These difference usually vary over distance, so that the difference is small between adjacent populations, or even adjacent regions, but significant between distant regions. Finding these SNPs and displaying information about them is what SNP Map helps you do.
119 SPA Special Ancestry Analysis Predict Ancestry or Geographic Origin Produces 2 and 3 Dimensional Mapping
120 SPA Overview
121 SPA Download Page
122 Geographic Population Structure Prediction A new journey into your ancestry!
123
124 Kitty Munson Cooper s DNA Utilities Tools for DNA Analysis
125
126
127
128 Make a graphic chromosome map from a CSV of overlapping segments KITTY COOPER S SEGMENT MAPPER
129 Kitty Cooper s Segment Mapper Input Screeen
130 Kitty Cooper s Segment Mapper Sample Output
131 Sometimes you might like to see a detailed picture of all the largest overlapping DNA segments on one chromosome. KITTY COOPER S ONE CHROMOSOME MAPPER
132 Kitty Cooper s One Chromosome Map Input Screen
133 Kitty Cooper s One Chromosome Map Sample Output
134 For Once You ve Found a Few Common Ancestors KITTY COOPER S ANCESTOR CHROMOSOME MAPPER
135 Kitty s Chromosome Mapper - Input Screen
136 Kitty Cooper s Ancestor Chromosome Mapper Sample Screenshot
137 Sample Output Kitty Cooper s Chromosome Mapper Sample Output from Jim Bartlett
138 Anders Pålsen, a Norwegian Genetic Genealogy Blogger FENNOSCANDIA BIOGRAPHIC PROJECT
139 Fennoscandia Biographic Project Home Page
140 Anders Pålsen does Nordic DNA Analysis All grandparents born in Norway, Sweden or Finland? your 23andme/FamilyFinder/deCODEme genotype file zipped to NEW! Estonians, Lithuanians, Latvians, Germans, Nederlands, Belgians, Luxenbourg, Austrians, Checkz, Slovaks, Balkans, Danes, Poles, Icelanders and Russians also welcome! ANALYSIS STATUS: FILE PREPARATIONS!
141 When All is Said and Done SOME CLOSING THOUGHTS
142 DNA Test Analysis Timeline Get Autosomal Test Results Upload to GedMatch and/or DNAGedcom Contact and Collaborate Study Your 10 cm+ Matches Triangulate ICW Matches This is a simple timeline to illustrate the recommended process to move from DNA testing to finding genetic cousins and enlisting them in a collaborative effort to develop the genealogical links between matches. Additional benefits can include a better understanding of our deep ancestral heritage.
143 The End Presentation Copyright 2014 James R. Lannin, Jr. aka Jimmy Chromosomes
Autosomal DNA. What is autosomal DNA? X-DNA
ANGIE BUSH AND PAUL WOODBURY info@thednadetectives.com November 1, 2014 Autosomal DNA What is autosomal DNA? Autosomal DNA consists of all nuclear DNA except for the X and Y sex chromosomes. There are
More informationWalter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018
DNA, Ancestry, and Your Genealogical Research- Segments and centimorgans Walter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018 1 Today s agenda Brief review of previous DIG session
More informationCAGGNI s DNA Special Interest Group
CAGGNI s DNA Special Interest Group 10 Jan 2015 Al & Michelle Wilson Agenda Survey Basics in Fan Charts Recombination Exercise Triangulation Overview Survey 1. Have you taken (or sponsored) a DNA test?
More informationIntroduction to Autosomal DNA Tools
GENETIC GENEALOGY JOURNEY Debbie Parker Wayne, CG, CGL Introduction to Autosomal DNA Tools Just as in the old joke about a new genealogist walking into the library and asking for the book that covers my
More informationRobert Warthen
Robert Warthen www.dnagedcom.com GENETIC GENEALOGY STANDARD NINE ISOGG PRIVATIZE OR REDACT THE NAMES OF LIVING GENETIC MATCHES FROM PRESENTATIONS UNLESS THE GENETIC MATCHES HAVE GIVEN THEIR PRIOR PERMISSION
More informationWalter Steets Houston Genealogical Forum DNA Interest Group April 7, 2018
Ancestry DNA and GEDmatch Walter Steets Houston Genealogical Forum DNA Interest Group April 7, 2018 Today s agenda Recent News about DNA Testing DNA Cautions: DNA Data Used for Forensic Purposes New Technology:
More informationRichard Weiss - Director / Exec VP
Richard Weiss - Director / Exec VP www.dnaadoption.com Welcome to DNAGEDCOM GENETIC GENEALOGY STANDARD NINE ISOGG PRIVATIZE OR REDACT THE NAMES OF LIVING GENETIC MATCHES FROM PRESENTATIONS UNLESS THE GENETIC
More informationGenetic Genealogy. Rules and Tools. Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter
Genetic Genealogy Rules and Tools Baltimore County Genealogical Society March 25, 2018 Andrew Hochreiter I am NOT this guy! 2 Genealogy s Newest Tool Genealogy research: Study of Family History Identifies
More informationGEDmatch Home Page The upper left corner of your home page has Information about you and links to lots of helpful information. Check them out!
USING GEDMATCH Created March 2015 GEDmatch is a free, non-profit site that accepts raw autosomal data files from Ancestry, FTDNA, and 23andme. As such, it provides a large autosomal database that spans
More informationGenealogical Research
DNA, Ancestry, and Your Genealogical Research Walter Steets Houston Genealogical Forum DNA Interest Group March 2, 2019 1 Today s Agenda Brief review of basic genetics and terms used in genetic genealogy
More informationUsing Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM
Using Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.
More informationWalter Steets Houston Genealogical Forum DNA Interest Group January 27, 2018
Using Ancestry DNA and Third-Party Tools to Research Your Shared DNA Segments Walter Steets Houston Genealogical Forum DNA Interest Group January 27, 2018 1 Today s agenda Brief review of previous DIG
More informationTRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter
TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter 1-1: DNA: WHERE DO I START? Definition Genetic genealogy is the application of genetics to traditional genealogy. Genetic genealogy uses genealogical
More informationFirst Results: Intro to FamilyTreeDNA s Family Finder. Learn what to do with results of autosomal DNA testing with FamilyTreeDNA (FTDNA).
First Results: Family Tree DNA When You First Get Your FamilyTreeDNA (FTDNA) Results Objective: Learn what to do with results of autosomal DNA testing with FamilyTreeDNA (FTDNA). Tools: familytreedna.com
More informationPizza and Who do you think you are?
Pizza and Who do you think you are? an overview of one of the newest and possibly more helpful developments in researching genealogy and family history that of using DNA for research What is DNA? Part
More informationAdvanced Autosomal DNA Techniques used in Genetic Genealogy
Advanced Autosomal DNA Techniques used in Genetic Genealogy Tim Janzen, MD E-mail: tjanzen@comcast.net Summary of Chromosome Mapping Technique The following are specific instructions on how to map your
More informationUsing X-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM
Using X-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.
More informationDNA Testing What you need to know first
DNA Testing What you need to know first This article is like the Cliff Notes version of several genetic genealogy classes. It is a basic general primer. The general areas include Project support DNA test
More informationWalter Steets Houston Genealogical Forum DNA Interest Group February 24, 2018
Using Ancestry DNA and Third-Party Tools to Research Your Shared DNA Segments Part 2 Walter Steets Houston Genealogical Forum DNA Interest Group February 24, 2018 1 Today s agenda Brief review of previous
More informationTools: 23andMe.com website and test results; DNAAdoption handouts.
When You First Get Your 23andMe Results Objective: Learn what to do with results of atdna testing with 23andMe. Tools: 23andMe.com website and test results; DNAAdoption handouts. Exercises: Practice Exercises
More informationDNA Testing. February 16, 2018
DNA Testing February 16, 2018 What Is DNA? Double helix ladder structure where the rungs are molecules called nucleotides or bases. DNA contains only four of these nucleotides A, G, C, T The sequence that
More information[CLIENT] SmithDNA1701 DE January 2017
[CLIENT] SmithDNA1701 DE1704205 11 January 2017 DNA Discovery Plan GOAL Create a research plan to determine how the client s DNA results relate to his family tree as currently constructed. The client s
More informationDNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding
DNA Basics, Y DNA Marker Tables, Ancestral Trees and Mutation Graphs: Definitions, Concepts, Understanding by Dr. Ing. Robert L. Baber 2014 July 26 Rights reserved, see the copyright notice at http://gengen.rlbaber.de
More informationTracking Your Roots With DNA
Tracking Your Roots With DNA Genetic Genealogy Lisa R Franklin RN,BSN 31 Oct 2013/27 Jun 2014 Andalusia, Alabama Why DNA test? Determine if two people are related Determine if two people descend from the
More informationTHE BASICS OF DNA TESTING. By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library
THE BASICS OF DNA TESTING By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library TYPES OF TESTS Mitochondrial DNA (mtdna/mdna) Y-DNA Autosomal DNA (atdna/audna) MITOCHONDRIAL DNA Found
More informationLearn what to do with results of autosomal DNA testing from AncestryDNA. Tools: AncestryDNA results; ancestry.com, gedmatch.com and familytreedna.
First Look : AncestryDNA When You First Get Your AncestryDNA Results Objective: Learn what to do with results of autosomal DNA testing from AncestryDNA. Tools: AncestryDNA results; ancestry.com, gedmatch.com
More informationGetting the Most Out of Your DNA Matches
Helen V. Smith PG Dip Public Health, BMedLabSci, ADCLT, Dip. Fam. Hist. PLCGS 46 Kraft Road, Pallara, Qld, 4110 Email: HVSresearch@DragonGenealogy.com Website: www.dragongenealogy.com Blog: http://www.dragongenealogy.com/blog/
More informationLearn what to do with results of autosomal DNA testing from AncestryDNA.
When You First Get Your AncestryDNA Results Objective: Learn what to do with results of autosomal DNA testing from AncestryDNA. Tools: AncestryDNA results; ancestry.com, genesis.gedmatch.com and familytreedna.com
More informationThe Structure of DNA Let s take a closer look at how this looks under a microscope.
DNA Basics Adapted from a MyHeritage Blog and the International Society of Genetic Genealogy (ISOGG) Wiki by Earl Cory MyHeritage has started a series to explain DNA, how it works and answer the most common
More informationDNA Solu)ons for Brick Walls And Adop)on
DNA Solu)ons for Brick Walls And Adop)on "I have not failed. I've just found ten thousand ways that won't work." Thomas Edison Wise Woman Gene+c Genealogy Comments Listen Carefully! 1. DNA is not the be
More informationBefore India: Exploring Your Ancestry With DNA By David G. Mahal
Before India: Exploring Your Ancestry With DNA By David G. Mahal You then receive an email notifying you that your results are ready to explore on utilize your DNA results for family history by Ancestry.com
More informationA Day Out With Your DNA
A Day Out With Your DNA Diahan Southard www.yourdnaguide.com Your testing company has evaluated around 800,000 locations on your DNA to help them determine your origins and your genetic cousins. While
More informationGenetic Genealogy Journey DNA Projects by Debbie Parker Wayne, CG SM, CGL SM
Genetic Genealogy Journey DNA Projects by Debbie Parker Wayne, CG SM, CGL SM Genealogy can be a solitary pursuit. Genealogists sometimes collaborate to work on common lines, but lone researchers can perform
More informationYour mtdna Full Sequence Results
Congratulations! You are one of the first to have your entire mitochondrial DNA (DNA) sequenced! Testing the full sequence has already become the standard practice used by researchers studying the DNA,
More informationWalter Steets Houston Genealogical Forum DNA Interest Group May 5, 2018
GEDmatch: The Golden State Killer Tier 1 Tools Walter Steets Houston Genealogical Forum DNA Interest Group May 5, 2018 1 Today s agenda Walter s Take on DNA Developments Growth in Number of DNA Testers
More informationDNA Basics. OLLI: Genealogy 101 October 1, ~ Monique E. Rivera ~
DNA Basics OLLI: Genealogy 101 October 1, 2018 ~ Monique E. Rivera ~ WHAT IS DNA? DNA (deoxyribonucleic acid) is found in every living cell everywhere. It is a long chemical chain that tells our cells
More informationGetting the Most of Your DNA Test. Friends of Irish Research Richard Reid
Getting the Most of Your DNA Test Friends of Irish Research Richard Reid So You Have Been Tested! The results are back and now is time to explore and see if any of your brick walls can be broken down.
More informationGenetic Genealogy Journey Why Is My Cousin Not on my DNA Match List? Debbie Parker Wayne, CG SM, CGL SM
Genetic Genealogy Journey Why Is My Cousin Not on my DNA Match List? Debbie Parker Wayne, CG SM, CGL SM The CSI television shows have conditioned us to expect exact DNA matches and lead us to think DNA
More informationUsing Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM
Using Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.
More informationUsing Mitochondrial DNA (mtdna) for Genealogy Debbie Parker Wayne, CG, CGL SM
Using Mitochondrial DNA (mtdna) for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical
More informationWhat to Expect When You re Clustering
What to Expect When You re Clustering Walter Steets Houston Genealogical Forum DNA Interest Group January 5, 2018 1 Today s agenda New Ancestry Match Comparison Report Clustering for DNA Matches Describe
More informationMitochondrial DNA (mtdna) JGSGO June 5, 2018
Mitochondrial DNA (mtdna) JGSGO June 5, 2018 MtDNA - outline What is it? What do you do with it? How do you maximize its value? 2 3 mtdna a double-stranded, circular DNA that is stored in mitochondria
More information! FTDNA! Ancestry. ! 23andMe. ! Medical Considera,ons. ! Iden,fying family medical history. ! Communica,ng with the medical community
by JEFF CARPENTER! Brief Defini,ons about YDNA, XDNA, mtdna, atdna (Covered in Part 1)! Benefits of Tes,ng DNA! Examples of DNA TESTING! FTDNA! Ancestry! 3andMe Jeff Carpenter, 016 jeffcarpenter1939@gmal.com!
More informationDNAGedcom s GWorks Automation Utility using Ancestry.com Results
Developed by Debra Demeester, collaborating genealogist, based on Kitty Cooper's blog post of 26 Sept 2017. PART 1: PARTNER DNAGedcom AND ANCESTRY I. CREATE A PAID ACCOUNT AT DNAGEDCOM 1. Click on the
More informationWalter Steets Houston Genealogical Forum DNA Interest Group November 18, 2017
DNA, Ancestry, and Your Genealogical Research Session 2 Walter Steets Houston Genealogical Forum DNA Interest Group November 18, 2017 1 Today s agenda Brief review of previous DIG session Degrees of Separation
More informationDNA for Genealogy Librarians. Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District
DNA for Genealogy Librarians Patricia Lee Hobbs, CG Local History & Genealogy Reference Associate Springfield-Greene County Library District What does DNA do? It replicates itself. It codes for the production
More informationRecent Results from the Jackson Brigade DNA Project
Recent Results from the Jackson Brigade DNA Project Dr. Daniel C. Hyde Professor Emeritus of Computer Science Bucknell University Lewisburg, PA Presented at Jackson Brigade Reunion, Horner, WV on August
More informationApproaching and Connecting with Your DNA Matches
Approaching and Connecting with Your DNA Matches Shannon Stewart Christmas, MCP throughthetreesblog@gmail.com Understand DNA Tests The four types of DNA and the relevant test companies Segment triangulation
More informationDNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016
DNA The New Genealogy Frontier Hope N. Tillman & Walt Howe Charlestown October 14, 2016 1 What we will cover How testing helps genealogy What is DNA? How do you select from the three testing companies?
More informationDNA: UNLOCKING THE CODE
DNA: UNLOCKING THE CODE Connecting Cousins for Genetic Genealogy Bryant McAllister, PhD Associate Professor of Biology University of Iowa bryant-mcallister@uiowa.edu Iowa Genealogical Society April 9,
More informationAutosomal-DNA. How does the nature of Jewish genealogy make autosomal DNA research more challenging?
Autosomal-DNA How does the nature of Jewish genealogy make autosomal DNA research more challenging? Using Family Finder results for genealogy is more challenging for individuals of Jewish ancestry because
More informationEvery human cell (except red blood cells and sperm and eggs) has an. identical set of 23 pairs of chromosomes which carry all the hereditary
Introduction to Genetic Genealogy Every human cell (except red blood cells and sperm and eggs) has an identical set of 23 pairs of chromosomes which carry all the hereditary information that is passed
More informationVisual Phasing of Chromosome 1
Visual Phasing of Chromosome 1 If you have the possibility to test three full siblings, then the next great thing you could do with your DNA, is to try out the Visual Phasing technique developed by Kathy
More informationIdentification of the Hypothesized African Ancestry of the Wife of Pvt. Henry Windecker Using Genomic Testing of the Autosomes.
Identification of the Hypothesized African Ancestry of the Wife of Pvt. Henry Windecker Using Genomic Testing of the Autosomes Introduction African Ancestry: The hypothesis, based on considerable circumstantial
More informationDNA Opening Doors for Today s s Genealogist
DNA Opening Doors for Today s s Genealogist Presented to JGSI Sunday, March 30, 2008 Presented by Alvin Holtzman Genetic Genealogy Discussion Points What is DNA How can it help genealogists What to expect
More informationSession 08. Ethnicity Results from Autosomal DNA tests. Lynn Teague
Orangeburg German-Swi
More informationUse of DNA information in family research information for IOWFHS members
Use of DNA information in family research information for IOWFHS members What is DNA? Since the discovery of deoxyribonucleic acid (DNA) in the 1950s, we have come to understand more about its role as
More informationYour Family 101 Beginning Genealogical Research
Your Family 101 Beginning Genealogical Research What Will We Cover Today? Session 1: Getting Started Session 2: Your Resources Session 3: Common Mistakes and Pitfalls Session 4: DNA Testing and Medical
More informationFind JCD Project Date: Identification-DNA Process Updated:
New Look Investigations Created by: Jack Friess Find JCD Project Date: 04-20-2018 Identification-DNA Process Updated: 05-24-2018 Questions and Answers Identification-DNA (ID-DNA) is a scientific process
More informationDNA and Ancestry. An Update on New Tests. Steve Louis. Jewish Genealogical Society of Washington State. January 13, 2014
DNA and Ancestry An Update on New Tests Steve Louis Jewish Genealogical Society of Washington State January 13, 2014 DISCLAIMER This document was prepared as a result of independent work and opinions of
More informationDNA TESTING. This is the testing regime for FamilyTreeDNA. Other SNP tests were ordered from Yseq.
DNA & GENEALOGY DNA TESTING This is the testing regime for FamilyTreeDNA. Other SNP tests were ordered from Yseq. Product Date Batch Family Finder 30-May-14 Completed 569 05-Aug-14 Batched 569 05-Jul-14
More informationHalley Family. Mystery? Mystery? Can you solve a. Can you help solve a
Can you solve a Can you help solve a Halley Halley Family Family Mystery? Mystery? Who was the great grandfather of John Bennett Halley? He lived in Maryland around 1797 and might have been born there.
More informationMyHeritage.com First Look, Page 1 of 35
MyHeritage.com First Look, Page 1 of 35 MyHeritage.com First Look MyHeritage is a comprehensive online genealogy company headquartered in Israel. This document provides a brief overview of features available
More informationUnderstanding DNA in Genealogy. Peter Biggins, BY3164 Darien Library, Darien, CT November 18, 2017
Understanding DNA in Genealogy Peter Biggins, BY3164 Darien Library, Darien, CT November 18, 2017 1953: Watson 25, Crick 37, Franklin 33 My BY3164 SNP 1953 paper published on the structure of DNA 1962
More informationcompany does improve its ethnicity estimates, your profile will automatically be updated, too. You won't have to retake the test to get the new
Ancestry dna kit The Y-DNA test is more limited than the ones from Family Tree DNA Does not offer a less expensive 'autosomal DNA-only' test Can't connect with other matches Can't upload raw data from
More informationGenetic Genealogy. Using DNA to research your maternal & paternal lines. Ed McGuire. Vermont Genealogy Library 2/24/14
Genetic Genealogy Using DNA to research your maternal & paternal lines Ed McGuire 2/24/14 Introduction Soprano Family Tree 2 2/24/14 Introduction 3 2/24/14 Introduction 4 2/24/14 Introduction Contradictory
More informationFamily Tree DNA Genetic Genealogy Started Here
Family Tree DNA Genetic Genealogy Started Here With 253,000 samples in our DNA database (the largest of its kind in the world) your genealogical search could become even easier Why Bennett Greenspan founded
More informationIN THIS ISSUE: February From the Administrator Questions/News...1. George Varner of Missouri Direct Line...2
IN THIS ISSUE: From the Administrator..... 1 Questions/News.......1 George Varner of Missouri Direct Line...2 Do the Newtons & Varners Really Both have Riggs DNA?...2 2016 Newton/Varner Reunion. 5 February
More informationY-DNA Genetic Testing
Y-DNA Genetic Testing 50 2/24/14 Y-DNA Genetic Testing Y-DNA flows from fathers to sons intact SNPs define Y-DNA haplogroups Haplogroups (clans) migrated together Timeframe between mutations is 2,000 to
More informationSimulated gene genealogy of a sample of size 50 from a population of constant size. The History of Population Size from Whole Genomes.
Simulated gene genealogy of a sample of size 50 from a population of constant size The History of Population Size from Whole Genomes Alan R Rogers October 1, 2018 Short terminal branches; long basal ones
More informationWhat Can I Learn From DNA Testing?
What Can I Learn From DNA Testing? From where did my ancestors migrate? What is my DNA Signature? Was my ancestor a Jewish Cohanim Priest? Was my great great grandmother really an Indian Princes? I was
More informationPedigree Reconstruction using Identity by Descent
Pedigree Reconstruction using Identity by Descent Bonnie Kirkpatrick Electrical Engineering and Computer Sciences University of California at Berkeley Technical Report No. UCB/EECS-2010-43 http://www.eecs.berkeley.edu/pubs/techrpts/2010/eecs-2010-43.html
More informationTable of Contents. Introduction DNA Basics DNA Origins: How it works Concepts of Race BioGeographical Ancestry...
Table of Contents Introduction... 1 In This Manual Your Results Package DNA Basics... 2 Terms You Will Encounter in this Manual Types of DNA Used in Ancestry Testing DNA Origins: How it works... 4 Concepts
More informationBig Y-700 White Paper
Big Y-700 White Paper Powering discovery in the field of paternal ancestry Authors: Caleb Davis, Michael Sager, Göran Runfeldt, Elliott Greenspan, Arjan Bormans, Bennett Greenspan, and Connie Bormans Last
More informationEller DNA Project. Status Report for Nashville EFA Conference----July 25, Tom Eller, DNA Project Administrator
Eller DNA Project Status Report for Nashville EFA Conference----July 25, 2009 Tom Eller, DNA Project Administrator Eller DNA Project This presentation used material from Family Tree DNA and from World
More informationDAR POLICY STATEMENT AND BACKGROUND Using DNA Evidence for DAR Applications
Effective January 1, 2014, DAR will begin accepting Y-DNA evidence in support of new member applications and supplemental applications as one element in a structured analysis. This analysis will use a
More informationGenealogical trees, coalescent theory, and the analysis of genetic polymorphisms
Genealogical trees, coalescent theory, and the analysis of genetic polymorphisms Magnus Nordborg University of Southern California The importance of history Genetic polymorphism data represent the outcome
More informationGliesianDNA (BETA) atdna Relationships Predictions for cms with no influence factors
GliesianDNA (BETA) atdna Relationships Predictions for 562.3 cms with no influence factors Report generated on: 2018-07-07T13:08:31.511 by Gliesian, LLC's GliesianDNA (beta), version 0.4.1 Introduction
More informationYoder Doors Opened by DNA Studies
Yoder Doors Opened by DNA Studies A Special Report to the 2012 North Carolina Yoder Reunion By Chris Yoder Yoder Newsletter Oct. 2012 www.yodernewsletter.org Established 1983 BACKGROUND How DNA Testing
More informationEwing Surname Y-DNA Project Article 8
Ewing Surname Y-DNA Project Article 8 This is the eighth in a series of articles about the Ewing Surname Y-DNA Project. The previous seven articles have appeared in the last seven issues of the Journal
More informationUsing Gworks. Gworks is a tool that lets you search and compare data from your gedcoms and Ancestry files. It is found on
Using Gworks Gworks is a tool that lets you search and compare data from your gedcoms and Ancestry files. It is found on http://dnagedcom.com Upload Gedcom Files Start by uploading any gedcom files you
More informationDNA CHARLOTTE COUNTY GENEALOGICAL SOCIETY - MARCH 30, 2013 WALL STREET JOURNAL ARTICLE
DNA CHARLOTTE COUNTY GENEALOGICAL SOCIETY - MARCH 30, 2013 WALL STREET JOURNAL ARTICLE NATIONAL GEOGRAPHIC GENOGRAPHIC PROJECT ABOUT NEWS RESULTS BUY THE KIT RESOURCES Geno 2.0 - Genographic Project
More informationAn O-F3288 Y DNA Discovery for Patrilineal Descendants of James Revell (Accomack) By Marie A. Rundquist, DNA Project Administrator November 2018
Project Scope Rundquist O-F3288 White Paper 11/2018 An O-F3288 Y DNA Discovery for Patrilineal Descendants of James Revell (Accomack) By Marie A. Rundquist, DNA Project Administrator November 2018 The
More informationGenetic Evidence Relative to the Native American Ancestry of Catharine, the Wife of Lt. John Young ( )
Genetic Evidence Relative to the Native American Ancestry of Catharine, the Wife of Lt. John Young (1742-1812) By David K. Faux While the present author has created a 50 plus page document outlining all
More informationDNA, A Genealogy Tool. The Search for an Expert Genealogist, Photos & Clues
DNA, A Genealogy Tool The Search for an Expert Genealogist, Photos & Clues mydanishancestors.com *Slide Show shared in this class & more web-sites under Toolbar/DNA *One doesn t have to have Danish ancestors
More informationDiana Elder AG R Familylocket.com. Getting Organized. One Paper at a Time
Diana Elder AG R Familylocket.com Getting Organized One Paper at a Time First comes thought; Then organization of that thought, into ideas and plans; Then transformation of those plans into reality. The
More informationW H I T E S I D E F A M I L Y A S S O C I A T I O N
WHITESIDE FAMILY ASSOCIATION W H I T E S I D E F A M I L Y A S S O C I A T I O N S AV E T H E DAT E!! SPECIAL POINTS OF INTEREST: ANNUAL MEETING PLANS 2014 Annual Meeting The WFA plans to hold it its 2014
More informationMEET YOUR VOLUNTEER PRATER PROJECT ADMINISTRATORS
Prater* Project NEWSLETTER i Vol I, No 1 Click on graphic above to view the latest Prater Project Results Tables using the drop-down menus MEET YOUR VOLUNTEER PRATER PROJECT ADMINISTRATORS Laverne Piatt
More informationComputer - aided Genealogy. Rob Drew
Computer - aided Genealogy Rob Drew Topics Building your family tree Off-line tools for your laptop or desktop at home. What s a gedcom file? Building an on-line tree. Research websites Where to get help
More informationMeek DNA Project Group B Ancestral Signature
Meek DNA Project Group B Ancestral Signature The purpose of this paper is to explore the method and logic used by the author in establishing the Y-DNA ancestral signature for The Meek DNA Project Group
More informationAlgorithms for Genetics: Basics of Wright Fisher Model and Coalescent Theory
Algorithms for Genetics: Basics of Wright Fisher Model and Coalescent Theory Vineet Bafna Harish Nagarajan and Nitin Udpa 1 Disclaimer Please note that a lot of the text and figures here are copied from
More informationGenetic Identity and
Genetic Identity and GACATGTAGCTCTTCACTTCACCCAGGTTGGGTTGTGTCAACAGGAAACATTGTAACATATCACTTGGATTAGCACCTAGG/TTAT/TTAT/TTA Community DTC Genetic Testing Workshop The National Academies' August 31 September 1,
More informationWelcome to this issue of Facts & Genes, the only publication devoted to Genetic Genealogy.
Facts & Genes from Family Tree DNA ================================== March 3, 2004 Volume 3, Issue 2 In This Issue ============= Editor's Corner In the News: Family Tree DNA Announcements Haplogroups:
More informationGenesis and Genetics Matthew Price
Genesis and Genetics Matthew Price Apologetics and Creation Camp 16 June 2018 Karakariki Christian Camp, Waikato, NZ 1 What is Science? 2 What is Science? Hypothesis Theory Start with a hypothesis; a reasonable
More informationGenealogical and Genetic Evidence Relating to the Native American Ancestry of: Margaret Ann (Hensiek) Faux
Genealogical and Genetic Evidence Relating to the Native American Ancestry of: Margaret Ann (Hensiek) Faux One of the profound difficulties in exploring the early genealogy of Ozark families is that there
More informationTHE KING S SON. (The Evidence) Brad Michael Little. (3 rd Edition) (APPENDIX No.1) (April 2018)
THE KING S SON (The Evidence) (3 rd Edition) (APPENDIX No.1) (April 2018) By Brad Michael Little THE KING S SON (The Evidence) [3 rd Edition] 546 ABOUT THE AUTHOR Brad Michael Little is the youngest grandson
More informationAncestral Recombination Graphs
Ancestral Recombination Graphs Ancestral relationships among a sample of recombining sequences usually cannot be accurately described by just a single genealogy. Linked sites will have similar, but not
More informationAn Introduction. Your DNA. and Your Family Tree. (Mitochondrial DNA) Presentation by: 4/8/17 Page 1 of 10
An Introduction Your DNA and Your Family Tree (Mitochondrial DNA) Presentation by: FredCoffey@aol.com 4/8/17 Page 1 of 10 Coffey Surname, y-dna Project We're now ready to move on and look at the type of
More informationSouhrada Family Reunion U.S.A. #36
Souhrada Family Reunion U.S.A. #36 CEDAR FALLS, IOWA AUGUST 11, 2018 THANKS TO DAVE & CHERIE SOUHRADA AND JANEL STEPHENS! NOTE: SOUHRADA REUNION IN THE CZECH REPUBLIC SEPTEMBER 15, 2018 In memory of Leota
More informationOrigins: Coffey/Keogh Families By Fred Coffey. ONLINE:
Origins: Coffey/Keogh Families By Fred Coffey ONLINE: http://www.coffey.ws/familytree/dna/origins-coffeykeoghfamilies.pdf My name is Coffey, and I m very interested in working out the origins of my family.
More information