Diet Networks: Thin Parameters for Fat Genomics
|
|
- Kristian Baldwin
- 5 years ago
- Views:
Transcription
1 Institut des algorithmes d apprentissage de Montréal Diet Networks: Thin Parameters for Fat Genomics Adriana Romero, Pierre Luc Carrier, Akram Erraqabi, Tristan Sylvain, Alex Auvolat, Etienne Dejoie, Marc-André Legault, Marie-Pierre Dubé, Julie G. Hussin, Yoshua Bengio
2 Outline Motivation & Challenges Deep Learning Architectures Diet Networks Results Wrap up and future research directions
3 Motivation & Challenges
4 Motivation Deep Learning Zhou et al., 2015 from from
5 Motivation Deep Learning Genomics from from from
6 Genomic Data as Fat Data Target millions of simple variants across the genome (SNPs). Number of participants limited, even for large datasets. # participants (samples) # SNP (features) Fat Data Dire imbalance between # samples and # input features
7 Challenges: Parameter explosion Linear classifier: Naive setup for SNP data: W (parameters) # inputs = hundreds of thousands # samples = thousands # samples << # parameters In deep networks: the # parameters in the 1st layer grows linearly with the # inputs. # inputs = # parameters
8 Challenges: Overfitting from
9 Challenges: The curse of dimensionality Considering: - 300K SNPs - 3 possible values (0, 1, 2) from K combinations!!
10 Why deep learning? Capturing information directly from the raw input data is not trivial and often involves complex and non-linear functions. Many problems become easier if the input data is transformed into a representation that emphasizes its most relevant characteristics.
11 Multi-Layer Perceptron (MLP) Supervised learning: desired output values are provided Describe data as a hierarchy of concepts Unsupervised learning: aims to discover hidden structure in the input data.
12 CNN - reducing the number of parameters Parameter sharing. Exploit spatially local correlations. Suitable for data with a grid-like topology. Problem: When the full DNA sequence is unavailable, other type of methods seem more appropriate.
13 Diet Networks
14 The idea Use a novel neural network reparametrization, which considerably reduces the number of free parameters when the input is very high-dimensional and orders of magnitude larger than the number of training samples.
15 The model Input data: Fx100 NxF, N << F 100 MLP MLP MLP 50K 500 MLP 100 Emb. Emb. Fx100 30M 300K Input = 1 sample 1xF Input = 1 feature (SNP) 1xN
16 Embeddings Raw (learnt embedding, end to end training) MLP MLP Per class histograms MLP Emb.
17 Per class histogram Individuals Class 1: 1 x 0, 2 x 1, 1 x SNPs Class 2: 3 x 0, 0 x 1, 1 x
18 The 1000 Genomes Project (1) Large-scale comparison of DNA sequences from populations, thanks to the presence of genetic variations. Represents 26 populations from 5 geographical regions, in total 3,450 individuals SNP inclusion/exclusion criteria: Genetic variants with frequencies of at least 5% Excluded SNPs positioned on sex chromosomes Only included SNPs in approximate linkage equilibrium with each other As a result, we obtained 315,345 SNPs, encoded as having 0, 1 or 2 copies of a genetic mutation (non-reference nucleotide).
19 Experimental setup Ethnicity prediction from SNPs on 1000 Genomes data. Metric: misclassification error and number of free parameters. 5-fold crossvalidation.
20 Quantitive results (1) Embedding Misclassification error (%) # free parameters Without reconstruction Basic MLP M Diet Networks (raw end2end) k Diet Networks (histograms) k With reconstruction Basic MLP M Diet Networks (raw end2end) k Diet Networks (histograms) k
21 Quantitive results (2) Embedding Misclassification error (%) Diet Networks (histograms) PCA (10 PCs) PCA (50 PCs) PCA (100 PCs) PCA (200 PCs)
22 Quantitive results (3)
23 What is the network learning? Layer 2 MLP Layer 1 MLP Input
24 What is the network learning? Raw input Layer 1 Layer 2 Ethnicities
25 What is the network learning? Raw input Layer 1 Layer 2 Continents
26 Wrap up and future research directions
27 Wrap up We demonstrated the potential of deep learning models to tackle genomicspecific tasks. The parameter explosion introduced by high dimensional genomic data can be mitigated by smart model parameterization, such as Diet Networks.
28 What comes next Conducting genetic association studies, with emphasis on population-aware analyses of SNP data in disease cohorts. Identify the genetic basis of common diseases to achieve a better patient risk prediction and improve our overall understanding of disease etiology.
29 Institut des algorithmes d apprentissage de Montréal Diet Networks: Thin Parameters for Fat Genomics Adriana Romero, Pierre Luc Carrier, Akram Erraqabi, Tristan Sylvain, Alex Auvolat, Etienne Dejoie, Marc-André Legault, Marie-Pierre Dubé, Julie G. Hussin, Yoshua Bengio Thank Code:
Artificial Intelligence and Deep Learning
Artificial Intelligence and Deep Learning Cars are now driving themselves (far from perfectly, though) Speaking to a Bot is No Longer Unusual March 2016: World Go Champion Beaten by Machine AI: The Upcoming
More informationEvolutionary Artificial Neural Networks For Medical Data Classification
Evolutionary Artificial Neural Networks For Medical Data Classification GRADUATE PROJECT Submitted to the Faculty of the Department of Computing Sciences Texas A&M University-Corpus Christi Corpus Christi,
More informationLASER server: ancestry tracing with genotypes or sequence reads
LASER server: ancestry tracing with genotypes or sequence reads The LASER method Supplementary Data For each ancestry reference panel of N individuals, LASER applies principal components analysis (PCA)
More informationAttention-based Multi-Encoder-Decoder Recurrent Neural Networks
Attention-based Multi-Encoder-Decoder Recurrent Neural Networks Stephan Baier 1, Sigurd Spieckermann 2 and Volker Tresp 1,2 1- Ludwig Maximilian University Oettingenstr. 67, Munich, Germany 2- Siemens
More informationIntroduction to Machine Learning
Introduction to Machine Learning Deep Learning Barnabás Póczos Credits Many of the pictures, results, and other materials are taken from: Ruslan Salakhutdinov Joshua Bengio Geoffrey Hinton Yann LeCun 2
More informationLecture 1: Introduction to pedigree analysis
Lecture 1: Introduction to pedigree analysis Magnus Dehli Vigeland NORBIS course, 8 th 12 th of January 2018, Oslo Outline Part I: Brief introductions Pedigrees symbols and terminology Some common relationships
More informationTRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter
TRACK 1: BEGINNING DNA RESEARCH presented by Andy Hochreiter 1-1: DNA: WHERE DO I START? Definition Genetic genealogy is the application of genetics to traditional genealogy. Genetic genealogy uses genealogical
More informationA Diagnostic Technique for Multilevel Inverters Based on a Genetic-Algorithm to Select a Principal Component Neural Network
A Diagnostic Technique for Multilevel Inverters Based on a Genetic-Algorithm to Select a Principal Component Neural Network Surin Khomfoi, Leon M. Tolbert The University of Tennessee Electrical and Computer
More informationDYNAMIC CONVOLUTIONAL NEURAL NETWORK FOR IMAGE SUPER- RESOLUTION
Journal of Advanced College of Engineering and Management, Vol. 3, 2017 DYNAMIC CONVOLUTIONAL NEURAL NETWORK FOR IMAGE SUPER- RESOLUTION Anil Bhujel 1, Dibakar Raj Pant 2 1 Ministry of Information and
More informationUSING SIMPLE PID CONTROLLERS TO PREVENT AND MITIGATE FAULTS IN SCIENTIFIC WORKFLOWS
USING SIMPLE PID CONTROLLERS TO PREVENT AND MITIGATE FAULTS IN SCIENTIFIC WORKFLOWS Rafael Ferreira da Silva 1, Rosa Filgueira 2, Ewa Deelman 1, Erola Pairo-Castineira 3, Ian Michael Overton 4, Malcolm
More informationWorkshop on anonymization Berlin, March 19, Basic Knowledge Terms, Definitions and general techniques. Murat Sariyar TMF
Workshop on anonymization Berlin, March 19, 2015 Basic Knowledge Terms, Definitions and general techniques Murat Sariyar TMF Workshop Anonymisation, March 19, 2015 Outline Background Aims of Anonymization
More informationBig Y-700 White Paper
Big Y-700 White Paper Powering discovery in the field of paternal ancestry Authors: Caleb Davis, Michael Sager, Göran Runfeldt, Elliott Greenspan, Arjan Bormans, Bennett Greenspan, and Connie Bormans Last
More informationSupervisors: Rachel Cardell-Oliver Adrian Keating. Program: Bachelor of Computer Science (Honours) Program Dates: Semester 2, 2014 Semester 1, 2015
Supervisors: Rachel Cardell-Oliver Adrian Keating Program: Bachelor of Computer Science (Honours) Program Dates: Semester 2, 2014 Semester 1, 2015 Background Aging population [ABS2012, CCE09] Need to
More informationFigure S5 PCA of individuals run on the EAS array reporting Pacific Islander ethnicity, including those reporting another ethnicity.
Figure S1 PCA of European and West Asian subjects on the EUR array. A clear Ashkenazi cluster is observed. The largest cluster depicts the northwest southeast cline within Europe. A Those reporting a single
More informationCONVOLUTIONAL NEURAL NETWORKS: MOTIVATION, CONVOLUTION OPERATION, ALEXNET
CONVOLUTIONAL NEURAL NETWORKS: MOTIVATION, CONVOLUTION OPERATION, ALEXNET MOTIVATION Fully connected neural network Example 1000x1000 image 1M hidden units 10 12 (= 10 6 10 6 ) parameters! Observation
More informationLandmark Recognition with Deep Learning
Landmark Recognition with Deep Learning PROJECT LABORATORY submitted by Filippo Galli NEUROSCIENTIFIC SYSTEM THEORY Technische Universität München Prof. Dr Jörg Conradt Supervisor: Marcello Mulas, PhD
More informationTHE BASICS OF DNA TESTING. By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library
THE BASICS OF DNA TESTING By Jill Garrison, Genealogy Coordinator Frankfort Community Public Library TYPES OF TESTS Mitochondrial DNA (mtdna/mdna) Y-DNA Autosomal DNA (atdna/audna) MITOCHONDRIAL DNA Found
More informationLearning Deep Networks from Noisy Labels with Dropout Regularization
Learning Deep Networks from Noisy Labels with Dropout Regularization Ishan Jindal*, Matthew Nokleby*, Xuewen Chen** *Department of Electrical and Computer Engineering **Department of Computer Science Wayne
More informationUsing Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM
Using Autosomal DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.
More informationClassification Accuracies of Malaria Infected Cells Using Deep Convolutional Neural Networks Based on Decompressed Images
Classification Accuracies of Malaria Infected Cells Using Deep Convolutional Neural Networks Based on Decompressed Images Yuhang Dong, Zhuocheng Jiang, Hongda Shen, W. David Pan Dept. of Electrical & Computer
More informationTiny ImageNet Challenge Investigating the Scaling of Inception Layers for Reduced Scale Classification Problems
Tiny ImageNet Challenge Investigating the Scaling of Inception Layers for Reduced Scale Classification Problems Emeric Stéphane Boigné eboigne@stanford.edu Jan Felix Heyse heyse@stanford.edu Abstract Scaling
More informationEnhancing Symmetry in GAN Generated Fashion Images
Enhancing Symmetry in GAN Generated Fashion Images Vishnu Makkapati 1 and Arun Patro 2 1 Myntra Designs Pvt. Ltd., Bengaluru - 560068, India vishnu.makkapati@myntra.com 2 Department of Electrical Engineering,
More informationIJITKMI Volume 7 Number 2 Jan June 2014 pp (ISSN ) Impact of attribute selection on the accuracy of Multilayer Perceptron
Impact of attribute selection on the accuracy of Multilayer Perceptron Niket Kumar Choudhary 1, Yogita Shinde 2, Rajeswari Kannan 3, Vaithiyanathan Venkatraman 4 1,2 Dept. of Computer Engineering, Pimpri-Chinchwad
More informationGenerating Groove: Predicting Jazz Harmonization
Generating Groove: Predicting Jazz Harmonization Nicholas Bien (nbien@stanford.edu) Lincoln Valdez (lincolnv@stanford.edu) December 15, 2017 1 Background We aim to generate an appropriate jazz chord progression
More informationSonia Sharma ECE Department, University Institute of Engineering and Technology, MDU, Rohtak, India. Fig.1.Neuron and its connection
NEUROCOMPUTATION FOR MICROSTRIP ANTENNA Sonia Sharma ECE Department, University Institute of Engineering and Technology, MDU, Rohtak, India Abstract: A Neural Network is a powerful computational tool that
More informationAncestral Recombination Graphs
Ancestral Recombination Graphs Ancestral relationships among a sample of recombining sequences usually cannot be accurately described by just a single genealogy. Linked sites will have similar, but not
More informationRoadmap for machine learning
Roadmap f machine learning Description and state of the art Definition Machine learning is a term that refers to a set of technologies that evolved from the study of pattern recognition and computational
More informationConvolutional neural networks
Convolutional neural networks Themes Curriculum: Ch 9.1, 9.2 and http://cs231n.github.io/convolutionalnetworks/ The simple motivation and idea How it s done Receptive field Pooling Dilated convolutions
More informationWalter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018
DNA, Ancestry, and Your Genealogical Research- Segments and centimorgans Walter Steets Houston Genealogical Forum DNA Interest Group January 6, 2018 1 Today s agenda Brief review of previous DIG session
More informationPartial Discharge Classification Using Novel Parameters and a Combined PCA and MLP Technique
Partial Discharge Classification Using Novel Parameters and a Combined PCA and MLP Technique C. Chang and Q. Su Center for Electrical Power Engineering Monash University, Clayton VIC 3168 Australia Abstract:
More informationVesselin K. Vassilev South Bank University London Dominic Job Napier University Edinburgh Julian F. Miller The University of Birmingham Birmingham
Towards the Automatic Design of More Efficient Digital Circuits Vesselin K. Vassilev South Bank University London Dominic Job Napier University Edinburgh Julian F. Miller The University of Birmingham Birmingham
More informationA Novel Approach of Compressing Images and Assessment on Quality with Scaling Factor
A Novel Approach of Compressing Images and Assessment on Quality with Scaling Factor Umesh 1,Mr. Suraj Rana 2 1 M.Tech Student, 2 Associate Professor (ECE) Department of Electronic and Communication Engineering
More informationCoursework 2. MLP Lecture 7 Convolutional Networks 1
Coursework 2 MLP Lecture 7 Convolutional Networks 1 Coursework 2 - Overview and Objectives Overview: Use a selection of the techniques covered in the course so far to train accurate multi-layer networks
More informationConstructing local discriminative features for signal classification
Constructing local discriminative features for signal classification Local features for signal classification Outline Motivations Problem formulation Lifting scheme Local features Conclusions Toy example
More informationDNA and Ancestry. An Update on New Tests. Steve Louis. Jewish Genealogical Society of Washington State. January 13, 2014
DNA and Ancestry An Update on New Tests Steve Louis Jewish Genealogical Society of Washington State January 13, 2014 DISCLAIMER This document was prepared as a result of independent work and opinions of
More informationOn the Use of Convolutional Neural Networks for Specific Emitter Identification
On the Use of Convolutional Neural Networks for Specific Emitter Identification Lauren Joy Wong Thesis submitted to the Faculty of the Virginia Polytechnic Institute and State University in partial fulfillment
More informationFairfield Public Schools Science Curriculum. Draft Forensics I: Never Gone Without a Trace Forensics II: You Can t Fake the Prints.
Fairfield Public Schools Science Curriculum Draft Forensics I: Never Gone Without a Trace Forensics II: You Can t Fake the Prints March 12, 2018 Forensics I and Forensics II: Description Forensics I: Never
More informationCLASSLESS ASSOCIATION USING NEURAL NETWORKS
Workshop track - ICLR 1 CLASSLESS ASSOCIATION USING NEURAL NETWORKS Federico Raue 1,, Sebastian Palacio, Andreas Dengel 1,, Marcus Liwicki 1 1 University of Kaiserslautern, Germany German Research Center
More informationAI for Autonomous Ships Challenges in Design and Validation
VTT TECHNICAL RESEARCH CENTRE OF FINLAND LTD AI for Autonomous Ships Challenges in Design and Validation ISSAV 2018 Eetu Heikkilä Autonomous ships - activities in VTT Autonomous ship systems Unmanned engine
More informationConvNets and Forward Modeling for StarCraft AI
ConvNets and Forward Modeling for StarCraft AI Alex Auvolat September 15, 2016 ConvNets and Forward Modeling for StarCraft AI 1 / 20 Overview ConvNets and Forward Modeling for StarCraft AI 2 / 20 Section
More informationAttention-based Information Fusion using Multi-Encoder-Decoder Recurrent Neural Networks
Attention-based Information Fusion using Multi-Encoder-Decoder Recurrent Neural Networks Stephan Baier1, Sigurd Spieckermann2 and Volker Tresp1,2 1- Ludwig Maximilian University Oettingenstr. 67, Munich,
More informationSupervised Versus Unsupervised Binary-Learning by Feedforward Neural Networks
Machine Learning, 42, 97 122, 2001 c 2001 Kluwer Academic Publishers. Manufactured in The Netherlands. Supervised Versus Unsupervised Binary-Learning by Feedforward Neural Networks NATHALIE JAPKOWICZ nat@site.uottawa.ca
More informationMachine Learning for Antenna Array Failure Analysis
Machine Learning for Antenna Array Failure Analysis Lydia de Lange Under Dr DJ Ludick and Dr TL Grobler Dept. Electrical and Electronic Engineering, Stellenbosch University MML 2019 Outline 15/03/2019
More informationAugmenting Self-Learning In Chess Through Expert Imitation
Augmenting Self-Learning In Chess Through Expert Imitation Michael Xie Department of Computer Science Stanford University Stanford, CA 94305 xie@cs.stanford.edu Gene Lewis Department of Computer Science
More informationStacking Ensemble for auto ml
Stacking Ensemble for auto ml Khai T. Ngo Thesis submitted to the Faculty of the Virginia Polytechnic Institute and State University in partial fulfillment of the requirements for the degree of Master
More informationTHE problem of automating the solving of
CS231A FINAL PROJECT, JUNE 2016 1 Solving Large Jigsaw Puzzles L. Dery and C. Fufa Abstract This project attempts to reproduce the genetic algorithm in a paper entitled A Genetic Algorithm-Based Solver
More informationCHAPTER 4 LINK ADAPTATION USING NEURAL NETWORK
CHAPTER 4 LINK ADAPTATION USING NEURAL NETWORK 4.1 INTRODUCTION For accurate system level simulator performance, link level modeling and prediction [103] must be reliable and fast so as to improve the
More informationPopulation Genetics using Trees. Peter Beerli Genome Sciences University of Washington Seattle WA
Population Genetics using Trees Peter Beerli Genome Sciences University of Washington Seattle WA Outline 1. Introduction to the basic coalescent Population models The coalescent Likelihood estimation of
More informationAn Introduction to Machine Learning for Social Scientists
An Introduction to Machine Learning for Social Scientists Tyler Ransom University of Oklahoma, Dept. of Economics November 10, 2017 Outline 1. Intro 2. Examples 3. Conclusion Tyler Ransom (OU Econ) An
More informationRadio Deep Learning Efforts Showcase Presentation
Radio Deep Learning Efforts Showcase Presentation November 2016 hume@vt.edu www.hume.vt.edu Tim O Shea Senior Research Associate Program Overview Program Objective: Rethink fundamental approaches to how
More informationJUMPSTARTING NEURAL NETWORK TRAINING FOR SEISMIC PROBLEMS
JUMPSTARTING NEURAL NETWORK TRAINING FOR SEISMIC PROBLEMS Fantine Huot (Stanford Geophysics) Advised by Greg Beroza & Biondo Biondi (Stanford Geophysics & ICME) LEARNING FROM DATA Deep learning networks
More informationApplication of Multi Layer Perceptron (MLP) for Shower Size Prediction
Chapter 3 Application of Multi Layer Perceptron (MLP) for Shower Size Prediction 3.1 Basic considerations of the ANN Artificial Neural Network (ANN)s are non- parametric prediction tools that can be used
More informationEnhanced MLP Input-Output Mapping for Degraded Pattern Recognition
Enhanced MLP Input-Output Mapping for Degraded Pattern Recognition Shigueo Nomura and José Ricardo Gonçalves Manzan Faculty of Electrical Engineering, Federal University of Uberlândia, Uberlândia, MG,
More informationIBM SPSS Neural Networks
IBM Software IBM SPSS Neural Networks 20 IBM SPSS Neural Networks New tools for building predictive models Highlights Explore subtle or hidden patterns in your data. Build better-performing models No programming
More informationGenerating an appropriate sound for a video using WaveNet.
Australian National University College of Engineering and Computer Science Master of Computing Generating an appropriate sound for a video using WaveNet. COMP 8715 Individual Computing Project Taku Ueki
More informationMINE 432 Industrial Automation and Robotics
MINE 432 Industrial Automation and Robotics Part 3, Lecture 5 Overview of Artificial Neural Networks A. Farzanegan (Visiting Associate Professor) Fall 2014 Norman B. Keevil Institute of Mining Engineering
More informationAvailable online at ScienceDirect. Procedia Technology 18 (2014 )
Available online at www.sciencedirect.com ScienceDirect Procedia Technology 18 (2014 ) 133 139 International workshop on Innovations in Information and Communication Science and Technology, IICST 2014,
More informationCampus Location Recognition using Audio Signals
1 Campus Location Recognition using Audio Signals James Sun,Reid Westwood SUNetID:jsun2015,rwestwoo Email: jsun2015@stanford.edu, rwestwoo@stanford.edu I. INTRODUCTION People use sound both consciously
More informationPrivacy Policy. What is Data Privacy? Privacy Policy. Data Privacy Friend or Foe? Some Positives
Privacy Policy Data Privacy Friend or Foe? Some Limitations Need robust language Need enforcement Scope of world / interaction Syntax, not semantics Bradley Malin, malin@cscmuedu Data Privacy Laboratory,
More informationDNA Testing. February 16, 2018
DNA Testing February 16, 2018 What Is DNA? Double helix ladder structure where the rungs are molecules called nucleotides or bases. DNA contains only four of these nucleotides A, G, C, T The sequence that
More informationNorsk Regnesentral (NR) Norwegian Computing Center
Norsk Regnesentral (NR) Norwegian Computing Center Petter Abrahamsen Joining Forces 2018 www.nr.no NUSSE: - 512 9-digit numbers - 200 additions/second Our latest servers: - Four Titan X GPUs - 14 336 cores
More informationYour mtdna Full Sequence Results
Congratulations! You are one of the first to have your entire mitochondrial DNA (DNA) sequenced! Testing the full sequence has already become the standard practice used by researchers studying the DNA,
More informationNature Genetics: doi: /ng Supplementary Figure 1. Quality control of FALS discovery cohort.
Supplementary Figure 1 Quality control of FALS discovery cohort. Exome sequences were obtained for 1,376 FALS cases and 13,883 controls. Samples were excluded in the event of exome-wide call rate
More informationWheel Health Monitoring Using Onboard Sensors
Wheel Health Monitoring Using Onboard Sensors Brad M. Hopkins, Ph.D. Project Engineer Condition Monitoring Amsted Rail Company, Inc. 1 Agenda 1. Motivation 2. Overview of Methodology 3. Application: Wheel
More informationSSB Debate: Model-based Inference vs. Machine Learning
SSB Debate: Model-based nference vs. Machine Learning June 3, 2018 SSB 2018 June 3, 2018 1 / 20 Machine learning in the biological sciences SSB 2018 June 3, 2018 2 / 20 Machine learning in the biological
More informationHalley Family. Mystery? Mystery? Can you solve a. Can you help solve a
Can you solve a Can you help solve a Halley Halley Family Family Mystery? Mystery? Who was the great grandfather of John Bennett Halley? He lived in Maryland around 1797 and might have been born there.
More informationGenetic Research in Utah
Genetic Research in Utah Lisa Cannon Albright, PhD Professor, Program Leader Genetic Epidemiology Department of Internal Medicine University of Utah School of Medicine George E. Wahlen Department of Veterans
More informationA Machine Learning Based Approach for Predicting Undisclosed Attributes in Social Networks
A Machine Learning Based Approach for Predicting Undisclosed Attributes in Social Networks Gergely Kótyuk Laboratory of Cryptography and Systems Security (CrySyS) Budapest University of Technology and
More informationClassifying the Brain's Motor Activity via Deep Learning
Final Report Classifying the Brain's Motor Activity via Deep Learning Tania Morimoto & Sean Sketch Motivation Over 50 million Americans suffer from mobility or dexterity impairments. Over the past few
More informationLocal Search: Hill Climbing. When A* doesn t work AIMA 4.1. Review: Hill climbing on a surface of states. Review: Local search and optimization
Outline When A* doesn t work AIMA 4.1 Local Search: Hill Climbing Escaping Local Maxima: Simulated Annealing Genetic Algorithms A few slides adapted from CS 471, UBMC and Eric Eaton (in turn, adapted from
More informationAn Investigation of Scalable Anomaly Detection Techniques for a Large Network of Wi-Fi Hotspots
An Investigation of Scalable Anomaly Detection Techniques for a Large Network of Wi-Fi Hotspots Pheeha Machaka 1 and Antoine Bagula 2 1 Council for Scientific and Industrial Research, Modelling and Digital
More informationContents 1 Introduction Optical Character Recognition Systems Soft Computing Techniques for Optical Character Recognition Systems
Contents 1 Introduction.... 1 1.1 Organization of the Monograph.... 1 1.2 Notation.... 3 1.3 State of Art.... 4 1.4 Research Issues and Challenges.... 5 1.5 Figures.... 5 1.6 MATLAB OCR Toolbox.... 5 References....
More informationBehaviour Patterns Evolution on Individual and Group Level. Stanislav Slušný, Roman Neruda, Petra Vidnerová. CIMMACS 07, December 14, Tenerife
Behaviour Patterns Evolution on Individual and Group Level Stanislav Slušný, Roman Neruda, Petra Vidnerová Department of Theoretical Computer Science Institute of Computer Science Academy of Science of
More informationGenetic Identity and
Genetic Identity and GACATGTAGCTCTTCACTTCACCCAGGTTGGGTTGTGTCAACAGGAAACATTGTAACATATCACTTGGATTAGCACCTAGG/TTAT/TTAT/TTA Community DTC Genetic Testing Workshop The National Academies' August 31 September 1,
More informationAN ANN BASED FAULT DETECTION ON ALTERNATOR
AN ANN BASED FAULT DETECTION ON ALTERNATOR Suraj J. Dhon 1, Sarang V. Bhonde 2 1 (Electrical engineering, Amravati University, India) 2 (Electrical engineering, Amravati University, India) ABSTRACT: Synchronous
More informationAnalysis of Learning Paradigms and Prediction Accuracy using Artificial Neural Network Models
Analysis of Learning Paradigms and Prediction Accuracy using Artificial Neural Network Models Poornashankar 1 and V.P. Pawar 2 Abstract: The proposed work is related to prediction of tumor growth through
More informationKnowledge discovery & data mining Classification & fraud detection
Knowledge discovery & data mining Classification & fraud detection Knowledge discovery & data mining Classification & fraud detection 5/24/00 Click here to start Table of Contents Author: Dino Pedreschi
More informationSeismic fault detection based on multi-attribute support vector machine analysis
INT 5: Fault and Salt @ SEG 2017 Seismic fault detection based on multi-attribute support vector machine analysis Haibin Di, Muhammad Amir Shafiq, and Ghassan AlRegib Center for Energy & Geo Processing
More informationarxiv: v1 [cs.lg] 2 Jan 2018
Deep Learning for Identifying Potential Conceptual Shifts for Co-creative Drawing arxiv:1801.00723v1 [cs.lg] 2 Jan 2018 Pegah Karimi pkarimi@uncc.edu Kazjon Grace The University of Sydney Sydney, NSW 2006
More informationThe Bead. beadarray: : An R Package for Illumina BeadArrays. Bead Preparation and Array Production. Beads in Wells. Mark Dunning -
beadarray: : An R Package for Illumina BeadArrays Mark Dunning - md392@cam.ac.uk PhD Student - Computational Biology Group, Department of Oncology - University of Cambridge Address The Bead Probe 23 b
More informationSynthetic View Generation for Absolute Pose Regression and Image Synthesis: Supplementary material
Synthetic View Generation for Absolute Pose Regression and Image Synthesis: Supplementary material Pulak Purkait 1 pulak.cv@gmail.com Cheng Zhao 2 irobotcheng@gmail.com Christopher Zach 1 christopher.m.zach@gmail.com
More informationOutline. Artificial Neural Network Importance of ANN Application of ANN is Sports Science
Advances of Neural Networks in Sports Science Aviroop Dutt Mazumder 13 th Aug, 2010 COSC - 460 Sports Science Outline Artificial Neural Network Importance of ANN Application of ANN is Sports Science Modeling
More informationUSING EMBEDDED PROCESSORS IN HARDWARE MODELS OF ARTIFICIAL NEURAL NETWORKS
USING EMBEDDED PROCESSORS IN HARDWARE MODELS OF ARTIFICIAL NEURAL NETWORKS DENIS F. WOLF, ROSELI A. F. ROMERO, EDUARDO MARQUES Universidade de São Paulo Instituto de Ciências Matemáticas e de Computação
More informationUniversity of Washington, TOPMed DCC July 2018
Module 12: Comput l Pipeline for WGS Relatedness Inference from Genetic Data Timothy Thornton (tathornt@uw.edu) & Stephanie Gogarten (sdmorris@uw.edu) University of Washington, TOPMed DCC July 2018 1 /
More informationSolving and Analyzing Sudokus with Cultural Algorithms 5/30/2008. Timo Mantere & Janne Koljonen
with Cultural Algorithms Timo Mantere & Janne Koljonen University of Vaasa Department of Electrical Engineering and Automation P.O. Box, FIN- Vaasa, Finland timan@uwasa.fi & jako@uwasa.fi www.uwasa.fi/~timan/sudoku
More informationStock Market Indices Prediction Using Time Series Analysis
Stock Market Indices Prediction Using Time Series Analysis ALINA BĂRBULESCU Department of Mathematics and Computer Science Ovidius University of Constanța 124, Mamaia Bd., 900524, Constanța ROMANIA alinadumitriu@yahoo.com
More informationAUTOMATED MALARIA PARASITE DETECTION BASED ON IMAGE PROCESSING PROJECT REFERENCE NO.: 38S1511
AUTOMATED MALARIA PARASITE DETECTION BASED ON IMAGE PROCESSING PROJECT REFERENCE NO.: 38S1511 COLLEGE : BANGALORE INSTITUTE OF TECHNOLOGY, BENGALURU BRANCH : COMPUTER SCIENCE AND ENGINEERING GUIDE : DR.
More informationDeep Learning Convolutional Neural Networks for Radio Identification
1 Deep Learning Convolutional Neural Networks for Radio Identification Shamnaz Riyaz, Kunal Sankhe, Stratis Ioannidis, and Kaushik Chowdhury Electrical and Computer Engineering Department, Northeastern
More informationMSc(CompSc) List of courses offered in
Office of the MSc Programme in Computer Science Department of Computer Science The University of Hong Kong Pokfulam Road, Hong Kong. Tel: (+852) 3917 1828 Fax: (+852) 2547 4442 Email: msccs@cs.hku.hk (The
More informationOptimization of Tile Sets for DNA Self- Assembly
Optimization of Tile Sets for DNA Self- Assembly Joel Gawarecki Department of Computer Science Simpson College Indianola, IA 50125 joel.gawarecki@my.simpson.edu Adam Smith Department of Computer Science
More informationNEURALNETWORK BASED CLASSIFICATION OF LASER-DOPPLER FLOWMETRY SIGNALS
NEURALNETWORK BASED CLASSIFICATION OF LASER-DOPPLER FLOWMETRY SIGNALS N. G. Panagiotidis, A. Delopoulos and S. D. Kollias National Technical University of Athens Department of Electrical and Computer Engineering
More informationPrediction of airblast loads in complex environments using artificial neural networks
Structures Under Shock and Impact IX 269 Prediction of airblast loads in complex environments using artificial neural networks A. M. Remennikov 1 & P. A. Mendis 2 1 School of Civil, Mining and Environmental
More informationDeep Learning. Dr. Johan Hagelbäck.
Deep Learning Dr. Johan Hagelbäck johan.hagelback@lnu.se http://aiguy.org Image Classification Image classification can be a difficult task Some of the challenges we have to face are: Viewpoint variation:
More informationUsing Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM
Using Y-DNA for Genealogy Debbie Parker Wayne, CG, CGL SM This is one article of a series on using DNA for genealogical research. There are several types of DNA tests offered for genealogical purposes.
More informationFault Location Using Sparse Wide Area Measurements
319 Study Committee B5 Colloquium October 19-24, 2009 Jeju Island, Korea Fault Location Using Sparse Wide Area Measurements KEZUNOVIC, M., DUTTA, P. (Texas A & M University, USA) Summary Transmission line
More informationThe Next Generation Science Standards Grades 6-8
A Correlation of The Next Generation Science Standards Grades 6-8 To Oregon Edition A Correlation of to Interactive Science, Oregon Edition, Chapter 1 DNA: The Code of Life Pages 2-41 Performance Expectations
More informationA TWO-PART PREDICTIVE CODER FOR MULTITASK SIGNAL COMPRESSION. Scott Deeann Chen and Pierre Moulin
A TWO-PART PREDICTIVE CODER FOR MULTITASK SIGNAL COMPRESSION Scott Deeann Chen and Pierre Moulin University of Illinois at Urbana-Champaign Department of Electrical and Computer Engineering 5 North Mathews
More informationGEDmatch Home Page The upper left corner of your home page has Information about you and links to lots of helpful information. Check them out!
USING GEDMATCH Created March 2015 GEDmatch is a free, non-profit site that accepts raw autosomal data files from Ancestry, FTDNA, and 23andme. As such, it provides a large autosomal database that spans
More informationBehavior Emergence in Autonomous Robot Control by Means of Feedforward and Recurrent Neural Networks
Behavior Emergence in Autonomous Robot Control by Means of Feedforward and Recurrent Neural Networks Stanislav Slušný, Petra Vidnerová, Roman Neruda Abstract We study the emergence of intelligent behavior
More informationDeep learning architectures for music audio classification: a personal (re)view
Deep learning architectures for music audio classification: a personal (re)view Jordi Pons jordipons.me @jordiponsdotme Music Technology Group Universitat Pompeu Fabra, Barcelona Acronyms MLP: multi layer
More information