Efficient collection of DNA and pedigree verification/assignment. status and plans in Denmark, Sweden and Finland
|
|
|
- Julianna Richardson
- 5 years ago
- Views:
Transcription
1 Efficient collection of DNA and pedigree verification/assignment status and plans in Denmark, Sweden and Finland NAV workshop Copenhagen, January 2015 Anders Fogh, Minna Toivonen, Nils-Erik Larsson STØTTET AF mælkeafgiftsfonden
2 Background for pedigree verification today and in the future Microsatellites Can confirm or reject possible parents, but cannot find parents Expensive test SNP Find parents with 99,9% reliability with sufficient number of SNP s ( 400) Method used today pedigree verification of genotyped animals handheld and time consuming 2...
3 Status on common Nordic pedigree verification system Initial discussions in Sweden and Finland Discussions, technical description and programming started in Denmark in spring/summer 2014 Parentage database and algorithm programmed in Denmark Ordering of tests and information to farmer described Nordic coordination will start in winter 2014/
4 Starting point Approx. 400 SNP s, of which 100 are determined internationally by ISAG Previously genotyped animals from Denmark, Sweden and Finland Beef and dairy 4...
5 Collection of DNA material Denmark Today: Blood, semen, tissue (TSU and ear tags), etc. today In the future: Ear tags in whole herds TSU for single animals German procedure Tissue is stored in cooperation between cattle organizations 5...
6 Today: Collection of DNA material Sweden Blood (TEGO kit), hair samples, nose-swab, semen Hair samples stored at Dynamic Code from 2000 Possible to SNP-test if found valuable!? In the future: Ear tags in whole herds Tissue stored on lab (Dynamic Code, Genoskan or other lab used). Tissue owned by Växa Sverige 6...
7 Today: Collection of DNA material Finland Blood (TEGO kit, tubes), hair samples, noseswab, (semen) Old hair samples stored by Faba. New samples from 2010 stored in Genoskan, owned by Faba In the future: TEGO kit, ear tags in whole herds Tissue stored in lab (Genoskan or other lab used). Tissue owned by Faba 7...
8 Parentage verification 400 SNP s for all animals are loaded to parentage database Foreign animals via Interbull service 8...
9 How to verify parentage? Test of one parent/search for possible parents: Opposite homozygotes = error Count number of errors 9...
10 Verification of parentage Possible parent A..G..C..A..C..C..A..A..T..C C..G..A..T..G..C..A..C..A..C Pairwise chromosomes Offspring C..A..C..A..G..A..A..A..T..G A..A..C..T..G..A..A..C..A..C
11 Access to parentage database Ordering: Possibility to connect to common parentage database from national clients Pedigree correction: Information from national databases back to parentage database when pedigree is corrected 11...
12 Information to farmer Error in pedigree Correction of parentage More and more automatically, when more cows are being genotyped 12...
13 Overview of workflow in new system Common or National ordering system Ordering Parentage Genomic Heritable diseases Single animals: TSU, blood etc. Test results for relatives? Whole herd: Ear tags Database containing all animals with tissue samples or other material Farmer, Viking or advisor Registration of all incoming samples in lab Storing of material Analyses on lab when ordered Follow-up Information to farmer Parentage database with 400 SNP s Verification of parentage Heritable diseases SNP to SNP-database Correction of pedigree automatically or from national databases
14 Possible labeling of parentage Denmark Labeling of individual animal on database, printouts etc.: Scenario Sire Dam Remark on Danish database Test Approved Test Approved 1 Yes Yes Yes Yes Parentage approved 2 Yes Yes No No Sire approved 3 No No Yes Yes Dam approved 4 Yes No Yes No Parentage rejected 5 Yes No Sire rejected 6 Yes No Dam rejected Generally pedigree is not deleted on national database, if it is not approved but herdbook marking is deleted 14...
15 Possible labeling of parentage Sweden Today In database, printouts etc.: D = DNA-typed V= pedigree verified In the future Same but done with SNP. Maybe further developed according to Danish scheme December 2014 decision taken that pedigree information found rejected by genomic test should be deleted in database! Routines for updating from SNP-test, where correct ancestry found has to be established 15...
16 Possible labeling of parentage Finland Every animal has a label based on insemination date and birth information (ICAR rule) Sire correct/conflict/not possible to derive Parentage is tested normally for both sire and dam (microsatellite) label: DNA-tested The same label even if dam is dead/not tested Incorrect pedigree: Farmer is responsible to correct in national database Not accepted in herd book with incorrect pedigree 16...
17 Sample with minimal effort and maximal reliability! Sampling - part of normal work flow Unique connection between tag and sample 17...
18 Danish pilot study Started November 2013 Test ear tag and collection procedure from stable to lab Goal ear tags used Frozen samples are genomic tested by Genoskan tissue quality Status 2,500 ear tags used now rest in herds all breeds
19 Procedure for collection
20 Lessons from Danish pilot study Farmers are very satisfied with ear tags and applicator Modification of ordinary applicator Allflex has more focus on production process In the future test of ear tags from more manufacturers
Guidelines. General Rules for ICAR. Section 1 - General Rules
Section 1 Guidelines General Rules for ICAR Section 1 - General Rules Table of Contents Overview 1 Methods of identification... 4 1.1 Rules on animal identification... 4 1.2 Methods of animal identification...
REGULATIONS OF THE AUSTRALIAN LIMOUSIN BREEDERS' SOCIETY LIMITED December 2017 INDEX
REGULATIONS OF THE AUSTRALIAN LIMOUSIN BREEDERS' SOCIETY LIMITED December 2017 INDEX 1. MEMBERSHIP RESPONSIBILITIES 1.1 Eligibility for Showing 2. SOCIETY RIGHTS 2.1 DNA Typing of Sires 2.2 Parentage Verification
IRISH SIMMENTAL CATTLE SOCIETY CATTLE SOCIETY LTD. HERDBOOK REGULATIONS
IRISH SIMMENTAL CATTLE SOCIETY CATTLE SOCIETY LTD. HERDBOOK REGULATIONS 1. Herdbook Contents The Herdbook of the Society shall include: a) Particulars of the Pedigree of Registered Simmental Cattle. b)
RULES FOR REGISTRATION -Savanna Goat
RULES FOR REGISTRATION -Savanna Goat A. GENERAL RULES AND REGULATIONS Goals of the World Wide Sheep and Goat Archives, Inc. ( WWSGA ) is the creation of a breed registry to record documents and maintain
Forensic use of the genomic relationship matrix to validate and discover livestock. pedigrees
Forensic use of the genomic relationship matrix to validate and discover livestock pedigrees K. L. Moore*, C. Vilela*, K. Kaseja*, R, Mrode* and M. Coffey* * Scotland s Rural College (SRUC), Easter Bush,
E.A.S.B.B Herd-book Rules of the European Association of Specialised Beef Breeds Society Ltd.
E.A.S.B.B Herd-book Rules of the European Association of Specialised Beef Breeds Society Ltd. The Herd-book of the Romagnola Breed. The Herd-book of the Romagnola breed shall include: a) Particulars of
RULES & REGULATIONS OF THE AMERICAN SHORTHORN ASSOCIATION
RULES & REGULATIONS OF THE AMERICAN SHORTHORN ASSOCIATION RULE I HERD BOOK The American Shorthorn Association (ASA) shall acquire and assemble data needed to accurately record all animals accepted for
CHAROLAIS BREEDERS NEW ZEALAND (INC) Regulations Articles
CHAROLAIS BREEDERS NEW ZEALAND (INC) Regulations Articles CHAROLAIS BREEDERS NEW ZEALAND (INC) R E G U L A T I O N S ARTICLES In the constitution and in the regulations of the society as from time to time
Inbreeding Using Genomics and How it Can Help. Dr. Flavio S. Schenkel CGIL- University of Guelph
Inbreeding Using Genomics and How it Can Help Dr. Flavio S. Schenkel CGIL- University of Guelph Introduction Why is inbreeding a concern? The biological risks of inbreeding: Inbreeding depression Accumulation
LABOGENA. Genetic Analysis Laboratory for Animal Species. Group of Economic Interest Jouy en Josas 2004 LABOGENA - MYB 1
LABOGENA Genetic Analysis Laboratory for Animal Species Group of Economic Interest 78352 Jouy en Josas 2004 LABOGENA - MYB 1 Between research and genetic improvement Initially derived from an INRA blood
Management of genetic variability in French small ruminants with and without pedigree information
EAAP 2009, Session 13 Management of genetic variability in French small ruminants with and without pedigree information Review and pratical lessons Danchin-Burge C 1,2, Palhière I. 3, Raoul J. 2 1 AgroParisTech,
INTERNATIONAL LAMA REGISTRY
INTERNATIONAL LAMA REGISTRY REGISTRY POLICIES International Lama Registry PO Box 8 Kalispell, MT 59903 406.755.3438 - fax 406.755.3439 ilr@lamaregistry.com - www.lamaregistry.com Policies and Procedures
Characterization of the Global Brown Swiss Cattle Population Structure
Abstract Characterization of the Global Brown Swiss Cattle Population Structure W. Gebremariam (1)*, F. Forabosco (2), B. Zumbach (2), V. Palucci (2) and H. Jorjani (2) (1) Swedish Agricultural University,
Optimum contribution selection conserves genetic diversity better than random selection in small populations with overlapping generations
Optimum contribution selection conserves genetic diversity better than random selection in small populations with overlapping generations K. Stachowicz 12*, A. C. Sørensen 23 and P. Berg 3 1 Department
Shareholder Roadshow June 2016
Shareholder Roadshow June 2016 Agenda 1. Murray King: Update on Capital Structure 2. Wayne McNee: Technology Update LIC: Innovative history 1910 Small regional milk testing Co ops 1930s 1940s 1960s Milk
Analysis of inbreeding of the South African Dairy Swiss breed
South African Journal of Animal Science 2013, 43 (No. 1) Short communication Analysis of inbreeding of the South African Dairy Swiss breed P. de Ponte Bouwer 1, C. Visser 1# & B.E. Mostert 2 1 Department
DNA: UNLOCKING THE CODE
DNA: UNLOCKING THE CODE Connecting Cousins for Genetic Genealogy Bryant McAllister, PhD Associate Professor of Biology University of Iowa bryant-mcallister@uiowa.edu Iowa Genealogical Society April 9,
Lecture 6: Inbreeding. September 10, 2012
Lecture 6: Inbreeding September 0, 202 Announcements Hari s New Office Hours Tues 5-6 pm Wed 3-4 pm Fri 2-3 pm In computer lab 3306 LSB Last Time More Hardy-Weinberg Calculations Merle Patterning in Dogs:
1) Using the sightings data, determine who moved from one area to another and fill this data in on the data sheet.
Parentage and Geography 5. The Life of Lulu the Lioness: A Heroine s Story Name: Objective Using genotypes from many individuals, determine maternity, paternity, and relatedness among a group of lions.
Characterization of the global Brown Swiss cattle population structure
Swedish University of Agricultural Sciences Faculty of Veterinary Medicine and Animal Science Characterization of the global Brown Swiss cattle population structure Worede Zinabu Gebremariam Examensarbete
Genetic Analysis for Spring- and Fall- Run San Joaquin River Chinook Salmon for the San Joaquin River Restoration Program
Study 49 Genetic Analysis for Spring- and Fall- Run San Joaquin River Chinook Salmon for the San Joaquin River Restoration Program Final 2015 Monitoring and Analysis Plan January 2015 Statement of Work
GENETICS AND BREEDING. Calculation and Use of Inbreeding Coefficients for Genetic Evaluation of United States Dairy Cattle
GENETICS AND BREEDING Calculation and Use of Inbreeding Coefficients for Genetic Evaluation of United States Dairy Cattle. R. WlGGANS and P. M. VanRADEN Animal Improvement Programs Laboratory Agricultural
1. A word from the President
ICAR NEWSLETTER March 2016 A word from the President 1. A word from the President TABLE OF CONTENT 1. A word from the President...1 2. ICAR s 65th anniversary: the marking dates...1 3. ICAR: the founding
Wildlife DNA Forensics Course
Wildlife DNA Forensics Course Lecture A4 Evidence for forensic testing: chain of custody and sample preservation. No: A4 Lecturer: R. McEwing Date: 02/08/2010 Introduction Maintaining the Chain of Custody
From Sticky Mucus to Probing our Past: Aspects and problems of the Biotechnological use of Macromolecules
From Sticky Mucus to Probing our Past: Aspects and problems of the Biotechnological use of Macromolecules DNA natures most important glycoconjugate DNA natures most important glycoconjugate High molecular
Developing Conclusions About Different Modes of Inheritance
Pedigree Analysis Introduction A pedigree is a diagram of family relationships that uses symbols to represent people and lines to represent genetic relationships. These diagrams make it easier to visualize
Need a little help with the lab?
Need a little help with the lab? Alleles are corresponding pairs of genes located on an individual s chromosomes. Together, alleles determine the genotype of an individual. The Genotype describes the specific
Assessment of alternative genotyping strategies to maximize imputation accuracy at minimal cost
Huang et al. Genetics Selection Evolution 2012, 44:25 Genetics Selection Evolution RESEARCH Open Access Assessment of alternative genotyping strategies to maximize imputation accuracy at minimal cost Yijian
ISO/TC 23/SC 19/WG 3 N 646
ISO/TC 23/SC 19/WG 3 N 646 ISO/TC 23/SC 19/WG 3 Identification Email of secretary: ima-wageningen@hetnet.nl Convenorship: NEN (Netherlands) N646 WG3 Guidelines ADDITIONAL TECHNOLOGY Document type: Other
Genetic Identity and
Genetic Identity and GACATGTAGCTCTTCACTTCACCCAGGTTGGGTTGTGTCAACAGGAAACATTGTAACATATCACTTGGATTAGCACCTAGG/TTAT/TTAT/TTA Community DTC Genetic Testing Workshop The National Academies' August 31 September 1,
Puzzling Pedigrees. Essential Question: How can pedigrees be used to study the inheritance of human traits?
Name: Puzzling Pedigrees Essential Question: How can pedigrees be used to study the inheritance of human traits? Studying inheritance in humans is more difficult than studying inheritance in fruit flies
Walter Steets Houston Genealogical Forum DNA Interest Group April 7, 2018
Ancestry DNA and GEDmatch Walter Steets Houston Genealogical Forum DNA Interest Group April 7, 2018 Today s agenda Recent News about DNA Testing DNA Cautions: DNA Data Used for Forensic Purposes New Technology:
How to Accurately Select for Alpacas with High Breeding Value: Pedigree, Phenotypic Performance, or Progeny Test. By Mike Safley
How to Accurately Select for Alpacas with High Breeding Value: Pedigree, Phenotypic Performance, or Progeny Test By Mike Safley The Fetish of the Pedigree: Until disillusionment dawned, the belief in the
CowView The smart way of mobile herd managing.
CowView CowView The smart way of mobile herd managing. engineering for a better world GEA Farm Technologies CowView, the handy management tool. Dairy herds are getting bigger and milk yield is increasing.
Impact of inbreeding Managing a declining Holstein gene pool Dr. Filippo Miglior R&D Coordinator, CDN, Guelph, Canada
Impact of inbreeding Managing a declining Holstein gene pool Dr. Filippo Miglior R&D Coordinator, CDN, Guelph, Canada In dairy cattle populations, genetic gains through selection have occurred, largely
Pizza and Who do you think you are?
Pizza and Who do you think you are? an overview of one of the newest and possibly more helpful developments in researching genealogy and family history that of using DNA for research What is DNA? Part
50/50. Accreditations 4/13/2016 A B A B A B. Mother. Father. Child. Everything you ever wanted to know about DNA collections and MORE!
Everything you ever wanted to know about DNA collections and MORE! Presented by: Kim Levaggi Accreditations 1 50/50 Half of your DNA comes from your mother Half of your DNA comes from your father Mother
4/13/2016. Everything you ever wanted to know about DNA collections and MORE! Presented by: Kim Levaggi
Everything you ever wanted to know about DNA collections and MORE! Presented by: Kim Levaggi 1 Accreditations 1 2 50/50 Half of your DNA comes from your mother Half of your DNA comes from your father Mother
Genetic management without pedigree: effectiveness of a breeding circle in a rare sheep breed
Genetic management without pedigree: effectiveness of a breeding circle in a rare sheep breed Jack J. Windig, Marjolein Verweij, Kor Oldenbroek EAAP 2016 Rare breeds Numerically small (especially males)
ABC Pastoral Company ABC Pastoral
Analysis for Herd: ABC ABC Pastoral Company ABC Pastoral Utilising BREEDPLAN EBVs from : The Angus Society Of Australia November 2012 Angus Australia BREEDPLAN MateSel parameter file : SPRING/SUMMER 2012
Beef Breeding Record Book : Extension Circular
University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Nebraska 4-H Clubs: Historical Materials and Publications 4-H Youth Development 1955 Beef Breeding Record Book : Extension
Computer programs for genealogy- a comparison of useful and frequently used features- presented by Gary Warner, SGGEE database manager.
SGGEE Society for German Genealogy in Eastern Europe A Polish and Volhynian Genealogy Group Calgary, Alberta Computer programs for genealogy- a comparison of useful and frequently used features- presented
July 12, so it includes. below. 4. Import File). You. will need to. Page 1
July 12, 2012 How to trim the database you send to SGGEE using Legacy genealogy software so it includes only the Germans in your database 1. Print your pedigree chart from your existing genealogy program.
Using Pedigrees to interpret Mode of Inheritance
Using Pedigrees to interpret Mode of Inheritance Objectives Use a pedigree to interpret the mode of inheritance the given trait is with 90% accuracy. 11.2 Pedigrees (It s in your genes) Pedigree Charts
VIPER: a visualisation tool for exploring inheritance inconsistencies in genotyped pedigrees
RESEARCH Open Access VIPER: a visualisation tool for exploring inheritance inconsistencies in genotyped pedigrees Trevor Paterson 1*, Martin Graham 2, Jessie Kennedy 2, Andy Law 1 From 1st IEEE Symposium
Illumina GenomeStudio Analysis
Illumina GenomeStudio Analysis Paris Veltsos University of St Andrews February 23, 2012 1 Introduction GenomeStudio is software by Illumina used to score SNPs based on the Illumina BeadExpress platform.
DNA Parentage Test No Summary Report
Collaborative Testing Services, Inc FORENSIC TESTING PROGRAM DNA Parentage Test No. 16-5870 Summary Report This proficiency test was sent to 27 participants. Each participant received a sample pack consisting
Recent Results from the Jackson Brigade DNA Project
Recent Results from the Jackson Brigade DNA Project Dr. Daniel C. Hyde Professor Emeritus of Computer Science Bucknell University Lewisburg, PA Presented at Jackson Brigade Reunion, Horner, WV on August
Comparison of genetic diversity in dual-purpose and beef Pinzgau populations
Original Paper Comparison of genetic diversity in dual-purpose and beef Pinzgau populations Ivan Pavlík*, Ondrej Kadlečík, Radovan Kasarda, Veronika Šidlová, Július Žitný Slovak University of Agriculture
HOLDING REGISTER. Address of Holding. CPH Number. Flock / Herd Number (Of this CPH) Species (Sheep or Goats) Type of Production (e.g.
Address Holding HOLDING REGISTER CPH Flock / Herd (Of this CPH) Species (Sheep or Goats) Type Production ( milk, meat) Name Registered Keeper Address Keeper (if different above) Notes for Guidance Further
NORDISKA KOMMISSIONEN FÖR GEODESI
NORDISKA KOMMISSIONEN FÖR GEODESI Ordförande BJøRN ENGEN Statens Kartverk Kartverksvn 21 N-3500 Hønefoss NORGE Sekreterare BO JONSSON Lantmäteriverket LF-Geodesi SE-801 82 Gävle SVERIGE The NKG Steering
Inbreeding Levels and Pedigree Structure of Landrace, Yorkshire and Duroc Populations of Major Swine Breeding Farms in Republic of Korea
1217 Asian-Aust. J. Anim. Sci. Vol. 19, No. 9 : 1217-1224 September 6 www.ajas.info Inbreeding Levels and Pedigree Structure of Landrace, Yorkshire and Duroc Populations of Major Swine Breeding arms in
Cattle Pedigree Chart
Cattle Free PDF ebook Download: Cattle Download or Read Online ebook cattle pedigree chart in PDF Format From The Best User Guide Database Food Science & Veterinary Medicine UCD, Belfield, Dublin 4, Ireland;
Bias and Power in the Estimation of a Maternal Family Variance Component in the Presence of Incomplete and Incorrect Pedigree Information
J. Dairy Sci. 84:944 950 American Dairy Science Association, 2001. Bias and Power in the Estimation of a Maternal Family Variance Component in the Presence of Incomplete and Incorrect Pedigree Information
Wilsons Gina. Wilsons Gina
Line Name Details Original Line Name Unknown origin Rona This lines shows with LOA Rona (NZ 2024) bred by Katie Rigby. The line dead ends simply stating it goes back to Kaigoose Stock but, does not list
AGENCOURT GENFIND Blood & Serum Genomic DNA Isolation Kit
Blood & Serum Genomic DNA Isolation Kit Page 1 of 9 Please refer to http://www.agencourt.com/technical for updated protocols and refer to MSDS instructions when handling or shipping any chemical hazards.
Walter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018
DNA, Ancestry, and Your Genealogical Research- Segments and centimorgans Walter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018 1 Today s agenda Brief review of previous DIG session
Technical Note. How to Use the Image Studio Software Western and MPX Western Analyses. Developed for: Image Studio Software
Technical Note How to Use the Image Studio Software Western and MPX Western Analyses Developed for: Image Studio Software Please refer to your manual to confirm that this protocol is appropriate for the
Inbreeding and self-fertilization
Inbreeding and self-fertilization Introduction Remember that long list of assumptions associated with derivation of the Hardy-Weinberg principle that we just finished? Well, we re about to begin violating
Primer on Human Pedigree Analysis:
Primer on Human Pedigree Analysis: Criteria for the selection and collection of appropriate Family Reference Samples John V. Planz. Ph.D. UNT Center for Human Identification Successful Missing Person ID
A general quadratic programming method for the optimisation of genetic contributions using interior point algorithm. R Pong-Wong & JA Woolliams
A general quadratic programming method for the optimisation of genetic contributions using interior point algorithm R Pong-Wong & JA Woolliams Introduction Inbreeding is a risk and it needs to be controlled
Package pedigreemm. R topics documented: February 20, 2015
Version 0.3-3 Date 2013-09-27 Title Pedigree-based mixed-effects models Author Douglas Bates and Ana Ines Vazquez, Package pedigreemm February 20, 2015 Maintainer Ana Ines Vazquez
TDT vignette Use of snpstats in family based studies
TDT vignette Use of snpstats in family based studies David Clayton April 30, 2018 Pedigree data The snpstats package contains some tools for analysis of family-based studies. These assume that a subject
Steve Harding, *Turi King and *Mark Jobling Universities of Nottingham & *Leicester, UK
Viking DNA Steve Harding, *Turi King and *Mark Jobling Universities of Nottingham & *Leicester, UK Viking DNA in Northern England Project Part 1 - Wirral and West Lancashire (2002-2007) Part 2 - North
Mehdi Sargolzaei L Alliance Boviteq, St-Hyacinthe, QC, Canada and CGIL, University of Guelph, Guelph, ON, Canada. Summary
An Additive Relationship Matrix for the Sex Chromosomes 2013 ELARES:50 Mehdi Sargolzaei L Alliance Boviteq, St-Hyacinthe, QC, Canada and CGIL, University of Guelph, Guelph, ON, Canada Larry Schaeffer CGIL,
DNA extraction Protocol for Agencourt Genfind v2 Blood and Serum Genomic DNA Isolation Kit
DNA extraction Protocol for Agencourt Genfind v2 Blood and Serum Genomic DNA Isolation Kit Introduction The Agencourt Genfind v2 Blood & Serum DNA Isolation Kit utilizes Agencourt s patented SPRI paramagnetic
Population Management User,s Manual
Population Management 2000 User,s Manual PM2000 version 1.163 14 July 2002 Robert C. Lacy Chicago Zoological Society Jonathan D. Ballou National Zoological Park Smithsonian Institution Software developed
Inbreeding and self-fertilization
Inbreeding and self-fertilization Introduction Remember that long list of assumptions associated with derivation of the Hardy-Weinberg principle that I went over a couple of lectures ago? Well, we re about
ICAR relations to ISO
ICAR relations to ISO Since many years ICAR has an official liaison to ISO TC23/ SC19 as an organization that makes an effective contribution to the work of the technical committee or subcommittee. Until
Every human cell (except red blood cells and sperm and eggs) has an. identical set of 23 pairs of chromosomes which carry all the hereditary
Introduction to Genetic Genealogy Every human cell (except red blood cells and sperm and eggs) has an identical set of 23 pairs of chromosomes which carry all the hereditary information that is passed
EU Ecolabel EMAS Environmental Technology Verification (ETV) State-of-play and evaluations
EU Ecolabel EMAS Environmental Technology Verification (ETV) State-of-play and evaluations Pierre Henry DG Environment B1 3 instruments of Circular Economy action plan Improving the efficiency and uptake
Factors affecting phasing quality in a commercial layer population
Factors affecting phasing quality in a commercial layer population N. Frioni 1, D. Cavero 2, H. Simianer 1 & M. Erbe 3 1 University of Goettingen, Department of nimal Sciences, Center for Integrated Breeding
Pedigree analysis and estimation of inbreeding effects on calving traits in an organized performance test for functional traits
Agrar- und Ernährungswissenschaftliche Fakultät an-albrechts-universität zu Kiel Institut für Tierzucht und Tierhaltung Pedigree analysis and estimation of inbreeding effects on calving traits in an organized
Walter Steets Houston Genealogical Forum DNA Interest Group February 24, 2018
Using Ancestry DNA and Third-Party Tools to Research Your Shared DNA Segments Part 2 Walter Steets Houston Genealogical Forum DNA Interest Group February 24, 2018 1 Today s agenda Brief review of previous
Finally, should you have any questions, queries or issues with regard to the service our company provides, us at
Dear Sir / Madam, To complete the enclosed registration form, please follow the procedure below: 1. Choose a sampler. To comply with current legislation, samples must be taken by a medically qualified
1 Setting up drafting
The Drafting (Sorting) feature in the 5000 series weigh scale indicator allows animals to be sorted by weight, weight gain or other advanced criteria. This is a powerful feature that allows you to quickly
Parentage analysis. Every person receives a unique set of genetic information from their parents - half from Mom and half from Dad
Parentage analysis Similar techniques as those used in human parentage testing! With 99.99% probability, you ARE the father Every person receives a unique set of genetic information from their parents
GENEALOGICAL ANALYSIS IN SMALL POPULATIONS: THE CASE OF FOUR SLOVAK BEEF CATTLE BREEDS
2012 CVŽV ISSN 1337-9984 GENEALOGICAL ANALYSIS IN SMALL POPULATIONS: THE CASE OF FOUR SLOVAK BEEF CATTLE BREEDS O. KADLEČÍK*, I. PAVLÍK Slovak University of Agriculture, Nitra, Slovak Republic ABSTRACT
Electronic ID for Inventory
Electronic ID for Inventory Status Report as of Dec 6, 2012 Luke Engelbert-Fenton C. Melissa Vetterling Justin Fritzler (Sp 2013) Advisor: Dr. Ali Pezeshki I : Overview II Details III IV Time Frame V Questions
23 March I will try and summarize the Y-DNA male line test results for both of you and the other members of the Stubbs DNA Project:
23 March 2019 Hello Irving and Rodney, I would like to share with you my thoughts regarding the recent DNA testing both of you in the Big Y program. I am therefore including both of you in this message.
Copy number variations and quantitative trait loci in South African Brahman cattle
Copy number variations and quantitative trait loci in South African Brahman cattle M.D. Wang 1, F.C. Muchadeyi 2, M. Makgahela 1,3, S. Mdyogolo 1 & A. Maiwashe 1,3 1 Agriculture Research Council-Animal
Genome-Wide Association Exercise - Data Quality Control
Genome-Wide Association Exercise - Data Quality Control The Rockefeller University, New York, June 25, 2016 Copyright 2016 Merry-Lynn McDonald & Suzanne M. Leal Introduction In this exercise, you will
APPLICATION FOR ENROLLMENT
CTGR-9615 Grand Ronde Rd.; Grand Ronde OR 97347 1-800-422-0232 ext.2253 APPLICATION FOR ENROLLMENT Name: First Middle Last Maiden Gender Female. Male Date of Birth Social security Number Address: Mailing
Genetic diversity and population structure of American Red Angus cattle 1
Published December 4, 2014 Genetic diversity and population structure of American Red Angus cattle 1 G. C. Márquez,* S. E. Speidel,* R. M. Enns,* and D. J. Garrick 2 *Department of Animal Sciences, Colorado
Methods of Parentage Analysis in Natural Populations
Methods of Parentage Analysis in Natural Populations Using molecular markers, estimates of genetic maternity or paternity can be achieved by excluding as parents all adults whose genotypes are incompatible
Genetic Research in Utah
Genetic Research in Utah Lisa Cannon Albright, PhD Professor, Program Leader Genetic Epidemiology Department of Internal Medicine University of Utah School of Medicine George E. Wahlen Department of Veterans
Chapter 6 EXPERIMENTAL VERIFICATION
Qiang Lu Chapter 6. Experimental Verification 173 Chapter 6 EXPERIMENTAL VERIFICATION To verify the capabilities and to study the limitations of the image processing modules, experiments were performed
DAR POLICY STATEMENT AND BACKGROUND Using DNA Evidence for DAR Applications
Effective January 1, 2014, DAR will begin accepting Y-DNA evidence in support of new member applications and supplemental applications as one element in a structured analysis. This analysis will use a
The Pedigree. NOTE: there are no definite conclusions that can be made from a pedigree. However, there are more likely and less likely explanations
The Pedigree A tool (diagram) used to trace traits in a family The diagram shows the history of a trait between generations Designed to show inherited phenotypes Using logic we can deduce the inherited
Your mtdna Full Sequence Results
Congratulations! You are one of the first to have your entire mitochondrial DNA (DNA) sequenced! Testing the full sequence has already become the standard practice used by researchers studying the DNA,
Pedigree Reconstruction using Identity by Descent
Pedigree Reconstruction using Identity by Descent Bonnie Kirkpatrick Electrical Engineering and Computer Sciences University of California at Berkeley Technical Report No. UCB/EECS-2010-43 http://www.eecs.berkeley.edu/pubs/techrpts/2010/eecs-2010-43.html
Click here to give us your feedback. New FamilySearch Reference Manual
Click here to give us your feedback. New FamilySearch Reference Manual January 25, 2011 2009 by Intellectual Reserve, Inc. All rights reserved Printed in the United States of America English approval:
Y-DNA Genetic Testing
Y-DNA Genetic Testing 50 2/24/14 Y-DNA Genetic Testing Y-DNA flows from fathers to sons intact SNPs define Y-DNA haplogroups Haplogroups (clans) migrated together Timeframe between mutations is 2,000 to
Population Patterns. Math 6.SP.B.4 6.SP.B.5 6.SP.B.5a 6.SP.B.5b 7.SP.B.3 7.SP.A.2 8.SP.A.1. Time: 45 minutes. Grade Level: 3rd to 8th
Common Core Standards Math 6.SP.B.4 6.SP.B.5 6.SP.B.5a 6.SP.B.5b 7.SP.B.3 7.SP.A.2 8.SP.A.1 Vocabulary Population carrying capacity predator-prey relationship habitat Summary: Students are introduced to
Development Team. Importance and Implications of Pedigree and Genealogy. Anthropology. Principal Investigator. Paper Coordinator.
Paper No. : 13 Research Methods and Fieldwork Module : 10 Development Team Principal Investigator Prof. Anup Kumar Kapoor Department of, University of Delhi Paper Coordinator Dr. P. Venkatramana Faculty
Find JCD Project Date: Identification-DNA Process Updated:
New Look Investigations Created by: Jack Friess Find JCD Project Date: 04-20-2018 Identification-DNA Process Updated: 05-24-2018 Questions and Answers Identification-DNA (ID-DNA) is a scientific process
Holden. Herefords. 53 rd. Annual Production Sale HH ADVANCE 8010F ET
Herefords www.holdenherefords.com 53 rd Holden Annual Production Sale HH ADVANCE 8010F ET Monday, March 11, 2019 Absentee Bidding View Holden Hereford s Sale Live on Satellite TV with Superior HERE S HOW
Walter Steets Houston Genealogical Forum DNA Interest Group May 5, 2018
GEDmatch: The Golden State Killer Tier 1 Tools Walter Steets Houston Genealogical Forum DNA Interest Group May 5, 2018 1 Today s agenda Walter s Take on DNA Developments Growth in Number of DNA Testers
CircumSpect TM 360 Degree Label Verification and Inspection Technology
CircumSpect TM 360 Degree Label Verification and Inspection Technology Written by: 7 Old Towne Way Sturbridge, MA 01518 Contact: Joe Gugliotti Cell: 978-551-4160 Fax: 508-347-1355 jgugliotti@machinevc.com
Pedigree analysis on the population of Gir cattle in Northeast Brazil
Revista Brasileira de Zootecnia 2012 Sociedade Brasileira de Zootecnia ISSN 1806-9290 www.sbz.org.br Pedigree analysis on the population of Gir cattle in Northeast Brazil Aracele Prates de Oliveira 1,